The plant in the vivarium uses

Answers

Answer 1

Answer:  Vivariums are enclosed spaces designed to provide a stable environment for animals and plants to be observed or studied.


Related Questions

when a leafy celery stalk is placed in colored water, transpiration results in the _____ turning the color of the water.

Answers

Answer: When a leafy celery stalk is placed in colored water, transpiration results in the leaves turning the color of the water.

Explanation:

When a leafy celery stalk is placed in colored water, transpiration results in the leaves turning the color of the water.


The leaves of the celery stalk will turn the color of the water due to the process of transpiration. This is because the colored water is absorbed by the celery stalk and travels up through the xylem to the leaves. The colored water then evaporates from the leaves, leaving behind the color in the leaves. This process is known as transpiration and is an important part of the water cycle in plants.

For more such questions on Transpiration.

https://brainly.com/question/13891305#

#SPJ11

60 minutes remaining
Question 13 The most abundant photoreceptors that detect dim light are Cones.
A True
B False
Question 14 Muscular tissue that adjusts the shape of the pupil to regulate how much light enters the eye is IRIS.
A True
B False Question
15 Opsins are visual pigments derived from Vitamin D.
A True
B False

Answers

Answer:

Question 13:

B. False

The most abundant photoreceptors that detect dim light are Rods, not Cones. Rods are highly sensitive to low light conditions and are responsible for vision in dim light and peripheral vision. Cones, on the other hand, are responsible for color vision and high visual acuity but are less sensitive to low light conditions.

Question 14:

A. True

The iris is the muscular tissue in the eye that adjusts the size of the pupil, controlling the amount of light entering the eye. It contracts or expands to regulate the size of the pupil in response to changing light conditions.

Question 15:

B. False

Opsins are visual pigments found in photoreceptor cells, specifically in the retina of the eye. They are responsible for capturing light and initiating the process of vision. Opsins are not derived from Vitamin D. Vitamin D is a separate compound involved in various physiological processes in the body, including calcium absorption and bone health.

Explanation:

NEED HELP!!! How do vestigial organs provide evidence for the theory of evolution? A Vestigial organs show differences between our DNA and the DNA of amoebas. B Vestigial organs show traits that a species once needed to have to perform certain tasks. C Vestigial organs show the variation in genes that can exist within one species. D Vestigial organs show how many cells organisms of a species once had.

Answers

Answer:

Vestigial organs show traits that a species once needed to have to perform certain tasks

Explanation:

B. Vestigial organs provide evidence for the theory of evolution:

"Vestigial organs show traits that a species once needed to have to perform certain tasks."

What do you mean by vestigial organs?

"Vestigial organs are the organs that have no apparent function and are considered to be the residual parts from the past ancestors."

What is theory of evolution?

"Theory of evolution is a scientific theory of the origin of species of plants and animals."

What do you mean by species?

"A species is often defined as a group of organisms that can reproduce naturally with one another and create fertile offspring."

What is a trait?

"A trait, as related to genetics, is a specific characteristic of an individual."

How are vestigial organs related to theory of evolution?

"Vestigial organs are often homologous to organs that are functioning normally in other species. Therefore, vestigial organs can be considered evidence for evolution, the process by which beneficial heritable traits arise in populations over an extended period of time."

To know more about vestigial organs and theory of evolution here https://brainly.com/question/14395849

#SPJ2

(d) Cells are treated with a compound that prevents the inactivation of kinase D . Researchers claim that Brec-WT cells treated with this compound will stimulate blood vessel-forming cell division to the same degree as Brec-MUT cells do in the absence of B . Based on the information provided, provide reasoning to support their claim.

Answers

Answer:

There are two kinds of communication in the world of living cells. Communication between cells is called intercellular signaling, and communication within a cell is called intracellular signaling. An easy way to remember the distinction is by understanding the Latin origin of the prefixes: inter– means “between” (for example, intersecting lines are those that cross each other) and intra– means “inside” (like intravenous). Chemical sign

Explanation:

As per the details provided, the correct reasoning to back the given claim would be as follows:

- Both cell types have active kinase D, which leads to the expression of A, and the expression of A stimulates the blood vessel-forming cell division by both cell types.

The correct reasoning to back the given claim that cells are intentionally handled using a compound that avoids the kinase's upregulation would be as mentioned above. In the given example, the use of Brec-WT cells shows that both the given cells contain kinase D in their activated form that causes the appearance of A. This appearance further results in the incitement of blood vessels which causes the division of cells through both kinds of cells.

