the repeating segments seen in a skeletal muscle fiber are the t tubules. T/F?

Answers

Answer 1

The repeating segments seen in a skeletal muscle fiber are the t tubules, The given statement is false.

The repeating segments seen in a skeletal muscle fiber are called sarcomeres, not T tubules. Sarcomeres are the basic structural units of muscle fibers and are responsible for muscle contraction.

They consist of overlapping thick and thin filaments, which slide past each other during contraction. T tubules, on the other hand, are invaginations of the sarcolemma (cell membrane) that help transmit action potentials deep into the muscle fiber, allowing for synchronized muscle contraction. While T tubules are an important component of muscle fibers, they are not the repeating segments themselves.

To know more about sarcomere:

https://brainly.com/question/6908670

#SPJ11


Related Questions

PLEASE HELP! 20 POINTS!! Explain how genes relate to the presence of dominant and recessive traits

Answers

Answer:

Fires often remove alien plants that compete with native species for nutrients and space, and remove undergrowth, which allows sunlight to reach the forest floor, thereby supporting the growth of native species. ... Overall, fire is a catalyst for promoting biological diversity and healthy ecosystems.

Explanation:

Students are observing two families of ducks living in the school pond. They decide to do a scientific investigation that involves the ducks. The students have only one class period to complete the investigation. Which of the following is a valid hypothesis the students could investigate?
A.
Ducklings think humans are funnier than adult ducks do.
B.
Ducks first came to the pond due to its high level of water quality.
C.
Ducklings will likely move to a new pond when they are fully grown.
D.
Ducks from different families will not feed within 10 feet of one another.

Answers

Answer:

D ducks from different families will not feed within 10 feet of one another.

Explanation:

this is the only investigation he could do in one class period all of the other ones will take days or years

QUICK! 30 POINTS

D is crossed out because it is wrong.

QUICK! 30 POINTSD is crossed out because it is wrong.

Answers

Answer:

C. There is a loss in energy

Explanation:

what do you mean by acrophobia and ephebiphobia?​

Answers

Answer:

Acrophobia ------- intense fear of heights

Ephebiphobia -----the fear of youth

Answer:

Acrophobia means extreme or irrational fear of height .Ephebiphobia is the fear of youth

hope your day goes great.

How does the leafy shoot of
the strangler fig affect the tree
it is growing around?

Answers

Answer:

Once established, the young strangler figs begin sending aerial roots down to the ground, where they quickly dive into the soil and anchor themselves. Once in contact with the ground, the fig enters a growth spurt, plundering moisture and nutrients that the host tree needs

Explanation:

Once in contact with the ground, the fig enters a growth spurt, plundering moisture and nutrients that the host tree needs.

During one point in the eukaryotic cell cycle, the nuclear membrane disassembles. Which process in the cell cycle occurs before the nuclear membrane disassembles

Answers

The process in the cell cycle that occurs before the nuclear membrane disassembles is the prophase. The cell cycle is the process that cells undergo to replicate themselves, leading to the formation of two daughter cells. The cell cycle has four stages: G1, S, G2, and M. The G1, S, and G2 phases are collectively known as interphase.

The cell undergoes the mitotic phase (M-phase) after the interphase, and this phase involves mitosis and cytokinesis. Mitosis is the process of dividing the nucleus, and cytokinesis is the process of dividing the cytoplasm. The nuclear membrane begins to disassemble during prophase, which is the first stage of mitosis.In the prophase stage of mitosis, the chromatin condenses into chromosomes, and each chromosome consists of two identical sister chromatids that are held together at the centromere.

The centrosomes move to the poles of the cell and begin to produce spindle fibers that attach to the centromeres. The nuclear membrane begins to disassemble, and the nucleolus disappears.The next stage is metaphase, during which the chromosomes line up in the center of the cell. During the anaphase, the sister chromatids separate and are pulled to opposite poles of the cell by the spindle fibers.

During telophase, the spindle fibers disassemble, and the nuclear membrane reforms around the two groups of chromosomes. The nucleolus reappears, and the chromosomes begin to uncoil back into chromatin. Finally, cytokinesis occurs, resulting in the formation of two daughter cells.

