The Galapagos island Finches that Darwin studied are a great example of the process of speciation. Which type of speciation would this be, and explain why?

Answers

Answer 1

The Galapagos Island Finches that Darwin studied are an example of allopatric speciation, which occurs when populations of the same species become geographically isolated from each other, resulting in genetic divergence and ultimately the formation of new species.

The finches' isolation on different islands led to natural selection favoring certain traits that were better suited to the specific island's environment, leading to the development of distinct beak shapes and other physical differences between the populations.

Over time, these differences accumulated to the point where the finches on different islands could no longer interbreed, and thus became separate species.

To know more about allopatric speciation, refer here:

https://brainly.com/question/4493180#

#SPJ11


Related Questions

HURRY PLEASE DUE IN 6 MIN
WHAT ARE THE SOURCES OF THE SUNS ENERGY?

WHAT DO ELECTRICITY CHARGED PARTICLES FROM THE SUN CAN STRIKE IN EARTHS MAGNETOSPHERE TO LEAD TO THE PRODUCTION OF SHEETS OF LIGHT KNOWN AS AURORAS?


WHICH LAYER OF THE SUN HAS THE DENSEST MATERIAL?

Answers

Answer:

The sun is a star, this means the sun generates energy from a process called nuclear fusion. During nuclear fusion, the high pressure and temperature in the sun's core cause nuclei to separate from their electrons. Hydrogen nuclei fuse to form one helium atom. During the fusion process, radiant energy is released.

In the north, the display is called aurora borealis, or northern lights. In the south, it is called aurora australis, or southern lights. The activity that creates auroras begins on the sun. The sun is a ball of superhot gases made up of electrically charged particles called ions. I got u bro.

Explanation:

A microorganism which releases water into its environment to regulate its salinity during osmosis is undergoing a process that is similar to a human being who releases moisture on a hot day. This process that helps keep both the microorganism and the human body fluids in balance is known as -
f cell division
g mutation
h homeostasis
j heredity

20 points !

Answers

process that helps keep both the microorganism and the human body fluids in balance is known as homeostasis

What is homeostasis?

Homeostasis is the ability of an organism to maintain a steady and balanced internal environment in spite of changes in the external environment. This is accomplished using a variety of physiological and behavioral mechanisms that collaborate to control and maintain the balance of the body's numerous systems and processes.

Temperature regulation, fluid balance, pH balancing, and blood sugar regulation are a few examples of homeostatic processes. For an organism to survive, it must maintain homeostasis because it enables efficient functioning and controlled responses to environmental changes.

Learn about homeostasis here https://brainly.com/question/1046675

#SPJ1

True or false: Due to starvation, amino acids from muscle tissue are converted into glucose. This wastes muscle tissue and can lead to edema.

Answers

Answer:

True

Explanation:

Because all the amino acids in the tissue muscle are converted tp glucose so u could have energy to live

What is the selection that is changing bacteria in populations and how is this happening?

What is the selection that is changing bacteria in populations and how is this happening?

Answers

Answer:

The selection that is changing bacteria in populations is natural selection. Bacteria populations can evolve through natural selection, which occurs when certain traits that confer a reproductive advantage are favored, and thus become more prevalent in the population over time.

In the case of bacteria, natural selection can occur through a variety of mechanisms. One example is the acquisition of antibiotic resistance. Bacteria that have a genetic mutation or acquire a resistance gene through horizontal gene transfer may be able to survive and reproduce in the presence of antibiotics, while bacteria that do not have the resistance gene will die off. Over time, the proportion of bacteria in the population that have the resistance gene will increase, leading to an overall increase in antibiotic resistance in the population.

Other factors that can drive natural selection in bacteria populations include changes in environmental conditions, competition for resources, and the ability to adapt to different niches or host organisms. In general, natural selection favors traits that increase an organism's ability to survive and reproduce in a particular environment or ecological niche.

Which is the greatest advantage to asexual reproduction

Answers

Asexual reproduction does not require a partner.

"Overall, how well do you believe the Bearington plant case and Theory of Constraints (TOC) in general align with the habits of highly effective people? (Describe and support your
conclusion).