Learn more about "Cell" here:

brainly.com/question/12129097

please help me please will give brainliest to ​

please help me please will give brainliest to

Answers

Answer: The Nucleotide

Explanation: RNA is synthesized in the nucleus using the nucleotide sequence of DNA as a template.

I will give brainliest for best answer!!!!!!

in a separate location, take notes from the sources you have identified. the notes will provide details for your presentation. while taking notes from texts and websites, use these reading strategies. in the space provided, write four pieces of information that you intend to use in your presentation
ps. the presentation is about the aids epidemic

Answers

Don't duplicate information from the book; instead, jot down notes in your own words. Don't highlight too much. Highlighting does little to actively engage the brain, making it a less effective tactic.

Overdoing the highlighting can also prevent you from concentrating on the essential points. Recognize what is necessary to know from the textbook. Make a summary of the textbook. Look over the main points first. Put your own words to the passage's content. Write your notes down after reading a piece from memory. Charts and graphs should not be overlooked. For any mistakes, review your notes. Examine the Reading List you were assigned. Form An Outline. Always get going from the beginning. Read a chapter at a time. Start your notes by using your memory. Include Key Information. Repetition in All Sections.

Read more about effective here

https://brainly.com/question/29787032

#SPJ4

Where did the water cycle begin?

Answers

Answer:

The water cycle has no starting point. But, we'll begin in the oceans, since that is where most of Earth's water exists. 

What environmental input is necessary for the Calvin cycle reactions?

Answers

The environmental input that is necessary for the Calvin cycle reactions is carbon dioxide (CO₂). It is captured and utilized by the enzyme Rubisco to convert carbon dioxide into glucose during the process of photosynthesis.

The Calvin Cycle, also referred to as the dark reaction, C3 cycle, or carbon fixation, is a sequence of enzyme-assisted reactions that occur in the stroma of chloroplasts in photosynthetic organisms. The Calvin cycle is responsible for transforming carbon dioxide (CO₂) into a high-energy molecule, which is used to produce glucose. This procedure occurs in three stages: carbon fixation, reduction, and regeneration. Environmental input for Calvin CycleIn the Calvin cycle, carbon dioxide is required as an environmental input.

Learn more about Calvin Cycle: https://brainly.com/question/920840

#SPJ11

Microorganisms that found in food can be classified based on
nutrien
protein, lipids and carbohydrates Elaborate this
statement.

Answers

Microorganisms that are found in food are classified into three types; carbohydrates, proteins, and lipids based on the nutrient they consume.

These nutrients are found in food and are required by microorganisms to survive and grow. The Microorganisms that feed on carbohydrates are referred to as carbohydrate fermenters which convert carbohydrates into energy by breaking down the sugars found in carbohydrates. Some examples of carbohydrate fermenters include yeast, lactic acid bacteria, and acetic acid bacteria.

Microorganisms that feed on proteins are referred to as protein decomposers. They break down the proteins found in food into amino acids and use them as a source of energy. Examples of protein decomposers include proteolytic bacteria and fungi.

The microorganisms that feed on lipids are referred to as lipid decomposers. They break down the fats found in food into fatty acids and glycerol, which they then use as a source of energy. Examples of lipid decomposers include lipolytic bacteria and fungi.

Microorganisms in nutrient-rich soil:

https://brainly.com/question/1198095

#SPJ11

How are brain and nerve cells function related to their structure?

Answers

Specialized projections called axons allow neurons to transmit electrical and chemical signals to other cells.

Amal was on a picnic to Hatta with his parents and family friends. While playing, he collected some muddy water from the Wadi in his beaker, which he wanted to make pure and clean. A) What do you think will happen to the mud in his beaker if left overnight? B) What is this process called?

Answers

Answer:

See the answers below

Explanation:

A) The mud in Amal's beaker will settle down at the bottom of the muddy water if left overnight with clear water occupying the surface. This is because the particles of mud are insoluble in water and will settle down at the bottom of the muddy water if left undisturbed for a while.

B) The process is called sedimentation. The settled mud particles are referred to as the sediments and the clear water at the top can be decanted off to separate the sediment from the water.

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

which is an example of a population ? a group of lions of a single species that live in the same general area of a prairie at the same time

Answers

a pack of one species of lions that are present in the same region of a prairie at the same time. A population is any creatures of the same species that are found in a specific area.