For more such questions on cell cycle

https://brainly.com/question/7196669

#SPJ8

HELP GIVING BRAINIEST!


escribe an adaptation to a plant's physical characteristic and explain how this adaptation helps the plant survive.

explain.

Answers

Answer:

so like a plant that loses leaves in the fall does so because it won't have sun in the winter. then they grow back. it adapts to the environment

Answer:

Pi is a number that is approximated by 3.14, or 22/7. It is the ratio of the circumference to the diameter of any circle. This ratio can be rearranged to find circumference of a circle by multiplying pi times diameter.

Explanation:

yeah i missed the answer just to get that and this guy talking about PLANTS. N e ways there u go.

You have a plant that you want to show off at a party. The party happens during autumn (aka fall). Usually in autumn (aka fall) the leaves of your plant fall off. You want to delay the leaves falling off your plant until after the party. What plant hormone would you use to help keep the leaves on? ethylene O cytokinins O gibberellins auxin

Answers

Answer:

Auxins

Explanation:

Auxin is a plant hormone that has to do with both leaf and fruit fall.

DNA encodes proteins, specifying the amino acids that compose them. Which of the following is most similar to a protein as the protein is being constructed?
A. computer program
B. files in a drawer
C. A set of tools
D. A string of beads

Answers

D:A string of beads is the
The answer is D.) A string of beads .

If a DNA strand with the sequence GGCATGCCTATGCGA is transcribed, which of the following accurately represents the newly synthesized mRNA strand?
a. CCGTACGGATACGCT
b. GGCATGCCTATGCGA
c. CCGUACGGAUACGCU
d. CCGAUCGGUAUCGCA

Answers

The newly synthesized mRNA strand from the given DNA strand is CCGUACGGAUACGCU. So, the correct answer is c. CCGUACGGAUACGCU.

To determine the newly synthesized mRNA strand from the DNA strand with the sequence GGCATGCCTATGCGA, you need to transcribe the DNA strand into an mRNA strand.

Step 1: Understand the transcription process. During transcription, the DNA sequence is converted into a complementary mRNA sequence using the following base pairing rules: Adenine (A) pairs with Uracil (U), Guanine (G) pairs with Cytosine (C), and vice versa.

Step 2: Transcribe the DNA strand. Use the base pairing rules to transcribe the DNA strand (GGCATGCCTATGCGA) into an mRNA strand:

DNA:  G  G  C  A  T  G  C  C  T  A  T  G  C  G  A
mRNA: C  C  G  U  A  C  G  G  A  U  A  C  G  C  U

So, the newly synthesized mRNA strand from the given DNA strand is CCGUACGGAUACGCU.

Learn more about mRNA at https://brainly.com/question/12388408

#SPJ11

29.
In the dihybrid cross AaBb aabb, how many heterozygotes for both gene pairs are found among the F1 offspring?
A)
one
B)
two
C)
three
D)
four
E)
five

Answers

In a dihybrid cross, two traits are studied simultaneously. In this case, the two traits are A and B. The parental generation is AaBb aabb.

When these gametes combine, they produce an F1 generation with the genotype AaBb. The question is asking how many heterozygotes for both gene pairs are found among the F1 offspring. Heterozygotes have two different alleles for a particular gene, while homozygotes have two identical alleles. In this case, the F1 offspring are heterozygous for both genes, so the answer is D) four. This is because each parent is heterozygous for both genes, so all of the offspring inherit one dominant and one recessive allele for each gene. Therefore, all of the F1 offspring are heterozygotes for both gene pairs.

TO know more about homozygotes refer :

https://brainly.com/question/29455764

#SPJ11

Can you guys pls help me?!!! It’s due tonight put them in order pls :)

Can you guys pls help me?!!! Its due tonight put them in order pls :)

Answers

1) I
2) E
3) F
4) H
5) A
6) B
7) J
8) G
9) C
10) D

The survival of a living organism occurs when what?

Answers

Answer:

Every organism has a unique ecosystem within which it lives. This ecosystem is its natural habitat. This is where the basic needs of the organism to survive are met: food, water, shelter from the weather and place to breed its young. All organisms need to adapt to their habitat to be able to survive.

