the income statement reports revenues, expenses, and net income over the period of time covered in the report. true false

Answers

Answer 1

True. The income statement, also known as the profit and loss statement, summarizes a company's revenues, expenses, and net income over a specific period of time, such as a month, quarter, or year.

Revenues refer to the total amount of money earned by the company from selling goods or services, while expenses include all costs incurred in the process of generating revenue. Net income is calculated by subtracting total expenses from total revenues and represents the company's profit or loss during the reporting period. The income statement is an essential financial statement that provides insights into a company's financial performance and is often used by investors, creditors, and other stakeholders to evaluate the company's profitability and financial health.
The statement you provided is true. The income statement, also known as the profit and loss statement, is a financial report that presents a company's revenues, expenses, and net income over a specific period of time, usually a quarter or a year. It provides valuable information about a company's financial performance, allowing stakeholders to evaluate its profitability and make informed decisions.

Revenues, or the money earned from sales or services, are recorded at the top of the income statement. Next, various expenses, including cost of goods sold, operating expenses, and taxes, are listed and subtracted from the revenues. Finally, net income, which is the difference between revenues and expenses, is calculated and displayed at the bottom of the report. The net income shows whether the company made a profit or suffered a loss during the period covered by the statement.

To know more about revenue visit:

https://brainly.com/question/29575618

#SPJ11


Related Questions

For each scenario, calculate the cross-price elasticity between the two goods and identify how the goods are related. Please use the midpoint method when applicable, and specify answers to one decimal place. A 20% price increase for Product A causes a 10% decrease in its quantity demanded, but no change in the quantity demanded for Product B.

Answers

Answer:

No relation

Explanation:

The computation of the cross elasticity of demand is shown below:

= Percentage change in quantity demanded ÷ Percentage change in price

here the price is increased by 20% for product A

But there is no change in the quantity demanded for product B

So, the cross elasticity of demand is

= 0 ÷ 20%

= 0

Therefore there is no relation between two products or goods

Abstracts usually have ______________________ words.
100 to 200
200 to 300
50 to 100
500 to 800
_________________ is not a part of the abstract.
Purpose
Reference
Result
Methodology
Abstract covers all major parts of the research paper in order to :
involve the reader
provide a complete summary
fulfill the requirement of the paper
provide extra information
Which verb tense is recommended to write the Abstract?
Present
Past
Future
Identify the most suitable time to write the abstract.
At the start of the research
After collecting the data
At the end of the research
During the research
Why is it important to spend time writing an abstract for a research report?
Readers sometimes use it to decide if they wish to read the full article.
It is the only opportunity to discuss your own interpretation of the research.
Reviewers only review the abstract.
It is the only opportunity for you to report the applications and strengths of the research.
What is an abstract used for?
for a brief written interview
for a written description of a project
for a news article
Which ONE of the following is not relevant for Abstracts?
Define Technical terms
Give a short background
discuss research methods
A high quality abstract does not ....
provide concise description of proposed research
spark interest
stand alone
target audience from different fields
Identify the suitable ABCs of the best Abstracts.
Accountability - Brevity - clarity
Accuracy - Brevity - clarity
All - Basic - Components
All - Best - Components

Answers

Abstracts are summaries of research papers or articles that usually have around 100 to 200 words.

They cover all major parts of the research paper, such as the purpose, methodology, results, and references, and are written in the present tense. The best time to write an abstract is after completing the research, so that all the relevant information can be included.

It is important to spend time writing an abstract because it is often the first thing that readers see and can influence their decision to read the full article or not.

A high-quality abstract should provide a concise description of the research and spark interest while remaining accurate and clear. It should also be targeted at a wide audience to make the research accessible to people from different fields. Finally, the ABCs of the best abstracts are accuracy, brevity, and clarity.

For more such questions on Abstracts, click on:

https://brainly.com/question/29214415

#SPJ8

why is south africa regarded as a developing country​

Answers

Answer:

This is due to the fact that South Africa is currently in a state of poverty and has very high unemployment rates, meaning there are a lot of poor people on the streets and it is uneasy/many do not have jobs either.