Answers

The Bearington plant case and the Theory of Constraints (TOC) align well with the habits of highly effective people.

Firstly, TOC emphasizes the habit of prioritizing and focusing on the most critical aspects of a system or process. In the Bearington plant case, the TOC approach identified the bottleneck operation and focused efforts on improving its efficiency. This aligns with the habit of highly effective people who prioritize their tasks based on their importance and impact.

Secondly, TOC encourages continuous improvement and problem-solving. The case study demonstrates this through the implementation of various improvement initiatives to address the bottleneck and optimize the entire system's performance. This aligns with the habit of highly effective people who constantly seek ways to enhance their processes and overcome obstacles.

Furthermore, TOC promotes a systems-thinking mindset, which is also essential for highly effective individuals. It encourages considering the entire system rather than optimizing individual components in isolation. In the Bearington plant case, the TOC approach aimed to improve the overall throughput of the plant, taking into account the interdependencies between different operations. This aligns with the habit of highly effective people who understand the interconnectedness of various factors and make decisions that consider the bigger picture.

In conclusion, the Bearington plant case and TOC align well with the habits of highly effective people. The focus on prioritization, continuous improvement, and systems thinking reflects the principles that highly effective individuals adopt in their personal and professional lives.

Learn more about Theory of Constraints  here:-

https://brainly.com/question/33051739

#SPJ11

1. Explain how naturally occurring phenomena, including the cycling of carbon and the flow of energy, contribute to the dynamic equilibrium within and between ecosystems.
2. Compare and contrast the processes of cellular respiration and photosynthesis and explain how their complementary relationship contributes to the dynamic equilibrium of ecosystems.
3. Explain the effects of three human activities on the dynamic equilibrium of ecosystems.

Answers

Naturally occurring phenomena, such as the cycling of carbon and the flow of energy, play crucial roles in maintaining the dynamic equilibrium within and between ecosystems. The cycling of carbon involves the movement of carbon compounds through various biological, geological, and physical processes, such as photosynthesis, respiration, decomposition, and the carbon cycle.

This cycling helps regulate atmospheric carbon dioxide levels and influences climate patterns. The flow of energy occurs through processes like photosynthesis and cellular respiration, where solar energy is converted into chemical energy and then transferred between organisms through food webs. This energy flow sustains life and drives the metabolic activities within ecosystems.

The dynamic equilibrium is maintained as carbon and energy continuously cycle through the biotic and abiotic components, allowing for the growth, reproduction, and interactions of organisms while keeping the ecosystem's overall functioning stable.

Cellular respiration and photosynthesis are two interconnected processes that contribute to the dynamic equilibrium of ecosystems. Photosynthesis is the process by which green plants and some bacteria convert light energy into chemical energy, producing glucose and releasing oxygen. This process removes carbon dioxide from the atmosphere and replenishes oxygen levels.

Cellular respiration, on the other hand, is the process by which organisms break down glucose and other organic molecules, releasing energy in the form of ATP and producing carbon dioxide as a byproduct. This complementary relationship is essential for the dynamic equilibrium as the oxygen produced by photosynthesis is used in cellular respiration, and the carbon dioxide produced by respiration is used in photosynthesis.

The continuous exchange of oxygen and carbon dioxide between these processes maintains a balance in atmospheric gases, enabling organisms to thrive within their ecosystems.Human activities can have significant impacts on the dynamic equilibrium of ecosystems. Three examples of such activities and their effects are as follows:

a) Deforestation: Clearing large areas of forests for agriculture, urbanization, or logging disrupts the carbon cycle and reduces biodiversity. Trees absorb carbon dioxide through photosynthesis, so deforestation leads to increased carbon dioxide levels in the atmosphere, contributing to climate change. It also disrupts the habitat for many species, leading to a loss of biodiversity and ecological imbalance.

b) Pollution: Release of pollutants, such as chemicals, heavy metals, and excess nutrients, into ecosystems can have detrimental effects. Pollution can contaminate water bodies, soil, and the air, affecting the health and survival of various organisms. It can disrupt the cycling of nutrients, harm plant and animal life, and lead to the degradation of ecosystems.

c) Overfishing: Excessive fishing beyond sustainable levels can disrupt the balance within marine ecosystems. Removing too many fish species disrupts food webs, affecting predator-prey relationships and leading to population declines or collapses. This can have cascading effects on the entire ecosystem, impacting biodiversity, trophic interactions, and overall ecosystem health.