Limiting considerations determine how a population is distributed. A group of creatures of the same species that cohabitate and exist in the same location at the same time, such as the population of people, apple trees, or deer in a forest. The study of population dynamics, or population biology, provides data essential to biological studies. Additionally, it aids in the prevention of agricultural pests and the preservation of rare and endangered species.

Learn more about population

https://brainly.com/question/21654221

#SPJ4

Why do you think that the people dance and sing for the left handed twin?

Answers

Because the left handed twin was liked more. Even though the right handed twin was the good one, revenge had spread through him and that was all he focused on

A company understands that it has a responsibility to minimize air pollution from its factories. What are effective ways the company can reduce the pollutants produced by the factories? Choose the three statements that apply.



A. Place devices that remove emissions in the factory smokestacks


B. Reduce the number of temperature inversions that trap pollutants.


C. Use low-emission trucks to move products from one place to another.


D. Use hydroelectric or wind energy sources instead of coal

Answers

Your answer: A, C, D
A. Place devices that remove emissions in the factory smokestacks
C. Use low-emission trucks to move products from one place to another
D. Use hydroelectric or wind energy sources instead of coal

A. Place devices that remove emissions in the factory smokestacks
B. Reduce the number of temperature inversions that trap pollutants
D. Use hydroelectric or wind energy sources instead of coal.
These three statements are effective ways the company can reduce air pollution from its factories. By placing devices that remove emissions in the factory smokestacks, the pollutants are trapped before they are released into the air. Reducing the number of temperature inversions that trap pollutants can also help to minimize the amount of air pollution. Using low-emission trucks to move products from one place to another can also help, but it is not as effective as the other three statements. Finally, using hydroelectric or wind energy sources instead of coal can greatly reduce the amount of pollution produced by the factories. By implementing these strategies, the company can take a responsible approach to minimizing air pollution.
To know more about hydroelectric visit:

https://brainly.com/question/14303851

#SPJ11

I need help
Claim: Yellow color is always an adaptive trait in a yellow environment.



Do you agree or disagree with this claim?

Answers

i agree with this clame

Yellow color is always an adaptive trait in a yellow environment I agree with this claim.

What is adaptive trait?

Adaptive trait is defined as an element of the developmental pattern that makes it easier for its carrier to survive and/or reproduce in a succession of different situations.

Any heritable characteristic that enables a plant or animal to survive and procreate in its environment is referred to as an adaptation.

The process of modifying behavior, physiology, or structure to make it more suitable to an environment is known as adaptation.

It might also be described as the condition that a biological population has achieved after enduring modifications or changes.

There are three types of adaptive traits.

StructuralPhysiologicalBehavioral

Thus, yellow color is always an adaptive trait in a yellow environment I agree with this claim.

To learn more about adaptive trait, refer to the link below:

https://brainly.com/question/1596691

#SPJ2

Proteins are synthesized at the ribosome and are often modified en route to their destination. How are these modified proteins most likely transported within a compartmentalized eukaryotic cell?.

Answers

Answer: rough-endoplasmic reticulum.

Explanation: rough endoplasmic reticulum are long thread like networks or channels transport protein within eukaryotic cell.

after osmosis occurs in beaker a, the cell would be __________ compared to its size at the start of the experiment.

Answers

After osmosis occurs in beaker A, the cell would be larger compared to its size at the start of the experiment.

Osmosis is the process in which solvent molecules move from an area of high concentration to an area of low concentration across a selectively permeable membrane. In this experiment, water moves into the cell, which has a higher solute concentration than the surrounding solution in beaker A. As a result, the cell swells and increases in size. If this process continues, the cell may burst due to the excess influx of water, leading to cell death. Therefore, it is important to maintain the balance of solutes and water inside and outside the cell.

To know more about Osmosis, click here:

https://brainly.com/question/31028904

#SPJ11

Ravi was asked by her boss Bob to deliver an order to a customer using the company van. Bob was hesitant to use Ravi as a delivery person because although Ravi has never had a car accident before she has a reputation amongst her friends and work colleagues for driving fast and getting speeding tickets in her own car. Ravi insisted she would be careful, and Bob knew that the customer really needed the order. Ravi drove carefully and dropped off the products to the customers warehouse. Eager to return the van, she sped as much as 25km over the speed limit on her way to deliver the van back the office. While rounding a curve, she lost control of the van, which tumbled off the road and down a hill, crashing into a tree. lan happened to witness the incident. He stopped his car at the top of the hill and ran down to help. Unfortunately, in his rush to help, he did not put the hand break on in his car and it also rolled down the hill and hit a shed. Ravi emerged from the van dazed but without a scratch. The van and lan's car, however, were severely damaged. lan's car was unable to be repaired and he had to buy a new vehicle. lan had been about to start a new his new home construction business and the delay in getting a suitable vehicle meant that it took an extra 3 months to get the business off the ground. Required 1) Using the law of Negligence explain who the Duty of Care is owed to by: () a) Ravi b) Bob c) lan

Answers

Negligence is a legal term used to describe careless behavior that causes damage to another person. The law of Negligence is used to establish whether a person is liable for injuries caused by their actions or omissions.