Explanation:

I think this type of ans. u want bcoz apne mention nhi kra

Persons who eat 18-30 grams of ________ are less likely to suffer from constipation, diverticulosis, heart disease, obesity, diabetes mellitus, and certain cancers, compared to those who eat minimal amounts.
A) fiber
B) sugar substitutes
C) carbohydrate substitutes
D) carbon nutrients

Answers

Answer:

A.) Fiber

Explanation:

Got from Quizlet...

Hope this Helps!

may someone please help me?​

may someone please help me?

Answers

Answer:

15. BB, Bb

16. bb

19. tt

20. TT, Tt

(17 and 18 are given).

Explanation:

g a viral neutralization test detects: group of answer choices vaccine antigens cytokines produced in response to virus infection. virus in patient samples. cytopathic effect on patient cells. patient antibodies specific for a virus.

Answers

The serum virus neutralisation (SVN) assay is a serological test used to detect the presence and magnitude of functional systemic antibodies that prevent the infectivity of a virus. The SVN assay is a highly sensitive and specific test that may be applied to influenza A viruses (IAV) in swine to measure the titer of neutralizing antibodies post-exposure, post-vaccination, or after passive transfer of maternally derived antibodies (MDA).

Neutralization tests are one of the most commonly used methods for quantifying antibodies against rabies virus (RABV). Conventional SVN methods performed in vitro are based on the inhibition of virus infectivity in cell culture in the presence of neutralizing antibodies in serum.

The SVN assay is relatively inexpensive using standard laboratory equipment, although it requires cell structure, more time and labour, and technical skill to conduct the assay compared to other serological methods.

Learn more about the neutralization test here:

https://brainly.com/question/28144910

#SPJ4

beginning with one double-stranded dna molecule and assuming perfect efficiency, how many double-stranded molecules will there be after four pcr cycles?

Answers

In the polymerase chain reaction (PCR), starting with one double-stranded DNA molecule and assuming perfect efficiency, after four PCR cycles, the number of double-stranded DNA molecules would be 16.

PCR is a widely used technique for amplifying specific DNA sequences. Each PCR cycle involves denaturation of the DNA template, primer annealing, and extension by DNA polymerase. During the first cycle, the initial DNA molecule is duplicated, resulting in two molecules. In the second cycle, each of the two molecules is duplicated, yielding a total of four molecules. This doubling continues with each subsequent cycle, so by the fourth cycle, there would be 16 double-stranded DNA molecules. It's important to note that these calculations assume ideal conditions and perfect efficiency, which may not be achievable in practice due to various factors influencing PCR efficiency.

Learn more about amplifying

https://brainly.com/question/32812082

#SPJ11

Which of the following statements is correct about air temperature?

When air temperature is higher, the weather is warmer.
Warm air falls to the ground.
Freezing air temperatures increase the chances of rain.
When air temperature is higher, the weather is colder.

Answers

Answer:

Answer is freezing air temperatures increases the chances of rain

Explanation:

Answer:

When air temperature is higher, the weather is warmer

Do haploid or diploid cells contain DNA?

Answers

Answer:

diploid

Explanation:

A diploid cell is a cell that contains two complete sets of chromosomes. This is double the haploid chromosome number. Each pair of chromosomes in a diploid cell is considered to be a homologous chromosome set.

What makes birds and planes similar and different.?

Answers

Answer:

Airplanes have wings, just like birds. They also have a light skeleton (or framework) to decrease their weight, and they have a streamlined shape to decrease drag. The big difference is that airplanes do not flap their wings.

can sum1 help me wit dis

can sum1 help me wit dis

Answers

Hello, this is the completion: UUC CGA UAG UCG CUC GCA ACU ACG CGC UGH AGA ACU Hope this help, please double check before submitting:)

which is the largest cell​

Answers

Answer:

Neurons are the largest cells.

Even among those, the ones which come out of the spine and reach every part of your body.

And every part of your body is attached to your spine with a single neuron, which is also a single cell.

So from the tips of your finger runs a single neuron which goes all the way to your spine, yes, a single cell which is few feet in length.

Explanation:

The largest cell is Ovum in the human body

when a protein is denatured, which type of interaction will not be broken? select any term that applies

Answers

During the denaturation of proteins, the secondary and tertiary arrangements get eradicated, and solely the peptide bond of the primary structure is maintained.