Explanation:

Match the tasks with the professionals who would complete them.

Match the tasks with the professionals who would complete them.

Answers

Meteorologist: measure the temp and humidity, creates charts and graphs to educate the public
Videographer: use editing softwares, discuss filming techniques
Network administrator: train users how to use the system, determine ways to make the system more effective
Hope this helps!

Answer:

Explanation:

1,3 and 2,4 and 5,6 and thats it

The production era marked a time when companies were able to increase their profits because they were able to decrease their production costs.
True
False

Answers

Answer:

true

Explanation:

it was the time of the production line making it easy to make expensive things with people that are lower skilled and cheaper overall

Answer:

True

Explanation:

have a good day

Which group is legally responsible for implementing
protection and controls that ensure your workplace
meets safety standards?
A. Employers
B. Unions
C. Employees
D. Government

Answers

Answer:

A

Explanation:

Answer:

It SHOULD be employers but i may be wrong... if i'm not CAN I PLES HAVE BRAINLYIEST

Explanation:

Also, if i'm right there is no need to thank me unless you want too

A company recognized an accrued salary expense in Year 1 and paid its employees in Year 2. The financial statements affected in Year 2 are the ______.

Answers

Answer:

Statement of Financial Position and Cash Flow Statement.

Explanation:

Year 2

1. Statement of Financial Position

Decrease the Liability : Salaries Owing

Decrease the Assets : Cash

2. Cash Flow Statement

Decrease in Liability : Cash Outflows

3. Income Statement

No Effect

4. Statement of Changes in Equity

No Effect

The financial statements that will be affected by this transaction are:

Balance Sheet. Income statement. Statement of Cashflows.

Effect on Financial statements The Balance sheet will see a reduction in liabilities related to the accrued expense of the salary. Income statement will recognize the salary expense. Statement of Cashflows will recognize the decrease in liabilities.

In conclusion, several financial statements will be affected.

Find out more about accrued expenses at https://brainly.com/question/13450378.

5 steps in developing a research instrument

Answers

Answer:

Explanation:

Step 1 – Locating and Defining Issues or Problems. ...

Step 2 – Designing the Research Project. ...

Step 3 – Collecting Data. ...

Step 4 – Interpreting Research Data. ...

Step 5 – Report Research Findings.

Answer:Step 1: locatingOr defining issues problems problems

Step 2: designing the research project

Step 3: collecting data

Step 4: interpreting research data

Step 5: Report research findings

Explanation: it is there as soon a u look it up ! Hope that helps

what are the roles of financial manager ?​

Answers

Answer:

hope it helps

Explanation:

A Financial Manager, or Finance Manager, builds financial strategies and reports to help companies improve their financial health and meet their long-term goals. Their main duties include preparing an organizations’ activity reports, creating financial forecasts and brainstorming ways to maintain or reduce company costs

the joining together of two or more companies to capitalize on a sponsorship is known as

Answers

The joining together of two or more companies to capitalize on a sponsorship is known as a co-branding or brand alliance.

Co-branding or brand alliance refers to the collaboration between two or more companies to leverage their respective brand strengths, customer bases, and marketing resources in order to achieve mutual benefits. In a co-branding partnership, the companies come together to create a combined product, service, or marketing campaign that utilizes the power of their individual brands.

The purpose of co-branding is to enhance brand equity, increase market visibility, and reach new customer segments. By leveraging the reputation, customer loyalty, and brand associations of each partner, the collaboration aims to create a unique value proposition and differentiation in the market.

Co-branding can take various forms, such as joint advertising campaigns, product collaborations, shared sponsorships, or licensing agreements. Through this strategic alliance, the participating companies seek to generate synergy and achieve a competitive advantage by combining their resources, expertise, and market presence.

To know more about Co-branding, refer here:
https://brainly.com/question/32158031#
#SPJ11

A naturalistic learning style fits a person who enjoys learning through _____.


listening to music

working alone

presenting a summary of a novel

comparing things found in nature

Answers

Answer: comparing things found in nature

Explanation:

Naturalistic learning involves the use of natural elements such as animals, plants, natural events and the environment in general to learn about various concepts.