These human activities interfere with natural processes, altering the equilibrium within ecosystems and often resulting in ecological imbalances, reduced resilience, and potential long-term consequences for both the environment and human societies.

For more such questions on energy

https://brainly.com/question/14512298

#SPJ8

TRUE / FALSE.
chlamydia trachomatis produces a dormant, resistant stage which is transmitted from one host to another. group of answer choices true false

Answers

The statement is true. Chlamydia trachomatis can produce a dormant, resistant stage that is transmitted from one host to another. Chlamydia trachomatis is a bacterial species that can cause various infections in humans, including sexually transmitted infections and ocular infections.

This bacterium has a unique life cycle that involves both an active and a dormant stage. The dormant stage, known as the elementary body, is a small, round, and infectious form of the bacterium. It is resistant to environmental conditions and can survive outside the host for a period of time.

During transmission, the elementary bodies of Chlamydia trachomatis are typically responsible for infecting new hosts. They can be transmitted through sexual contact, contaminated objects, or from an infected mother to her newborn during childbirth. Once inside a new host, the elementary bodies can enter host cells and differentiate into a metabolically active form called the reticulate body, which replicates and causes infection.

Therefore, it is true that Chlamydia trachomatis produces a dormant, resistant stage (elementary body) that is transmitted from one host to another.

Learn more about Chlamydia trachomatis at:

https://brainly.com/question/33318845

#SPJ11

to roughly what temperature would you have to cool the diver to produce the same change in the volume of air in her lungs

Answers

To produce the same change in the volume of air in the lungs of a diver, the temperature of the diver needs to be cooled to approximately 10°C.

As the diver descends into the water, the pressure on the lungs increases, compressing the air inside the lungs and reducing its volume. The pressure on the lungs increases by about 1 atmosphere (1 atm) for every 10 meters of depth, causing the air in the lungs to compress by a factor of 2 for every 30 meters of descent. This effect is known as Boyle's law.

To produce the same change in the volume of air in the lungs of a diver, the temperature of the diver needs to be cooled to approximately 10°C. This is because cooling the air in the lungs decreases the volume of the air in the same way that increasing pressure does, so lowering the temperature can offset the compression caused by increased pressure at depth.

Learn more about Boyle's law here:

https://brainly.com/question/21184611

#SPJ11

help to complete
…….. i’m confused

help to complete.. im confused

Answers

Cancer is a result of damage and mutations to the genes in a cell. Cancer cells often have damage to the apoptosis which control when cells multiply and divide. Cancer cells are unique in that they rapidly divide. Unlike healthy cells that do not multiply often. Healthy cells have genes that cause the cell to self-destruct when the cell is damaged, a process known as oncogenes.

I hope this helps

Pls hurry with answer

On a weather map what does this symbol mean.

////

A. Cloud Cover
B. Cold Front
C. Showers
D. Warm front

Answers

Answer:

Showers

Explanation:

I watch the news and weather

true or false the skeleton supports the body's softer tissue

Answers

The skeleton gives shape for the body, allows movement, support and protect the organs, produce bllod cells, and stores minerals. Being a true fact that it supports the body's softer tissues.

If you had a type of cancer that involved the immune cells in your central nervous system that ingest intruders (similar to how macrophages function in the peripheral body), what cell would be affected?

Answers

Answer:

Phagocytes.

Explanation:

Phagocytes are the cells which would be affected by the cancer that involved the immune cells in our central nervous system that ingest intruders. If the cells that ingested intruders also turn into cancer cells then there is decrease occur in the number of Phagocytes and the body's immune system get weaken and unable to defend the body against pathogens. Phagocytes are a type of white blood cells that use phagocytosis method to engulf bacteria, foreign particles, and dying cells to protect the body.

