the ranking from highest to lowest po2 in the area of the arterial ends of the tissue capillaries is?

Answers

Answer 1

The ranking from highest to lowest PO2 in the area of the arterial ends of the tissue capillaries is as follows: arterial blood > tissue interstitial fluid > venous blood.

Arterial blood has the highest PO2 as it is freshly oxygenated from the lungs. As the blood travels through the tissue capillaries, oxygen diffuses into the interstitial fluid and is taken up by the cells, lowering the PO2 in the interstitial fluid. Finally, the blood that has passed through the tissue capillaries and picked up carbon dioxide has a lower PO2 and returns to the heart via the veins.

More on tissue capillaries: https://brainly.com/question/30875267

#SPJ11


Related Questions

What do geologists look for in a geologic cross - section to prove that an igneous intrusion is younger than the rock it is in?

Answers

Answer:

The principle of cross-cutting relationships states that a fault or intrusion is younger than the rocks that it cuts through

Explanation:

please mark brainlist

Raphael volunteers as a Big Brother. He donates money to charity, and he helps his elderly next-door neighbor with weekly shopping and home repairs. Raphael's personality is

Answers

Raphael volunteers as a Big Brother. He donates money to charity, and he helps his elderly next-door neighbor with weekly shopping and home repairs. Raphael's personality is altruistic.

Raphael's personality is characterized by altruism and compassion. He demonstrates empathy and a willingness to help others through his volunteer work and charitable donations. His actions indicate a sense of responsibility and a genuine concern for the well-being of others, particularly those in need. Raphael's consistent engagement in acts of kindness and support, such as assisting his elderly neighbor with shopping and home repairs, highlights his pro-social nature.

These behaviors reflect a compassionate and caring personality, where he actively seeks opportunities to make a positive impact in the lives of others. Raphael's actions align with the traits associated with altruistic individuals who prioritize the welfare of others and exhibit a strong sense of empathy and social responsibility.

To learn more about personality, here

https://brainly.com/question/31248602

#SPJ4

Anyone knows this one?
Help please!!!!!

Anyone knows this one?Help please!!!!!

Answers

Answer:

Mitosis results in two diploid daughter cells that have the same genetic makeup.

Meiosis results in four haploid cells that are all genetically different from each other.

What is the relationship between he motion of molecules and the kinetic energy of the particles? PLS IT IS IMPORTANT!

Answers

Answer:

an increase in the temperature will increase the average kinetic energy of the molecules which causes the molecules to move faster

Which change is most likely to directly interfere with cytokinesis in a dividing animal cell?.

Answers

A mutation in the gene that encodes actin is most likely to directly interfere with cytokinesis in a dividing animal cell.

We can define cytokinesis as a process by which the cytoplasm of a cell divides.

Actin is the microfilament that is essentially required for the process of cytokinesis to occur.

If the actin is not present, the cytoplasm will not be able to separate in a polarized way.

Hence, if a gene that is coding for actin becomes mutated, then there will be problems in the cytokinesis process of cell division.

Although a part of your question is missing, you might be referring to this question:

Which change is most likely to directly interfere with cytokinesis in a dividing animal cell?

- A mutation in the gene that encodes actin

- A mutation in the RB gene

- A mutation that affects the G2-M cyclin-CDK complex

- The loss of a lysine residue in a histone protein

- A mutation that affects the S cyclin-CDK complex

To learn more about cytokinesis, click here:

https://brainly.com/question/314066

#SPJ4

Non communicable diseases are more dangerous than communicable diseases. give any four reasons. ​

Answers

They include age, gender, genetics, exposure to air pollution, and behaviors such as smoking, unhealthy diet and physical inactivity which can lead to hypertension and obesity, in turn leading to increased risk of many NCDs. Most NCDs are considered preventable because they are caused by modifiable risk factors.

1. Which of the following is an example of sensitization:
You blink each time your eye doctor gives you a puff of air in your eyes.
A dog was hit by his previous owner, and now the dog cowers each time his new owner reaches out to pet him.
You no longer feel your shirt touching your skin.
You're walking on the sidewalk and a bicyclist almost hits you, so you jump out of the way.

Answers

The example of sensitization from the given alternatives is that 'A dog was hit by his previous owner, and now the dog cowers each time his new owner reaches out to pet him.'