A duty of care is a legal responsibility that one person or organization has to another person or organization. The concept of a duty of care is central to the law of negligence. In this case, the duty of care is owed by Ravi, Bob, and Lan: RaviThe Duty of Care is owed by Ravi, who was driving the company van. Ravi owed a duty of care to her employer, Bob, and her colleagues, as well as to other road users. Ravi had a duty to drive safely and avoid causing injury or damage to others or their property.

Ravi was negligent when she drove the van at high speed and lost control of the vehicle, causing it to crash. Her negligence resulted in damage to the van, as well as damage to Lan's car. Bob Bob also had a duty of care, as he is Ravi's employer. Bob was responsible for ensuring that Ravi was fit to drive the company van and that she had the necessary skills and experience to operate the vehicle safely. Bob was also responsible for ensuring that the van was in good condition and roadworthy. Bob was negligent when he allowed Ravi to drive the van, knowing that she had a reputation for speeding and driving recklessly.

He could have assigned the delivery to another driver who had a good driving record. LanLan is not liable for any damage caused to Ravi's van as he was not responsible for driving it. However, he was owed a duty of care by Ravi when she caused damage to his car. Ravi's negligent driving resulted in the destruction of the man's car, which had to be replaced. As a result of the accident, Lan was delayed in starting his new home construction business, which caused him to incur a loss. Ravi was responsible for the losses suffered by Lan, and she could be sued for damages caused by her negligence.

To learn more about injuries caused here

https://brainly.com/question/29648597

#SPJ11

true or false? a codon is a group of three bases that can specify more than one amino acid.view available hint(s)for part atrue or false? a codon is a group of three bases that can specify more than one amino acid.truefalse

Answers

It is true that a Codon is a trio of nucleotides that can designate many amino acids. Four nucleotides make up the language of DNA and RNA molecules, while 20 amino acids make up the language of protein molecules.

Do three codons equal one amino acid?

This proved that the coding unit is made up of three nucleotides. A codon is a triplet of nucleotides that codes for an amino acid. One amino acid is encoded by each set of three nucleotides.

A codon may specify multiple amino acids.

Even within a single gene, a codon can spontaneously evolve to code for two different amino acids, with the choice of the inserted amino acid being determined by an RNA structure in the 3′-untranslated region.

To know more about Codon visit:-

https://brainly.com/question/22991780

#SPJ4

select the correct statement related to antigens and antibodies.
a. the clumping of antibodies and antigens is called clotting. b. antibodies are cellular markers that the body recognizes as self or foreign.
c. antibodies are produced by t lymphocytes. d. antigens and antibodies have specificity. antigens are found in the blood plasma.

Answers

The correct statement related to antigens and antibodies is: d. antigens and antibodies have specificity. Antigens are found in the blood plasma. Antigens are substances recognized by the immune system, while antibodies are proteins produced by B lymphocytes to neutralize or remove foreign substances like antigens.

The specificity ensures that the antibodies bind only to their corresponding antigens, leading to effective immune responses. Antigens are substances that can stimulate an immune response, while antibodies are proteins produced by B lymphocytes that recognize and bind specifically to antigens. They work together to help the immune system identify and fight off foreign invaders such as viruses and bacteria. Clotting is a different process unrelated to the interaction between antigens and antibodies.

For more questions related to antigens, refer to:

https://brainly.com/question/7597406

#SPJ11

PLEASE HELP I GIVE YOU 20 POINTS PLEASE HELP ME PLEASE HELP IF YOU GIVE ME THE RIGHT ANSWERS I GIVE YOU 20 POINTS PLEASE HELP PLEASE HELP ME





3. Create a "role-play" or "practice session" between you and an imaginary person who is either abusing drugs or encouraging you to abuse drugs. Include in your role-play these items:


a. The persons involved


b. The scenario


c. The dialogue between you and your friends


d. What you would say to them to discourage their abuse of drugs


e. What you would say or do to refuse to participate


4. Summarize your thoughts on the following questions.


a. What are the dangers of over-the-counter drugs?


b. What can you do to reduce the risk of abusing over-the-counter drugs?