1. Given the double-stranded stretch of DNA below, determine the base sequence of
messenger RNA strand produced using this gene as the template. *Hint: Only one of the
two strands is used as the template.
5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'

3' TACGGTAACG AATTCGCCCGTAAT ATĄGGTACT 5


AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGA

How many amino acids will this protein contain?

Answers

Answer:

AUG-CCA-UUG-CUU-AAG-CGG-GCA-ULA-UAU-CCA-UGA

so 11

Explanation:

because every 3 bases code for 1 amino acid and to make it easier to count split into 3 so u can count easily.

hope this helps :)

Which of the following is present in eukaryotes......
A) Cell wall B) Flagellum
C)Diploid nucleus D) membrane bounded organelles

Answers

D. membrane bounded organelles

Answer:

Membrane bounded organelles are present in eukaryotes..

Explanation:

hope it is helpful to

Briefly describe how wind and ocean currents are created and how they affect Earth’s climate.

Answers

Answer:

ocean currents are driven by global wind systems that are fueled by energy from the sun.

Explanation: These currents transfer heat from the tropics to the polar regions, influencing local and global climate

11. Two fruit flies have different parents. One fruit fly has orange eyes while the other has red eyes.
Why do the fruit flies have different eye colors?
a
Each fruit fly has a different eye color because offspring from different parents will have
different eye colors.
b
Each fruit fly has a different eye color because they have different versions of the gene for
eye color that connect together to make different eye colors.
с
The fruit flies have different versions of the gene for eye color, which instruct for different
proteins that connect in different ways to make different eye colors.
d
The fruit flies have different versions of the gene for eye color, and the genes are different
colors in each fruit fly's eyes.

11. Two fruit flies have different parents. One fruit fly has orange eyes while the other has red eyes.Why

Answers

Answer:

The fruit flies have different versions of the gene for eye color, which instruct for different proteins that connect in different ways to make different eye colors Explanation:

explaining voluntary control of micturitionclick and drag the appropriate word or phrase on the left to complete the sentences on the right. then, click and drag the sentences arranging them in order to accurately describe the process of voluntary voiding of the urinary bladder.

Answers

Voluntary control of micturition refers to the ability to consciously initiate or inhibit the act of urination. This process involves the coordination of both the sympathetic and parasympathetic nervous systems. When the bladder is full, stretch receptors in the bladder wall send signals to the spinal cord, which in turn sends signals to the brain indicating the need to urinate.

However, the external urethral sphincter, under voluntary control, can prevent the release of urine until it is appropriate to void. When the individual decides to urinate, the external sphincter relaxes and the detrusor muscle of the bladder contracts, causing urine to flow out of the body.
Voluntary control of micturition refers to the conscious decision to empty the urinary bladder. The process involves a coordinated effort between the central nervous system and the muscles of the urinary tract. During voluntary micturition, the detrusor muscle contracts while the internal and external urethral sphincters relax. This action allows urine to flow from the bladder through the urethra and exit the body.

The brain plays a crucial role in this process by receiving sensory signals from the bladder and initiating the appropriate motor response. Ultimately, voluntary voiding of the urinary bladder is a complex process involving coordination between multiple muscles and neural pathways.

To know more about bladder visit-

https://brainly.com/question/6388558

#SPJ11

First correct answer gets Brainliest! Please answer!
(About Parkinson's Disease)
What gene is affected?
What kind of mutation is it?

Answers

Answer:

Parkinson disease is caused by mutations in the PARK7, SNCA, PINK1, PRKN, or LRRK2.

Explanation:

These are all genes that can be affected.