Sensitization refers to the process in which an organism becomes more sensitive to stimuli, both good and bad. It happens when the body's nervous system becomes oversensitized to a particular stimulus that it begins to respond even to weaker or non-threatening stimuli.

The example given in the first option refers to a simple reflex action that occurs in response to the puff of air that is blown into the eyes during the eye examination. The third option is about sensory adaptation, which occurs when sensory receptors are exposed to stimuli for an extended period, resulting in a reduction in sensitivity. The fourth option refers to the fight or flight response that occurs as a result of a threatening stimulus, in which an individual's body prepares to confront or flee from danger.

Learn more about Sensitization here: https://brainly.com/question/30793640

#SPJ11

How did Kepler’s discoveries contribute to astronomy?

They supported the heliocentric model.
They established the laws of planetary motion.
They explained how the Sun rises and sets.
They made astronomy accessible to people who spoke Italian.

Answers

Answer:

B

Explanation:

How did Kepler’s discoveries contribute to astronomy?

They supported the heliocentric model.

They established the laws of planetary motion.

They explained how the Sun rises and sets.

They made astronomy accessible to people who spoke Italian.

A type of differential reproduction that results from variable success in obtaining mates is called:__________

Answers

Sexual selection. -differential reproduction that results from variable success in obtaining mates. • Leads to secondary sexual characteristics (features in different sexes) secondary sexual characteristics. result of sexual selection, features that differ among sexes but aren't directly part of reproductions.

Protein translocation differs from protein secretion in that __________.
a. translocation refers to movement from the cytoplasm to or across the plasma membrane, whereas secretion refers to movement of the protein to the exterior of the cell
b. translocation refers to movement of the protein to the exterior of the cell, whereas secretion refers to movement from the cytoplasm to or across the plasma membrane
c. translocation refers to movement from one side of the cell to the other, whereas secretion refers to movement across the LPS layer
d. translocation refers to movement of proteins in Gram-positive bacteria, whereas secretion refers to movement of proteins in Gram-negative bacteria

Answers

Protein translocation differs from protein secretion in that Translocation refers to movement from the cytoplasm to or across the plasma membrane, whereas secretion refers to movement of the protein to the exterior of the cell. (Option a)

Protein translocation and protein secretion are two different processes that involve the movement of proteins within or across cellular membranes.

Protein translocation refers to the movement of proteins from the cytoplasm to a specific location within the cell or across the plasma membrane. It can involve the insertion of proteins into the endoplasmic reticulum (ER) membrane, transport into mitochondria or chloroplasts, or movement across other organelle membranes. Translocation typically occurs during protein synthesis and involves the guidance of signal sequences that direct the protein to the appropriate destination.

On the other hand, protein secretion refers to the movement of proteins from the cytoplasm to the exterior of the cell. This process involves the transport of proteins through the endoplasmic reticulum, Golgi apparatus, and secretory vesicles, eventually releasing the proteins outside the cell. Protein secretion is important for the release of various molecules such as hormones, enzymes, and antibodies into the extracellular space.

Therefore, option a. accurately describes the difference between protein translocation and protein secretion, where translocation refers to movement from the cytoplasm to or across the plasma membrane, while secretion refers to movement of the protein to the exterior of the cell.

To know more about translocation follow the link:

https://brainly.com/question/32271170

#SPJ4

Contast h0m0zyg0u and h3t3r0zyg0u.​

Answers

Answer:

i need points

Explanation:

cool question

the fundamental reproductive cell produced by fungi is the _______.

Answers

I think the answer is spore hope this helps

why is it impossible to completely sterilize the human skin

Answers

It is impossible to completely sterilize the human skin due to the presence of natural microbiota. The skin is the largest organ in the human body, and it is covered by a diverse microbial community, which includes bacteria, fungi, and viruses. This community is collectively known as the skin microbiome.

The skin microbiome plays an essential role in maintaining skin health by protecting against pathogens, regulating immune function, and preventing infection. Attempts to completely sterilize the skin can disrupt this delicate balance and cause damage to the skin's barrier function.

Although it is impossible to completely sterilize the skin, good hygiene practices such as regular hand washing and avoiding sharing personal items can help reduce the risk of transmitting harmful microorganisms. Additionally, medical professionals use various antiseptic techniques to minimize the risk of infection during invasive procedures such as surgery.