Because the denaturation reaction is not intense and its vitality is not adequate to crack the peptide bond. We must have to understand that the protein structure in amino acid chain molecules is organized in a three-dimensional way. The proteins are constructed by the condensation reaction of amino acids. And during the condensation reaction, there is a loss of water molecules and it will bind with the peptide bond. The secondary structure of protein contains hydrogen bonds. And during the denaturation procedure, the intermolecular hydrogen bond will break.

To learn more about protein denaturation visit here:

https://brainly.com/question/10887788

#SPJ4

when does land breeze blow and why?​

Answers

A land breeze is a local nighttime and early morning wind that occurs along coasts and blows offshore (from the land out to sea). It arises at sunset when the sea surface is warmer than the adjacent land due to the land having a lower heat capacity and cooling off faster.

Changes in body size or beak shape to avoid competition with another similar species is termed:
a) Mutualism b) Resource partitioning c) Adaptive radiation d) Coevolution

Answers

The Resource partitioning refers to the process in which similar species adapt to avoid competition for limited resources. In the case of changes in body size or beak shape, one species may adapt to feed on a different part of a shared resource.

The lead to a reduction in competition and an increase in the diversity of species within an ecosystem. Adaptive radiation is a process in which a single species evolves into multiple new species that occupy different ecological niches. Coevolution refers to the process in which two or more species evolve in response to each other, often resulting in a close and mutually beneficial relationship. Mutualism refers to a type of symbiotic relationship in which both species benefit from the interaction. Overall, resource partitioning is an important mechanism that allows for the coexistence of multiple species within an ecosystem. By adapting to different niches and resources, species can avoid competition and increase their chances of survival and reproduction.

learn more about Resource partitioning here.

https://brainly.com/question/668308

#SPJ11

Tomas investigates coloured lights.
(a) Tomas shines red, green and blue light onto a green object.
He draws a diagram to help explain what happens.
-red light
green light
green object
blue light
(1) What colour does the object appear?
[1]
(11) Explain what happens at the surface of the green object.
[2]

Answers

The object will appear green because it will absorb the other colours of light and reflect the green light back into our eyes please award brainliest

Why is the planet Earth capable of sustaining all three forms of water
Position of Earth to the Sun
O Rotation of the Earth throughout the day
Movement of the material in the inner core
Revolution of the Moon around the Earth

Answers

While Earth orbits the sun, the planet is simultaneously spinning on an Length of year (single revolution around the sun): 365.26 days while the inner core is solid; it's about four-fifths as big as Earth's moon.

Hope this helped!!

Study the map.



Which plate forms a boundary with the African Plate?

Pacific
South American
Nazca
Philippine

Answers

Answer:

south american.......

There are different kinds of tectonic plates. The plate forms a boundary with the African Plate is South American.

A tectonic plate is simply known as a plate that consist of solid rock with set of irregular shapes.

The African plate is known to be made up of all of Africa and the surrounding ocean. They are share boundary withSouth America plate, Antarctic plate, Eurasia plate, North America plate etc.

Other tectonic plates includes:

Antarctic PlateEurasian PlateIndo-Australian PlateNorth American PlateSouth American Plate

Learn more about Plate from

https://brainly.com/question/11542091

WILL GIVE BRAINLIST!!!! What effects do weathering, erosion, and deposition have on agriculture in Texas?

Answers

Answer:

cause the soil to become less fertile therefore causing the loss of nutrients and farmers can no longer plant crops causing profits to drop.

Explanation:

What is the structure of a genome?

Answers

Answer:

A genome is composed of one or more DNA molecules, each organized as a chromosome.

Explanation:

Answer:

A genome is composed of one or more DNA molecules, each organized as a chromosome.

Prokaryotic genomes are mostly single circular chromosomes.

Eukaryotic genomes contain nuclear and organellar components. The nuclear complement of the genome consists of one or two sets of linear chromosomes.