People who would prefer this style of learning prefer to learn outdoors and are usually found comparing things found in nature to other things regardless of if they are indoors or outdoors. The strong attraction they feel to nature allows them to harness this learning style more effectively.

Answer:

comparing things found in nature

Explanation:

i got it right on my test

Select the education or qualification that is best demonstrated in each example.

Harsha comes up with ideas for ways to improve a software application.

Bill can stay focused for long periods of time while working alone.

Edith has a four-year college degree in computer science.

Tawana is an expert in writing code for websites.

Answers

Answer:

So it should be:

creativity

independence

a bachelor's degree

knowledge of programming languages

Explanation:

is this correct?

1. Harsha's ability to generate ideas for improving a software application suggests that they possess strong creativity and problem-solving skills.

What does qualification describe?

The term "qualification" typically refers to a person's education, training, skills, or experience that make them suitable or eligible for a particular job, role, or task. Qualifications can be formal, such as degrees, certifications, or licenses, or they can be informal, such as skills learned through on-the-job experience or self-study.

Qualifications may also refer to specific requirements that must be met in order to obtain a particular position or achieve a certain level of recognition or accreditation.

Here are some education or qualification that is best demonstrated in each example:

2. Bill's ability to maintain focus for extended periods of time while working independently demonstrates good concentration and discipline.

3. Edith's four-year college degree in computer science demonstrates that she has completed a formal education in the field of computer science and likely has a broad understanding of various topics within the discipline.

4. Tawana's expertise in writing code for websites suggests that she has developed specialized knowledge and skills in this area through training and experience.

Learn more about qualification here:

https://brainly.com/question/27322497

#SPJ3

5-1 Activity: Walt Disney Working Capital Management
FIN-320 Principles of Finance

Answers

Working capital management refers to the management of a company's short-term assets and liabilities to ensure its daily operations run smoothly.

It involves monitoring and optimizing the levels of current assets (such as cash, accounts receivable, and inventory) and current liabilities (such as accounts payable and short-term debt).

In the context of Walt Disney, a company with extensive operations in the entertainment and media industry, effective working capital management is crucial for supporting its ongoing business activities. Here are some key considerations related to Walt Disney's working capital management:

Cash Management: Walt Disney needs to manage its cash flows efficiently to ensure it has sufficient funds to cover its operating expenses, investments, and dividend payments. This involves monitoring cash inflows and outflows, optimizing cash balances, and investing excess cash wisely.

Accounts Receivable: Walt Disney offers various products and services, including theme park admissions, merchandise sales, and licensing deals. It must effectively manage its accounts receivable to ensure timely collection of payments and minimize the risk of bad debts.

Inventory Management: As a company involved in film production, merchandise sales, and theme park operations, Walt Disney must carefully manage its inventory levels. It needs to balance maintaining sufficient inventory to meet customer demand while avoiding excessive inventory carrying costs.

Accounts Payable: Walt Disney interacts with numerous suppliers and vendors. Effective management of accounts payable involves negotiating favorable payment terms, monitoring payment schedules, and optimizing cash flow by paying suppliers on time while taking advantage of any available discounts.

Short-Term Financing: Walt Disney may use short-term financing options, such as lines of credit or commercial paper, to manage its working capital needs during peak seasons or when faced with temporary cash flow challenges.

The goal of working capital management is to maintain a balance between liquidity, profitability, and operational efficiency. By effectively managing its working capital, Walt Disney can enhance its financial stability, improve cash flow, and support its growth initiatives.

It's important to note that the specific details and strategies of working capital management can vary based on factors such as industry dynamics, company size, and financial objectives. For a comprehensive understanding of the topic and the specific activity requirements for "FIN-320 Principles of Finance," it would be best to refer to your course materials and follow the instructions provided by your instructor.

Learn more about Walt Disney here -: brainly.com/question/28207301

#SPJ11

Based on the content in this module and in the video, discuss the elements involved in CAT's production process by addressing the following:
Summarize the type of production utilized (e.g. mass production, mass customization or customization). Provide one example of the type utilized.
Describe two examples of raw materials utilized to make an excavator that you observed.
Describe two examples of technology utilized to make an excavator that you observed."