The correvisin sequires a prim perised adiuartmant. a The wormita +ntry will be difierent than if the erroe had besw सacrerted the poritul year whest it ocrarred. 6. The 20×1. Pepriciation Expener arroent will be involved in the poereving eutigh d. Aal sheve natemente arv trae. 44. Which of the fallowing is an ancurafe description ef the w failare to recerd ab ecriasl is Hikely tio be found? a. An expense that was not acrerued is paid, but there ia no poyaBLe wn thr tooks as thres thould be b. A revenue that was not aceroed is received, but there is ne receiv. attle on the beoks as there shoald be. c. A review of the trial balnnce teveals that aat asset or liability. actoant that ia norrally pireient after secrals are recorded is. fit presest. 4. All abere statemant are sccurate deseriptions of how faiture to fecord an accual is likely to be found 45. A comparison of thin your's trial bolance with lant year's may be w good พay to discever … a. whetber nurmal accuals were made this year- b. whether normal defirrals were made this year c. errers in accruate of deferrals that have resalted in overi or ugderetatement of revenues or expensef d. all of the abowe? 46. When trying to find errun in a trialhalance that docs not balance, the first step should be to ... it. mork from the ledger to the trial balance in check the jourran! entries and postings for errors b. see if the ledger acerant balanter have been calcalated correctly c. work from the ledper to the trial balance to verify that ledger account balances were transferred to the ourrect debit or credit: colurans d work from the trial balance to the ledger to verify that ledger: account balances were transferred to the corrcet debit or credit columns

Answers

The accurate descriptions are as follows: For question 44, none of the options accurately describe the likely finding when a failure to record an accrual occurs. For question 45, the accurate description is option (d): all of the above. For question 46, the correct first step to find errors in an unbalanced trial balance is to work from the ledger to the trial balance and verify the correct transfer of ledger account balances, which corresponds to option (c).

It appears that the text provided contains several errors and inconsistencies. However, I will attempt to address the questions based on the context and assumptions made.

44. The inaccurate description of the failure to record an accrual that is likely to be found is option (c): A review of the trial balance reveals that an asset or liability account that is normally present after several are recorded is not present. In reality, if an accrual is not recorded, it would lead to an understatement or omission of expenses or revenues, not the absence of assets or liabilities in the trial balance.

45. A comparison of this year's trial balance with last year's may be a good way to discover whether normal accruals or deferrals were made this year and whether errors in the accurate or deferred recognition of revenues or expenses have resulted in over- or understatement. Therefore, the correct option is (d): all of the above.

46. When trying to find errors in a trial balance that does not balance, the first step should be to work from the ledger to the trial balance to verify that ledger account balances were transferred to the correct debit or credit columns. This option corresponds to option (c).

Learn more about errors

https://brainly.com/question/28008941

#SPJ11

can dogs the poison ivy?

Answers

Explanation:

Though cases of a dog being affected by poison ivy are rare, if you have a canine companion with sensitive skin, you should keep him away from the plant, just in case. “After being in an area with poison ivy or oak, you should wash your dog,” Nold suggests.

Answer:

Unfortunately, yes, your dog can get poison ivy. Fortunately, dogs getting poison ivy is not as common as it is in humans. It is tougher for poison ivy to make contact with the dog's skin since they are covered in protective fur. If your dog does get poison ivy it is easily treatable.

Based on the data in Table 1, identify the animal that has the greatest number of sequence differences from the reference animal.

Answers

Answer:

( please like and hope it helps)

A) Elephas-2 has 13 sequence differences from the reference animal, and this is the greatest number of animals in the table.

B) From left to right, the order at the tips of the cladogram is: Dugong , Elephas , Loxodonta , Mammathus.

(Loxodonta and Mammuthus can also be reversed)

C) The molecular data, such as that for are widely conserved protein such as cytochrome b , show conserved similarities between organisms such as to dugongs and proboscideans and can be used to support the existence of this relationship.

D) The animals that are related ones had a common assister with certain genetic characteristics. Adaptation to different habitats leads to diversification of morphology but does not change evolutionary relationships.

Sequence differences in genes or genomes are used to determine organisms that are most related to each other based on evolution.

What does sequence difference mean?

Sequence differences are differences which exists in the entire genome or a gene which code for proteis s whivh are related on function or structure in two organisms.

For proteins performing similar functions, organisms which have the least sequence differences are usually the most related organisms in an evolutionary sense whereas, organisms with the most sequence differences are the least related.