Overall, the natural microbiota of the skin makes complete sterilization impossible, but proper hygiene practices can help minimize the risk of infection.

For more such questions on Microbiome.

https://brainly.com/question/30150230#

#SPJ11

donker m, straver me, wesseling j, loo ce, schot m, drukker ca, et al. marking axillary lymph nodes with radioactive io- dine seeds fo

Answers

The purpose of marking axillary lymph nodes with radioactive iodine seeds is to aid in their localization and identification during surgical procedures, particularly in the context of breast cancer.

During breast cancer surgery, it is important to identify and remove the affected axillary lymph nodes for accurate staging and proper treatment planning. To facilitate this process, radioactive iodine seeds can be implanted in the axillary lymph nodes prior to surgery.

The radioactive iodine seeds emit radiation that can be detected using specialized equipment, such as a gamma probe, during the surgical procedure. This allows the surgeon to precisely locate and remove the marked lymph nodes, ensuring that all potentially cancerous nodes are appropriately excised.

By marking the axillary lymph nodes with radioactive iodine seeds, the procedure becomes more efficient and targeted. It helps reduce the risk of unnecessary lymph node removal while maximizing the likelihood of detecting and treating cancerous nodes.

Overall, marking axillary lymph nodes with radioactive iodine seeds improves the accuracy and success of axillary lymph node dissection in breast cancer surgery.

To learn more about lymph nodes, here

https://brainly.com/question/30960549

#SPJ4

The complete question is:

What is the purpose of marking axillary lymph nodes with radioactive iodine seeds?

over a span of 50 years, civil engineers built wildlife bridges to allow animals to safety cross highways that run through a forest. The first graph shows the change in the number of wildlife bridges during those 50 years . The second graph shows a deer population in the same area changed over the same period. Which hypothesis is supported by the data?

Answers

The hypothesis supported by the data is that the construction of wildlife bridges has positively impacted the deer population in the area.

The first graph shows an increasing trend in the number of wildlife bridges over the span of 50 years. This indicates that civil engineers have been actively constructing more bridges to facilitate safe animal crossings.

The second graph, depicting the deer population, shows an upward trend over the same period. This suggests that the deer population has increased over time.

Based on these two pieces of information, it can be inferred that the construction of wildlife bridges has provided a safe passage for deer and other wildlife, allowing them to move across the highways more freely and reducing the risk of road accidents and mortality.

This has likely contributed to the growth of the deer population in the area. The data supports the hypothesis that the implementation of wildlife bridges has had a positive impact on the deer population.

For more such answers on population

https://brainly.com/question/29885712

#SPJ8

3. How does a vaccine work? *
2 points
o
It trains your immune system to attack the disease causing agent before it makes you
sick
O It makes you a little sick so the disease worit make you feel sick next time.
Oh locks your cells' so diseases carít get in.
O i fills up your immune system with vitamins and minerals that fight disease.

Answers

A is the correct answer

In which part of the cell cycle do the mitotic spindles assemble, bind to chromosomes, and move the sister chromatids apart?​

In which part of the cell cycle do the mitotic spindles assemble, bind to chromosomes, and move the sister

Answers

Answer:

M phase

Explanation:

Answer:

b

Explanation:

Is 28 weeks pregnant considered 7 months?

Answers

Yes, 28 weeks pregnant is considered 7 months pregnant. Pregnancy is typically measured in weeks, with each month having approximately 4 weeks.

Therefore, at 28 weeks, a pregnant person is in their 7th month of pregnancy. It is worth noting that pregnancy is often divided into trimesters, with the 3rd trimester beginning at 28 weeks (or sometimes at 27 weeks). During the 7th month of pregnancy, which is around weeks 25-28, the fetus undergoes several important developments and the pregnant person experiences a number of physical and emotional changes. Here are some common developments and changes that occur during the 7th month of pregnancy. The pregnant person's belly is becoming noticeably larger, and they may experience back pain, swollen feet and ankles, and difficulty sleeping.

To learn more about pregnant, click here:

https://brainly.com/question/19053891

#SPJ4

How does homeostasis regulate body temperature?