Answers

Caterpillar or CAT is a company that is primarily involved in the manufacturing of construction equipment, such as excavators, bulldozers, and dump trucks. Based on the content of the module and video, the following are the elements involved in CAT's production process:

Production type utilized:CAT uses mass production to produce excavators. Mass production is a process whereby a large number of identical products are produced at a high rate. As an example, CAT produces excavators in large quantities, using the same design and materials. Two examples of raw materials utilized to make an excavator that I observed are: Steel is a significant raw material utilized in the production of CAT's excavators. The steel is used to form the various components of the excavator, such as the tracks and the arm. Aluminum is also utilized to create the excavator cab and some of the other minor components.Technology utilized to make an excavator that I observed:CAT uses advanced technology in its manufacturing processes to create high-quality excavators. Two examples of technology utilized to make an excavator that I observed include:CAT uses automated welding machines to weld the various components of the excavator together. This results in a consistent and strong weld that is difficult to achieve by hand. CAT's excavators are designed and engineered using 3D modeling software, which allows for precise and accurate design of the machine's components. This software can also simulate the performance of the excavator in a virtual environment, which helps to refine the design and improve its efficiency.

to know more about manufacturing, visit

https://brainly.com/question/13440987

#SPJ11

How do you give brainliest?

I cant figure it out.

Answers

when two or more people answer your question it will give the option

Answer:

for example, click the crown next to my question :)

Explanation:

ultimate dissolution of the partnership may be necessary if the firms are able to successfully work through the critical steps of partnership formation or synergies can be recognized.

Answers

Dissolution of partnership refers to the procedure by which the partnership is ended and all of the partners' assets, shares, accounts, and liabilities are sold or settled.

Unless otherwise arranged, partnerships end at the death or insolvency of any partner. Partnerships should therefore have a written partnership agreement that contains clauses allowing the partnership to continue. In contrast to the dissolution of a firm, which also involves the dissolution of the relationship between partners, the dissolution of a partnership simply changes the nature of the business relationship between partners.

All of the assets and liabilities in this case have been resolved and properly disposed of.

Learn more about the dissolver partnership here: https://brainly.com/question/25641198

#SPJ4

an employee can be dismissed if their job surplus to requirements' outline why this state ment is false

Answers

Hiring labour is different from buying other goods and services, and the contract between the employer and the employee is incomplete. It does not cover what the employer really cares about, which is how hard and well the employee works.

The appeal of using predetermined departmental overhead rates is they presumably provide ___.

Answers

The appeal of using predetermined departmental overhead rates is they presumably provide a more accurate accounting of costs, enhanced information.

What is accounting?

Accounting, which is frequently referred to as simply "accounting," is the process of gathering, analyzing, and disseminating financial and other data on companies and businesses.

Accounting is the activity of keeping records of a company's financial transactions.

The benefit of adopting departmental overhead rates that have been defined is that they should provide better information and a more accurate accounting of expenditures.

Thus, this rate is distinct at every stage of production because various departments employ various procedures that enable management to precisely review manufacturing inefficiencies and determine the best course of action.

For more details regarding accounting, visit:

https://brainly.com/question/22917325

#SPJ1

We suppose an economy defined by:
Y=10000 ; G = 2000 ; T = 1000 ;
r (real interest rate) = 3%;
C = 400 + 0.6 (Y-T) ;
Lo (factors that affect demand of moeny) = 5 ;
Ms (money supply) = 15000 ;
Mg (growth rate of money) = 10% ;
Yg (growth rate of Y) = 7%

question : If M increase by 3%, the P increase by ? ( the options I have are : 1.22%/1.23%/1.24%/1.25%)

Answers

Answer:

Explanation:

To find the percentage increase in P if M increases by 3%, we need to use the equation for the quantity theory of money, which is:

M * V = P * Y

Where M is the money supply, V is the velocity of money, P is the price level, and Y is the output of the economy.