Therefore, sequence differences in genes are used to determine organisms that are most related to each other based on evolution.

Learn more about genes at: https://brainly.com/question/1480756

Which of the following must occur before DNA replication can take place?

Answers

Answer:

Before replication can occur, the length of the DNA double helix about to be copied must be unwound. In addition, the two strands must be separated, much like the two sides of a zipper, by breaking the weak hydrogen bonds that link the paired bases.

Explanation:

Number of Individuals 120 100 80 60 40 20 0 1.4 meters meters Height 30 Years Ago Present Data Part B The researcher thinks the changes in data are a result of selection. Do you think directional, disruptive, or stabilizing selection is occurring? How does your data support this conclusion?​

Answers

All selection kinds have the same ideas, yet they differ greatly. In contrast to directional selection, which prefers just one extreme, disruptive selection encourages both extreme phenotypes.

What real-world example would best illustrate directed selection?

Galapagos Island's arid climate causes plants to produce large seeds with a tough seed coat.Finches with small beaks cannot eat these large, difficult seeds.The drought affects the direction of selection in the finch beaks as well as the size and hardness of the seeds.

Stabilising selection favours the median phenotype, which over time minimises diversity in a population.

Birth weight is a prime example of a trait that has strong stabilising selection when it is present.

Learn more about stabilising selection

https://brainly.com/question/3490954

#SPJ1

Can someone pleaseee help me with this It’s urgent! It’s multiple choice! Plsssss help (20 points)

Can someone pleaseee help me with this Its urgent! Its multiple choice! Plsssss help (20 points)

Answers

Answer:

Explanation:

8/c

9/c

10/c

12/b

13/a

14/b

and i am not sure about 12/9

Full from of DNA
Full from of RNA

Answers

Answer:

DNA=Deoxyribonucleic Acid

RNA=Ribonucleic acid

why do small farmers do better in an equal exchange coffee chain

Answers

Small farmers may do better in an equal exchange coffee chain for several reasons: Fair prices, Direct relationships with buyers, Capacity building, Environmental sustainability.

Fair prices: Small farmers often struggle to earn a living wage due to the volatile nature of coffee prices on the global market. However, in an equal exchange coffee chain, farmers are paid a fair price for their coffee beans that covers the cost of production and allows them to earn a sustainable income.

Direct relationships with buyers: Equal exchange coffee chains typically involve direct relationships between small farmers and buyers, which can eliminate the need for middlemen and ensure that farmers receive a higher share of the profits. These relationships also provide farmers with greater stability and security, as they know that they have a consistent buyer for their coffee.

Capacity building: Equal exchange coffee chains often provide small farmers with training and resources to improve the quality of their coffee beans and increase their productivity. This can lead to higher yields and better quality coffee, which can fetch higher prices on the market.

Environmental sustainability: Equal exchange coffee chains often prioritize environmental sustainability, which can benefit small farmers who rely on the land for their livelihoods. By promoting organic and shade-grown coffee, these chains can help protect the environment and support the long-term viability of small farms.

Overall, small farmers may do better in an equal exchange coffee chain because they are able to earn fair prices, build direct relationships with buyers, access resources to improve their coffee production, and promote environmental sustainability.

To know more about environment please refer:

https://brainly.com/question/29244782

#SPJ4

the size difference between most multicellular hosts and their pathogens results in which of the following evolutionary advantages for the pathogen? group of answer choices pathogens have larger population sizes and shorter generation times than hosts, allowing for increased rates of adaptation. pathogens have lower mutation rates than hosts, resulting in more stable populations. hosts evolve more rapidly due to mutations induced by the pathogen. host population sizes increase in the presence of a pathogen, providing more potential hosts for infection.

Answers

Pathogens can adapt more quickly than hosts since they have higher populations and faster generation periods.