Explanation:

Other Questions
due to the movement of surface ocean water in the north atlantic gyre, which coastline would have warmer and more humid climates? During 20X1, Jacinta Manufacturing Company (JMC) declared and paid cash dividends of $10,000. Late in the year, JMC bought new welding machinery for a cash cost of $125,000, financed partly by its first issue of long-term debt. Interest on the debt is payable annually. JMC sold several old machines for cash equal to their aggregate book value of $5,000. The company pays taxes in cash as incurred. The following data are in thousands: Jacinta Manufacturing Company Income Statement for the Year Ended December 31, 20X1 Sales $490 Cost of sales 300 Gross margin 190 Salaries $82 Depreciation 40 Cash operating expenses 15 Interest 2 139 Income before taxes 51 Income taxes 8 Net income $ 43 OBJECTIVE 5 OBJECTIVE 5 ASSIGNMENT MATERIAL 227 Jacinta Manufacturing Company Balance Sheets December 31 Increase 20X1 20X0 (Decrease) Assets Cash and cash equivalents $125 $ 45 $ 80 Accounts receivable 45 60 (15) Inventories 57 62 (5) Total current assets 227 167 60 Fixed assets, net 190 110 80 Total assets $417 $277 $140 Liabilities and Stockholders Equity Accounts payable $ 26 $ 21 $ 5 Interest payable 2 2 Long-term debt 100 100 Paid-in capital 220 220 Retained earnings 69 36 33 Total liabilities and stockholders equity $417 $277 $140 Prepare a statement of cash flows for 20X1. Use the direct method for reporting cash flows from operating activities. Omit supporting schedules. Assume that Jacinta paid expense items in cash unless balance sheet changes indicate otherwise. What is the opposite of 9.28HELP A DNA strand with the sequence 5 AGCTAGACGCATCCTAATGGCCACTGAATCCTGAATGGACGA 3 is transcribed. What is the sequence of the beginning of the mRNA molecule synthesized (assume transcription starts at the first base and there is no need for a promoter)? You might need to write out the other strand of DNA (or you might be able to do this without that step).a. 5 -AGCUAGAb. 5 -AGCTAGAc. 5 -TCGATCTd. 5 -UCGAUC What's the superstition seven significance in The Crucible? Solve the equations: 1) 3a + 11 + 2(a-5) = 6a+ 1 2) 2(x+8)-3(x - 2) = 10 + x Solve the problems: 3) Two-third of a number is four more than 12. Find the number 4) The perimeter of a rectangle is 72 units, the length of the rectangle is 4 units more than the width. Find the area of the rectangle. 5) Find the measure of each angle in the following triangle 6) Write and solve an equations similar to 5x + 12 = 9x + 16 with solution x = 0 7) Write and solve an equations similar to 4+ 10x = 36 + 12x with solution x = -9 Crop yield is the ratio of the number of bushels harvested to the number of acres used for the harvest. This year, the harvest at a farm was 9,396 bushels of soybeans, resulting in a crop yield of 40.5 bushels per acre.To the nearest whole acre, how many acres were harvested?232 acres252 acres285 acres295 acres If Chidi Anagonye's computer still won't work; I willlet him borrow mine for a few days. PLEASE ANSWER WITH (A P E X) ANSWERAn appeal of a district court ruling can next be made to:O A. a U.S. Court of Appeals.OB. a state trial court.C. the U.S. Supreme Court.D. a state appellate court. PLS HURRY TIMED!!! In a Marxist context, how could the owners change to better serve the workers and avoid conflict?Share more profit with the workers.Instill a sense of pride in the workers.Require the workers to have safe conditions.Provide the workers with breaks more often. In ________, carbohydrates are broken down into CO2 and water when they combine with atmospheric oxygen. Given WY with W(3,7) and Y(13.-8), if X partitions WY such that the ratio of WX to XY is 3:2, find the coordinates of X. Which of the following points is the fourth vertex needed to create a rectangle with vertices located at (25, 18), (13, 9), and (25, 9)? (13, 9) (13, 18) (25, 9) (25, 18) a nurse is preparing for a class discussion on sexually transmitted infections (stis) to be given at a local high school. which would the nurse include as a discussion priority? The large rectangle below represents one whole.What percent is represented by the shaded area?% Help math math math Which of the following equations has a slope of 5 and y-intercept of 4 ? The process by which the movement of internal bonds converts one type of organic compound into another is How did Radical Republicans react to Abraham Lincolns plan for Reconstruction?They thought it would be too expensive.They thought it went too easy on the South.They thought it punished the South too much.They thought it would be too slow to put into effect. jjc~l'ds~ 3.5 let p {x e r3 i xl x2 x3 = 1, x o} and consider the x = (0,0,1). find the set of feasible directions at x.