If M increases by 3%, then the new value of M can be found by multiplying the old value of M by 1 + the percentage increase:

M' = M * (1 + 0.03) = 15000 * 1.03 = 15450

We can then solve for the new value of P by substituting the new values of M and Y into the equation:

P' = (M' * V) / Y = (15450 * V) / 10000 = 1.5450 * V

We can then find the percentage increase in P by taking the difference between the new value of P and the old value of P, and dividing by the old value of P:

Percentage increase in P = (P' - P) / P = (1.5450 * V - 1) / 1 = 0.5450 * V

So the percentage increase in P is 0.5450 * V.

How much should someone’s loan payment be if their total income is $100?

Answers

Someone’s loan payment  if their total income is $100 should be 30 times their monthly income.

The loan payments means the amounts required to be paid by the borrower in repayment of the loan pursuant to the provisions of the loan agreement, the note and the bond mortgage.

In most cases, lenders consider approximately 50-75% of the net income as instalments. In case your expenses exceed the percentage, banks either increase the tenure of the loan or reduce the amount sanctioned.

Additionally, to minimise the risk of default, lenders keep the EMIs of the loan to about 45-60% of your monthly income.

To know more about loan here,

https://brainly.com/question/14784302

#SPJ1

The _____ are diverse, including providing financial security, and encouraging peace of mind.

Answers

The benefits that are offered by various organizations and companies are diverse, providing individuals with an array of options to choose from that cater to their unique needs and preferences. One such benefit that is often provided is financial security, which can come in many forms such as retirement plans, life insurance, and disability coverage.

These types of benefits help employees feel more secure about their future and provide them with a safety net in case of unexpected events. In addition, many companies also offer wellness programs and mental health support that encourage peace of mind and promote a healthy work-life balance. By providing a diverse range of benefits, companies can attract and retain top talent, improve employee satisfaction, and ultimately achieve greater success.

To know more about Financial visit:

https://brainly.com/question/28644358

#SPJ11

Perceived switching costs may prevent a long-term FreshDirect customer from
- visiting the convenient mart down the street.
- subscribing to a rival online grocer.
- ordering dinner using restaurant order delivery.
- picking up grocery items on a trip to a big box store.
- renewing their subscription

Answers

Perceived switching costs refer to the perceived effort, time, and money that a customer believes they will have to invest in order to switch to a different product or service.

In the case of a long-term FreshDirect customer, perceived switching costs may prevent them from trying out a rival online grocer, subscribing to a different delivery service or ordering dinner from a restaurant delivery platform. They may also hesitate to visit a convenient mart or pick up grocery items from a big box store due to the added effort and time it takes. However, if the perceived benefits of switching outweigh the perceived costs, the customer may decide to switch to a different service. Ultimately, it is up to the customer to evaluate their needs and decide if the potential benefits of switching are worth the perceived switching costs.

To learn more about products, visit:

https://brainly.com/question/24184452

#SPJ11

Armenia had a favorable balance of trade in 2018 when it exported $800 million in goods and services and imported $1.5 billion.

Answers

Armenia's favorable balance of trade in 2018 means that it exported more goods and services than it imported, resulting in a surplus in the country's trade balance. With $800 million in goods and services exported and $1.5 billion imported, Armenia had a trade deficit of $700 million. This indicates that Armenia relies heavily on imports to meet its domestic demand, which can have both positive and negative impacts on the country's economy.

On the positive side, imports can provide access to goods and services that are not available domestically, which can stimulate economic growth and increase consumer choice. On the negative side, heavy reliance on imports can make a country vulnerable to external economic shocks and fluctuations in global commodity prices.

To maintain a favorable balance of trade, Armenia can explore ways to increase its exports and reduce its reliance on imports. This can involve diversifying its export markets, investing in industries with high export potential, and improving the competitiveness of its domestic businesses. By doing so, Armenia can enhance its economic resilience and support sustainable growth in the long term.