Pathogens, of course, have the advantage in this evolutionary game because they can change far more quickly than the hosts—especially in long-lived animals like humans—due to their high population numbers and rapid generation rates. The relationship between surface area and complement activation shows how bacterial pathogenicity may be influenced by tiny size. The region of the microbial surface may also have a role in their action since other antimicrobial agents are focused there. A pathogen reacts with the host and creates infection, which results in the host being ill. Any dangerous microbial agent, including bacteria, viruses, protozoa, fungi, and helminths, might be considered a pathogen.

Learn more about pathogen

https://brainly.com/question/13051879

#SPJ4

jelly fish do not have a heart, True stomach

Answers

Thx that’s an awesome fact I didn’t know that

Plz help! In a density-dependent population, a decrease in which of the following will most likely cause an increase in birthrate?
Carrying capacity
Death rate
Emigration
Immigration

plz don't put link or ill report

Answers

Immigration because that is people coming in which would make the population rise

In a density-dependent population, a decrease in the death rate will most likely cause an increase in birthrate. It is because a lower death rate means that more individuals are surviving, which can lead to an increase in the number of individuals reproducing, ultimately resulting in a higher birthrate. The correct option is B.

What is a density-dependent population?

As we know that a population's birthrate tends to increase if there is a decrease in death rate, which also results in a decrease in carrying capacity.

Also, a density-dependent population is a population where the death rate increases and birthrate decreases with increasing population density, and vice versa. So, a decrease in the death rate of a density-dependent population will most likely cause an increase in the birthrate.

A density-dependent population is a population where the death rate increases and birthrate decreases with increasing population density, and vice versa. A decrease in the death rate of a density-dependent population will most likely cause an increase in the birthrate.

Therefore, the correct option is B.

Learn more about Density-dependent population here:

https://brainly.com/question/12655151
#SPJ3

Other Questions
Suppose the curves r1(t)=t2t^2+6,2t1,t6 and r2(s)=1305s^2,2s+11,s2 both lie on a surface S and intersect at P(5,1,7). Find an equation of the tangent plane to the surface S at point P. The minute hand on a clock tower is 6 feet long. At 10 minutes after the hour, the tipof the minute hand is 55 feet above the ground. How high above the ground is thecenter of the clock face? Explain how you know. Kingbird, Inc. sells 450 shares of common stock being held as an investment. The shares were acquired six months ago at a cost of $50 a share. Kingbird sold the shares for $51 a share. The entry to record the sale is:_____. a) A tourist is going to visit 6 different cities in the UK. She can fly to any of the cities at the start of the trip, and from any of the cities to her country at the end of the trip. She can travel between any two pair of cities by two different means of transport (bus or train) (i) In how many different orders can she choose to visit the attractions? (You should [4%) stato which formula you are using, and justify its use.) (ii) For any fixed choice of order, how many different ways are there for her to .[4%] complete her journey? (You should state which formula you are using, and justify its use.) Complete each sentence with a word from the box What happens to the other organisms in a food chain when an organism in the middle of the food chain is lost? Which is the correct answer for 7 x 8 = 56A) 7 times as many as 8 is 56B) 8 times as many as 7 is 56C) 56 times as many as 8 is 7 Which answer gives both a positive impact and a negative impact associated with the effects of nitrogen- and phosphorus-enhanced fertilizers?. Which could be a product of biotechnology?A. a potato that resists frostB. a chicken coopC. a microscope D. a laboratory Which type of shock results from the effects of infectious agents, such as bacteria, releasing toxins in the blood? A hiker travels at 4 miles per hour at a heading of S 35 E from a ranger station. After 3 hours how far south and how far east is the hiker from the station? Anyone know how to get the answer 1/2 in the problem? Please help, Just the question that is asked please. Find the measure and solve for x What are SAM, BAM, and BAI files? What are the differencesbetween them files? How are they generated? what does the phrase ''If you don't want your life to be a circus, then you need to stop hanging out with clowns!'' mean Kims family spends $62.50 on dinner. They leave an 18% tip. How much is their total bill after tip? An 8-ounce serving of apples contains 8% of your daily vitamin C. How many ounces of apples would you need to get 100% of our daily vitamin C? please answer this. Patients who are considered mentally competent have a right to consent or refuse medical treatment. what is the legal term for this right?