Answers

Answer: pretty sure the answer is ⠀ ⠀ ⠀, hope this helps! :))

Explanation:

Albino corn has no chlorophyll. You would expect albino corn seedlings to:
(A) synthesize glucose indefinitely, using stored ATP and NADPH.
(B) fail to thrive because they cannot capture light energy.
(C) switch from the C4 pathway to the CAM pathway.
(D) use accessory pigments such as carotenoids to capture light.
(E) capture light energy in the white end of the visible light spectrum.

Answers

Albino corn has no chlorophyll. You would expect albino corn seedlings to: (B) fail to thrive because they cannot capture light energy.

Albino corn lacks chlorophyll, which is the pigment responsible for capturing light energy during photosynthesis. Without chlorophyll, the corn seedlings are unable to perform photosynthesis effectively. As a result, they are unable to convert light energy into chemical energy in the form of glucose.

Option (B) is the correct answer because it states that albino corn seedlings would fail to thrive due to their inability to capture light energy. Without the ability to capture light, the seedlings cannot generate the necessary energy to carry out essential metabolic processes and grow properly.

Options (A), (C), (D), and (E) are incorrect:

(A) Albino corn seedlings cannot synthesize glucose indefinitely because they lack the chlorophyll needed for photosynthesis. Glucose synthesis relies on the capture of light energy during photosynthesis, which is not possible in albino corn.

(C) The C4 and CAM pathways are alternative carbon fixation pathways used by some plants to optimize photosynthesis under certain conditions. However, the absence of chlorophyll in albino corn prevents the use of any specific pathway as it lacks the ability to capture light energy.

(D) Accessory pigments such as carotenoids can assist chlorophyll in capturing light energy, but in the case of albino corn, the absence of chlorophyll means there is no primary pigment to work in conjunction with the accessory pigments.

(E) Since albino corn lacks chlorophyll, it cannot capture light energy across the visible light spectrum, including the white end. Without the ability to capture light, the seedlings cannot utilize light energy for photosynthesis.

Therefore , the correct answer is option (b)  fail to thrive because they cannot capture light energy.

To know more about pigment, refer here:

https://brainly.com/question/31789623#

#SPJ11

According to Newton's second law of motion, Force = mass X

Velocity

Acceleration

Momentum

Mass

Answers

According to Newton's second law of motion, Force = mass x Acceleration.

According to Newton's second law of motion, Force = mass X acceleration. This means that the force applied to an object is directly proportional to its mass and the acceleration it experiences. In other words, the greater the mass of an object, the greater the force required to accelerate it, and the greater the acceleration, the greater the force required to produce it. This relationship between force, mass, and acceleration is fundamental to our understanding of motion and is essential in many areas of physics, engineering, and everyday life. So, the long answer is that according to Newton's second law of motion, force is equal to mass multiplied by acceleration.

To know more about Newton's visit :-

https://brainly.com/question/3273157

#SPJ11

A biologist reads an article in a scientific journal that describes how the legs

of different organisms look and function differently, but appear to be

constructed from the same basic bones. He compares a drawing of the

skeletal structure of a porpoise's fin with one of an elephant's leg. (7A)

What aspect of the theory of evolution do these drawings support?

Answers

Answer:

Homology

Explanation:

The aspect of the theory of evolution that the drawings support is homology. Homologous organs are organs of different organisms that look similar in structure but perform different functions in reality.

Organs that are built on the same or similar basic plans in the same organisms but perform different functions are thought to have been from the same ancestor. Hence, homology or homologous organ represents one of the evidence used to support the theory of evolution which opines that all living organisms descended with modifications from common ancestors.

Discuss the function of hemoglobin in human body and the consequences of hemoglobin
deficiency

Answers

Hemoglobin: The high iron-containing protein in red blood cells (RBCs) is known as hemoglobin. This gives the blood a red color.

It has two main functions: it carries oxygen from the lungs to tissues of the body, and it carries carbon dioxide from cells back to the lungs for excretion.

Functions of hemoglobin:

Hemoglobin is the main reason for the red color in our blood.Hemoglobin carries oxygen and carbon dioxide. Hemoglobin interacts with other ligands.Hemoglobin plays a crucial role in maintaining the shape of red blood cells.