Learn more about balance here:

https://brainly.com/question/28699225

#SPJ11

Drag each option to the correct location.
Match the scenarios to the factors that affect the labor market.
foreign direct investment
outsourcing
immigration

Answers

Each scenario should be matched to the factors that affect the labor market as follows:

Immigration: Carlos is moving from Mexico to the United States because he got a job in a bank. He had his interview last month, and the bank agreed to hire him because he was willing to work for 10% less than most American workers, even though he has the same qualifications.Foreign direct investment: A US supermarket chain is going to open a few supermarkets in Europe because a recent survey showed that the chain has a huge potential for profits in Europe.Outsourcing: A renowned US information technology firm has recently signed a contract with a company based in the Philippines. The Filipino company will handle the accounts of the US firm. The US firm made this decision to reduce labor costs.

What is immigration?

Immigration can be defined as the movement of a group of people from one geographical region to another geographical destination such as a city, especially in search of any of the following:

Good governanceSecurityBetter living conditions.WorkJobsSocial amenities

What is a foreign direct investment?

A foreign direct investment (FDI) simply refers to a type of investment which is made by an individual or business organization (investor) into an investment market that is located in another country.

In conclusion, an example of foreign direct investment (FDI) is a US supermarket chain that is planning to open a few supermarkets in a country in Europe.

Read more on immigration here: brainly.com/question/9809956

#SPJ1

Drag each option to the correct location.Match the scenarios to the factors that affect the labor market.foreign

Answer:

Post Test: Free Market and Businesses

Unit: 2

Economics

Question #12

__________________________________________________________

This is 100% right because I took the test

Go to explanation for picture with answers

l

l

Explanation:

Here's the picture and I hope this helped!

Have a nice day!

Drag each option to the correct location.Match the scenarios to the factors that affect the labor market.foreign

assume that $1 is equal to ¥98 and also equal to c$1.21. based on this, you could say that c$1 is equal to: c$1(¥98/c$1.21) = ¥80.99. the exchange rate of c$1 = ¥80.99 is referred to as the:

Answers

The exchange rate of c$1 = ¥80.99 is referred to as the cross rate, which is calculated by dividing the exchange rate between two currencies by the exchange rate of a third currency.

In this scenario, the exchange rate between the US dollar (USD) and the Japanese yen (JPY) is given as $1 = ¥98, and the exchange rate between the Canadian dollar (CAD) and the US dollar is given as c$1 = $1.21. To determine the exchange rate between the Canadian dollar and the Japanese yen, we can calculate the cross rate.

The cross rate is calculated by dividing the exchange rate between two currencies by the exchange rate of a third currency. In this case, we divide the exchange rate of ¥98 by c$1.21:

¥98 / c$1.21 = ¥80.99

Therefore, the exchange rate of c$1 = ¥80.99 is the cross rate between the Canadian dollar and the Japanese yen.

Cross rates are useful when direct exchange rates between two currencies are not readily available. By using a common third currency, cross rates allow individuals or businesses to estimate the exchange rate between two currencies indirectly.

Learn more about exchange rate here:

https://brainly.com/question/13717814

#SPJ11

A toy company reported these data for its operations for the most recent year: sales: $5,000,000 total fixed cost: 1,000,000 net income: 800,000 the toy company has five stores. Each store is open an average of 12 hours per day each day of the year. The average sales amount per customer is $2. How many customers must visit each store per hour for the toy company to break even for the year?

Answers

Answer:

The company needs approximately 67 customers per hour.

Explanation:

To determine the number of customers per hour needed to break even, we need to first calculate the company's total variable costs. We can use the contribution margin ratio to do this.

The contribution margin ratio is the difference between the sales price and the variable cost per unit, divided by the sales price. In this case, the average sales per customer is $2, and we know the net income is $800,000, so we can calculate the total variable costs as follows:

Contribution margin ratio = (sales price - variable cost per unit) / sales price

800,000 / 5,000,000 = (2 - variable cost per unit) / 2

Variable cost per unit = $0.60

Next, we need to calculate the number of customers per hour needed to cover the fixed costs. The fixed costs are $1,000,000, and the stores are open for 12 hours per day, 365 days per year, so the total hours of operation are:

12 hours/day/store * 5 stores * 365 days/year = 21,900 hours

To break even, the company needs to cover its fixed costs, which means it needs to generate enough revenue to cover the fixed costs plus the variable costs for each unit sold. The contribution margin per unit is:

Sales price - variable cost per unit = $2 - $0.60 = $1.40

So, the number of customers per hour needed to break even is:

Break-even point = Fixed costs / (Contribution margin per unit * Customers per hour)

1,000,000 / (1.40 * Customers per hour) = 21,900

Customers per hour = 67.05

Therefore, the company needs approximately 67 customers per hour at each store to break even for the year.