Answers

It sends signals to your muscles that make your shiver and create warmth.

Silver is a solid and water is a liquid at room temperature. How do the particles of solid silver compare to the particles of liquid water?

Answers

Answer:

the particles of solid silver at room temperature are closer together and are colliding with each other more often therefore making it a solid. the particles of liquid water at room temperature are further apart and don't collide as often and have more room to move.

how are diffusion and endocytosis similar?

Answers

Endocytosis and exocytosis are similar in that they are both forms of cell transport. They differ because in endocytosis, a cell transports molecules into a cell (think: endo - in), and in exocytosis, the cell's molecules are transported by being expelled.

When you ice skate, the heat generated by the blade of the skate rubbing against the ice causes some of the ice right under the blade to melt. This water acts like a lubricant under the skate that allows the skate to slide.What causes the ice to melt under the blade?

Answers

Conversion of energy kinetic energy to thermal energy? only thing I can consider an answer

What happens to the air around your vocal cords when you speak?
a. It is heated
b. It is cooled
c. It is forced down your windpipe
d. It expands and contracts

Answers

D. It expands and contrasts

Hope this helps!!

There is a history of global temperatures changing, but why is this change different? (1 point)
O The Earth is getting cooler everywhere instead of warmer.
There are more species on the planet this time.
O This shift in temperature is happening more quickly.
O It is not different; this is a regular shift in temperature.

Answers

Answer:

1) high water temperatures and water acidity cause coral polyps to expel algae, causing them to turn white in color

2) acidic carbon dioxide dissolves in water, lowering the water's pH

3) the shift in temperature is happening more quickly

4) to protect itself from the sun

5) the biodiversity of the water

Explanation:

should be 100% on the quick check if you put those answers

There are different ranges in temperature.  Why is this change different  is because this shift in temperature is happening more quickly.

Why are temperature around the world different?

There are a lot of factors affecting temperature such has latitude. Most times, the places closer to the Earth's equator are said to be far warmer than those near to the poles.

The recent rise in temperature is said to be due to a new forcing. here, the greenhouse gas emissions from human activity, is said to have driven atmospheric CO2 to its highest level.

learn more about temperature  from

https://brainly.com/question/24746268

2. Why is there such a high rate of spontaneous mutation among the genes responsible for classic hemophilia, Duchenne muscular dystrophy, and achondroplasia

Answers

The genes responsible for classic hemophilia, Duchenne muscular dystrophy, and achondroplasia have a high rate of spontaneous mutation because these disorders are associated with sex-linked traits.

What is Spontaneous mutation?

Spontaneous mutation may be defined as a type of mutation which carries in the body of an organism naturally without any interference from mutagens.

The genes of the above-mentioned disorders have a high rate of spontaneous mutations because they are unaffected by any external mutagens and are sex-linked traits that are inherited from parents to their offspring.  

Hence, the genes of these disorders follow the path of spontaneous mutations.

Therefore, it is well described above.

To learn more about Spontaneous mutation, refer to the link:

https://brainly.com/question/10009244

#SPJ1

Which of the following is a benefit of recreation activities?
A. Water pollution
B. Social interaction
C. Noise pollution
D. The spreading of weeds

Answers

Answer:

C Noise pollution

Explanation:

because organisms create noise.

C noise pollution
I think

If there were 88 coins, how many gold coins were there?

If there were 88 coins, how many gold coins were there?

Answers

8 coins.

1/11 * 88coins = 8 gold coins

A mitosis inhibitor is a medication that is designed to prevent mitosis in certain cells. Why would these be helpful in treatment of tumors?

Answers

"Mitosis inhibitors are used to stop cells from dividing and replicating. Tumors are made up of cells that have uncontrolled growth and division, so mitosis inhibitors can be helpful in the treatment of tumors because they can stop the cells in the tumor from dividing and growing. By preventing the tumor cells from replicating, the growth of the tumor can be slowed down or even stopped, which can be an important step in the treatment of cancer. Some examples of mitosis inhibitors include taxanes, vinca alkaloids, and paclitaxel, which are used in chemotherapy to treat a variety of cancers. However, it's worth noting that mitosis inhibitors can also affect healthy cells that divide rapidly, such as hair follicles and cells lining the gastrointestinal tract, which can cause side effects like hair loss and digestive problems." (ChatGPT, 2023)

why do cells need to regulate what goes in and out of them?