Consequences of hemoglobin deficiency:

Hemoglobin deficiency leads to having fewer red blood cells and causes anemia.It is found in red blood cells and acts as a carrier of oxygen and carbon dioxide.Low levels of hemoglobin in the blood cause parts of the body to function more slowly and weaken due to reduced oxygenation.

Hemoglobin deficiency reduces the blood's oxygen-carrying capacity.

To know more about Hemoglobin:

https://brainly.com/question/29380989

Which statement about these cells is correct?


a.About 20 percent of the cells are dividing.

b. Most of the cells are undergoing meiosis.

c. Most of the cells will never undergo mitosis

d. About 80 percent of the cells are dividing.

Which statement about these cells is correct? a.About 20 percent of the cells are dividing.b. Most of

Answers

About 80 percent of the cells are dividing because of the perfect structure of the cell.

What is cell division?

Cell division is the process by which cells multiply that includes nuclear and cytoplasmic division. Meiosis and  mitosis are their types.

So we can conclude that about 80 percent of the cells are dividing because of the perfect structure of the cell.

Learn more about cell here: https://brainly.com/question/13123319

What do you think? Should human activity be documented on the geological scale why or why not if the human population were not the size it was today however it be different consider all force fears geosphere atmosphere hydrosphere and biosphere and the answer

Answers

Answer:

Environments on Earth are always changing, and living systems evolve within them. For most of their history, human beings did the same. But in the last two centuries, humans have become the planet’s dominant species, changing and often degrading Earth’s environments and living systems, including human cultures, in unprecedented ways. Contemporary worldviews that have severed ancient connections between people and the environments that shaped us – plus our consumption and population growth – deepened this degradation. Understanding, measuring, and managing today’s human environmental impacts – the most important consequence of which is the impoverishment of living systems – is humanity’s greatest challenge for the 21st century.

Two students below described a part of Earth's middle layer:

Bob: The deepest part
Joe: The semi-fluid part

Which part of the middle layer did Bob and Joe describe? (4 points)
A. They both described the mesosphere.
B. They both described the asthenosphere.
C. Bob described the mesosphere and Joe described the asthenosphere.
D. Bob described the asthenosphere and Joe described the mesosphere.

Answers

Answer:

c

Explanation:

Crossing-over occurs
a. during prophase 2.
c. during prophase I.
b. during fertilization.
d. at the centromere

Answers

C. Prophase 1 crossing over occurs during prophase 1 of meiosis.
Answer : prophase I

Internets prove: Crossing over occurs only during prophase I.
The complex that temporarily forms between homologous chromosomes is only present in prophase I, making this the only opportunity the cell has to move DNA segments between the homologous pair.
Other Questions
How did the ideas of the Enlightenment influence colonial protests against British taxes? what do you mean by sick? which model of secsdlc does the work product from each phase fall into the next phase to serve as its starting point? question 15 options: agile modular continuous traditional waterfall elementary cyclical need answered asapp!! One angle in a right triangle measures 57. What is the measure of the other acute angle?431239033 A right rectangular prism has a square base with a side length of 3 inches. The height of the prism is 8 1/4inches. What is the volume of this prism? The perimeter of a rectangular meadow is 1004 m. Whatwill be the sum of the length and breadth of the meadow ? For sunset graphics purchase and payment process, the appropriate multiplicities between the purchase order event and the products resource should indicate that:____. What do you mean by market development ? Expalin. In the early 1600's what was exported? What is the main theme of Beowulf? Which two compounds are not isomers of each other? a. n-pentane and 2-methylbutane b. ch3ch2oh and ch3och3 c. ch3cooh and ch3ch2cooh d. ch3coch3 and ch3ch2cho e. ch3ch2ch2cl and ch3chclch3 each of the following compounds does not participate as a diene in a Diels-Alder reaction. Explain why in each case. y the com- (b) that will mixture of (c) (d) 16.40 29. All powers that the Constitution does not give to the Federalgovernment...O Remains with the State governmentsOAre given to the PresidentAre interpreted by the Supreme CourtPLEASE HELP IM ON A TIMER solve the following a)n^2-n=0b) 9q^2 -1 =0c)(n-1)^2=16kindly help me with this Solve for the value of x.10x-58x+9 Short-Term goals can be set to help achieve specific long-term goals.TrueFalse Overall, the style of the passage is best described as conversational conversational digressive digressive cryptic cryptic lyrical lyrical intellectual Convert 380 K to degrees F. please help me find the 5th term of 4/3, 18/9, 1, 16/27 in geometric progression please please please please please please please