To learn more about, contribution margin ratio, click here:

https://brainly.com/question/30459935

#SPJ11

The budgeting process would normally begin with the preparation of a: A. cash budget. B. capital expenditure budget. C. sales budget. D. production budget.

Answers

The budgeting process would normally begin with the preparation of a sales budget.

What is sales budget?

A sales budget is a financial strategy that projects the total income of a business over a given time frame. To forecast the performance of the business, it focuses on two factors: the volume of goods sold and the price at which they are sold.

The sales allocation is really quite straightforward. Sales budget is determined as follows: sales volume (units) x selling price per unit.

The main goals of the sales budget are to predict sales and plan for the best possible use of resources. The data needed to create a sales budget originates from a variety of sources.

There are four kinds of budgets that businesses typically employ: incremental, activity-based, value-based, zero-based, and thirdly incremental.

To learn more on sales budget from the link:

https://brainly.com/question/16821253

#SPJ1

What are taxes?

Do taxes affect the government economic policies today?

Should taxes be lowered overall?

Should some groups be paying more than they are now?

Answer all please, 34 points :)

Answers

Answer:

1.Taxes are a amount of money that a government requires people to pay according to their income.

4.Yes, High marginal tax rates can discourage work, saving, investment, and innovation, while specific tax preferences can affect the allocation of economic resources. But tax cuts can slow long-run economic growth by increasing deficits.

3.lowering tastes would lead to raising in disposable income, allowing the consumer to spend additional sums, thereby increasing GNP. Reducing taxes thus pushes out the aggregate demand curve as consumers demand for more goods and services with their higher disposable incomes.

4.No, This reading is because people pay off their incomes so it would be unfair to charge higher then needed.

Answer:

What are taxes?

Taxes are amount of money that a government forces individuals to pay according to their income, the value of their property, etc., and that is used to pay for the activities done by the government.

Do taxes affect the government economic policies today?

Taxes affect the government economic policies today. High marginal tax rates may deter people from working, saving, investing, and innovating, while particular tax preferences can have an impact on how economic resources are allocated in a country. Tax cuts, on the other hand, might have the unintended consequence of slowing long-term economic development through boosting deficits.

Should taxes be lowered overall?

As you would anticipate, decreasing taxes increases disposable income, which allows consumers to spend more money, hence boosting gross national product (GNP). As a result, lowering taxes causes the aggregate demand curve to shift outward, as consumers seek more products and services as a result of their increased disposable incomes.

Should some groups be paying more than they are now?

Personally, I believe that one group should not be overtaxed at the expense of another group. While the tax rate for the rich is much higher, they are able to deduct a large number of expenses. The working middle class bears the brunt of the burden of taxes, whilst the impoverished get the advantages of them. I feel that it would be considerably more equitable to impose a single flat rate tax on everyone and to prohibit the use of write-offs altogether.

Explanation:

Hope it helps:)

What does it mean to follow ethical principles?

Answers

Following ethical principles is like like justifying or defending moral rules and judgements

a home builder wants to construct a house on his lot. the house will sit 20' from the front lot line. the city ordinance calls for a minimum setback line of 25'. in order to construct his house in the manner described, the builder must obtain a: select one: a. variance. b. spot zoning permit. c. special use permit. d. non-conforming use license.

Answers

The correct answer is: a. variance.

in order to construct the house with a setback of 20' from the front lot line, which is less than the minimum setback required by the city ordinance (25'), the builder would need to obtain a:

a. variance.

a variance is a permission or exception granted by the local zoning authority that allows a property owner to deviate from certain zoning regulations or requirements. in this case, the builder would need to request a variance to construct the house with a setback of 20' instead of the required 25' setback.

a spot zoning permit typically refers to the process of designating a specific area or spot for a particular use within a larger zoning district. a special use permit is required for specific uses that may have an impact on the surrounding area, but it doesn't apply to setback requirements. a non-conforming use license is related to properties that were legally established before zoning regulations were enacted and do not comply with current zoning requirements.