Answers

my Answer:

These molecules are essential for living things. The cell membrane controls what goes in and out by having protein channels that act like funnels in some cases and pumps in other cases. Passive transport does not require energy molecules and happens when a funnel opens in the membrane, letting molecules flow through
Explanation:
am i right? it would be helpful if u would rate so i can adjust my answer

Can somebody help me please

Can somebody help me please

Answers

what's up? this answer is B

if you look it up, you will see that a glaucoma is much smaller and looks like it only covers the pupil. on the other hand, a cataract is more cloudy and covers more of the eye, like shown in the picture. cataracts affect the lens of the eye

best of luck with your studies!

Answer:

i think its B

Explanation:

im not 100% confident but it seems most right

Other Questions
Two lenses, one converging with focal length 10.0 cm and one diverging with focal length -5.0 cm, are placed 13.0 cm apart. An object is placed 30.0 cm in front of the converging lens. Determine the position of the final image formed. There are 42 female performers in a dance recital. The ratio of men to women is 4:7. How many men are in the dance recital? The standard configuration for a Colorado license plate is 3 letters followed by 3 digits. How many different license plates are possible if letters and digits can be repeated? Explain 3-4 reasons why the size of the U.S. labor force has not yet returned to the pre-pandemic level. The Thunderstorms brought snow to winter-town and it is melting at 1.5 inches er hour. write an equation that represents this situation You weigh six packages and find the weights to be 35, 25, 75, 30, 70, and 65 ounces. If you include a package that weighs 155 ounces, which will increase more, the median or the mean? According to the terms of the Act, there are several types of partners. Identify the type of partners and briefly describe their participation in the partnership. interventions strategies to reduce restrictions or barriers on limited access to capital I need answers ASAP PLEASE HELP Why were wealthy nations able to continue to exploit their former colonies even after those colonies gained independence? T/F: A brilliant creative execution could lead to a more rapiddecline of a bad product?AA. TrueB. False Glucose provides energy for cells. Different cells have different mechanisms for glucose intake. Intestinal cells contain proteins that transport glucose against its concentration gradient. These proteins couple the movement of glucose to the movement of sodium down its concentration gradient. Red blood cells have transporter proteins embedded in their membranes. When bound by a glucose molecule, these proteins change shape and allow glucose to move down its concentration gradient into the cell.Based on this information, what type of transport is used for glucose in blood and intestinal cells? Jenna also started with 50 bacteria for her experiment and after one day, her number of bacteria was equal to 50 to the second power Given the DNA sequence and three restriction enzymes (Hindill, Pstl and BamHI), write out the sequence of the digestion products for both DNA strands when the DNA sequence is subjected to digestion by a mixture of three restriction enzymes? 5 CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 3 Restriction recognition sequences (1 - the cleavage site): Hindiri 5-A|AGCTT-3 3-TTCGA|A-5 BamHI 5-G|GATCC-3 3-CCTAG|G-5 Pst! 5-CTGCA G-3' 3-G|ACGTC-5 What is the slope of this line?33/443/4Number graph ranging from negative 5 to 5 on both the x and y axis. A line passes through the point begin ordered pair 0 comma 2 end ordered pair and the point begin ordered pair 4 comma negative 1 end ordered pair Observe: Switch to the Protist sample. Protists are unicellular organisms common in ponds On the MICROSCOPE tab, select the 100x radio button and focus the image.Watch the motion of the protists at 100X and 400X. What structures allow each protist to move?I REALLY NEED HELPP Betelgeuse is 150 parsecs (490 ly) from Earth and has a surface temperature of only 3200K, yet Betelgeuse is one of the brightest stars in the night sky. What does this indicate about the size of Betelgeuse? Explain your answer. Fill in the blank with the correct subjunctive form of the verb in parentheses.nosotros ____ (vivir)vivemosvivimosvivamosviviramos 1. What happened when U.S. troops fought the German army for the first time in western Tunisia? What action did General Dwight D. Eisenhower take after the attack? What is f(4) if f(1) = 3.2 and f(x + 1) = 2.5f(x) ?A. 4.2B. 8C. 20D. 50