Learn more about exception here:

 https://brainly.com/question/31238254

#SPJ11

Other Questions
Sandy brought 6 1/4 dozen cookies to the bake sale. Alejandro brought 1 3/4 fewer cookies than Sandy brought. Pierre brought 2 3/4 dozen fewer cookies than Alejandro brought. How many dozen cookies did Pierre bring? write the equation of the line that passes through the points (8, -1) and (2,-5) in standard form, given that the point- slope form is y + 1 = } (x 8). How does the author address aconflicting point of view? A company sells merchandise to a customer on credit. The journal entry to record this transaction would include a debit entry to the Accounts BLANK account.receivable Candela subscribes to norms that emphasize independence, fending for oneself, and achieving whatever heights one aspires to. candela is most likely from? Which of the following options correctly describe the general trends in polarizability? Select all that apply.Anions are larger than their parent atoms and are therefore more polarizable.The greater the number of electrons a particle has, the greater its polarizability will generally be.Polarizability increases down a group on the periodic table. What is the best way to treat a bacterial infection?. Tory and her friend Terrence ride their bikes to school each day. On one particular day, Tory started out 5 minutes before Terrence. Tory rides at a rate of 880 feet per minute and Terrence rides at a rate of 1.056 feet per minutHow long had Tory been riding when Terrence caught up with her? The project will be using a company to provide the technicians for a national network upgrade project. The buyer is providing to the prospective seller a greatly detailed description of what the buyer wants the seller to do on the project. What type of document is being provided to the seller Find the equation of a line that passes through the points (2,13) and (1,8) WILL GIVE BRANLIEST !Case #28104Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.Part TwoCopy the DNA sequences for each suspect into a Word document.Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.Repeat step 1 with the DNA samples for Suspects B and C.Suspect ATCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGASuspect BTCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGASuspect CTTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGAProbeAGGTQuestionsAnswer these following questions in the essay box below.1. Which suspect most likely committed the robbery?2. How do you know? stocks A and B have the following returns: (Click on the following icon in order to copy its contents into a spreadsheet.) AWN 1 2 3 4 5 Stock A 0.11 0.04 0.13 -0.04 0.08 Stock B 0.05 0.03 0.05 0.01 -0.01 a. What are the expected returns of the two stocks? b. What are the standard deviations of the returns of the two stocks? c. If their correlation is 0.42, what is the expected return and standard deviation of a portfolio of 51% stock A and 49% stock B? Find the volume of the solid obtained by rotating the region bounded by the given curves about the x-axis.y = 3 3x^2, y = 0 How do I simplify this?[tex]\frac{\sqrt{12} }{\sqrt{15} }[/tex] Which of the following statements is not accurate as concerns the task of identifying the strategic issues and problems that management needs to address and try to resolve in deciding what upcoming strategic actions to take? Identifying the strategic issues and problems that the company faces is the first thing that company managers need to do before starting to analyze the company's external environment, resources, capabilities, and overall competitiveness. A strategy is neither complete nor well matched to the company's situation unless it contains A actions and initiatives to address each issue or problem on the "worry list." Only after managers have first done serious strategic thinking about the items on the worry list are they truly prepared to pick and choose among the alternative strategic actions and initiatives in fashioning an overall strategy that suits the company's situation. The purpose of compiling a worry list is to create an agenda of items that merit top-priority managerial consideration before attempting to craft a strategy well-suited to the company's overall situation--this is because the items on the worry list are most definitely a relevant and important part of the company's situation. Compiling a "worry list" involves drawing heavily on the results of the analysis of both the company's external and internal environments. find the equation of the line , use exact numbers What were attitudes toward the armistice ending World War I? How hawk and chicken game helps you physically fit Sally Paper is responsible for gathering information for completion of birth certificates at Sunny View Hospital. After the application for the birth certificate is completed, she should forward each to the the _?_ is composed of bands of the internal oblique muscle that elevates a testis.