Answer:
a. located on the inner surface and oriented perpendicular to the minor and major grooves of DNA.
Explanation:
The beta subunit of the Polymerase III is a ring-shaped clamp that embraces DNA in a central 35-angstrom (A) hole and plays an important role in the processivity of the enzyme during DNA replication. The beta subunit of the Polymerase III is a homodimer composed of two monomers (each of 366 amino acids), where each monomer provides one half of the ring-shaped clamp. In the beta dimer, this hole is sufficiently large to accommodate the double helix of DNA.
23
Put the 4 phases of mitosis in the correct order.
III
Prophase
Telophase
III
Anaphase
III
Metaphase
Answer:
beef
Explanation:
poop
Answer:
prophase, metaphase, anaphase, and telophase
Explanation:
I'm happy to help
explain the importance of all 3 biomolecules in general and for making ATP.
The three biomolecules that are used for making ATP are Lipids (fats) , Carbohydrates and Proteins
The biomolecules also known as biological molecules serve a wide range of activities and they vary in shape and their size . It is also considered essential to life because they help organisms develop, survive, and propagate. The biomolecules interact with one another which play a role in the development of organisms .
There are four types of biological molecules which are carbohydrates which is used as an energy source , lipids which is used for storage and support , proteins is used for supporting essential vital functions and amino acids are the developing elements that make up proteins and nucleic acids for storing genetic information .
To learn more about biomolecules
https://brainly.com/question/12299485
Can every atom form each of these kinds of bonds?
Answer: No They Can Not\ XD
I'LL MARK THE BRAINLIEST!
What did Mendel's cross-pollination of pea plants prove?
A} Certain factors are dominant, and other factors are recessive.
B} Crossing a tall plant with a tall plant will always result in a tall plant.
C} All the cells in an organism carry the same hereditary factors.
If the unfertilized egg of a bird contains 18 chromosomes, how many chromosomes would be found in the same bird's muscle cell?
Answer:
36
Explanation:
you times the amount chromosomes by 2
Did you ever think a papaya could get a vaccination? It turns out that it can, sort of. While genetically modified fruits and vegetables remain fairly rare, the papaya is one exception. Most papayas in the United States are grown in Hawaii, where they are important and profitable for the state's economy. After a papaya virus devastated Hawaiian papaya production in the 1990s, papayas engineered for resistance to the virus were approved and brought to the market. Now, more than 80% of Hawaiian papayas are genetically modified. What are the benefits of this example of GM food?
Write a short argument in favor of this use of genetic engineering below.
The use of genetic engineering methods to p[roduce genetically modified foods such as the papaya has resulted in increased yield of papaya and improved its resistance to diseases.
What are genetically modified foods?Genetically modified foods refer to foods made from organisms whose DNA has undergone modifications through genetic engineering techniques.
Among the advantages of genetic engineering in agriculture are higher crop yields, lower costs for food or drug production, a decrease in the need for pesticides, improved nutrient composition and food quality, resistance to pests and disease, and greater food security.
Learn more about genetically modified foods at: https://brainly.com/question/9779863
#SPJ1
if the offspring generation of problem 1 is crossed with the tall plant from a tall lineage, what will be the phenotypes and in what ratio for the offspring? what will be the genotypes and in what ratio?
In complete dominance, the presence of at least one dominant allele in the genotype is enough to express the dominant phenotype because the recessive allele expression is inhibited. Expected Phenotype: 100% tall plants. Expected genotype: 50% TT and 50% Tt. Genotypic ratio ⇒ 1:1
What is complete dominance?
Complete dominance is the inheritance pattern through which the dominant allele of a gene can hide the expression of the recessive allele in the same genotype.
This is evident in heterozygous individuals that carry one dominant and one recessive allele of the same gene. These individuals will only express the dominant phenotype, because the recessive allele is being inhibited.
In pea plants, a diallelic gene codes for plants height,
T is the dominant allele and codes for tall plantst is the recessive allele and codes for dwarf plantsProblem 1)
Cross: true breething tall plant with dwarf plantParentals) TT x ttF1) 100% of the progent is expected to be heterozygous for the trait (Tt) and express the dominant tall phenotype.
Problem 2)
Cross: individual from F1 with tall plant from a tall lineageParentals) Tt x TTGametes) T t T TPunnett square) T tT TT Tt
T TT Tt
F2)- 50% of the plants are expected to be homozygous dominant, TT
- 50% of the plants are expected to be heterozygous, Tt
- 100% of the plants are expected to be tall.
According to this explanation,
Expected Phenotype: 100% tall plantsExpected genotype: 50% TT and 50% Tt.Genitypic ratio ⇒ 1:1You can learn more about complete dominance at
https://brainly.com/question/1953851
#SPJ1
Problem 1)
The gene for tall is dominant over dwarf in the garden pea plants used by Mendel. A peaplant that comes from a line of plants that are all tall is corssed with a dwarf plant. What is the phenotype of the F1 generation? What is the genotype of the F1 generation?
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.
Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.
Methionine can be abbreviated as Met.
The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.
We can use the codon chart to determine the amino acid sequence.
The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.
Each codon codes for a different amino acid.
For example, the codon AUG codes for the amino acid methionine.
To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).
Then we write down the amino acid sequence for the codons we read, using the codon chart.
Here, the sequence starts with AUG, which codes for methionine.
After that, the next codon is UAA which is a stop codon, so we can stop.
The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).
For more such questions on Methionine
https://brainly.com/question/29481268
#SPJ8
The graph of a function never has two different points with the same x-coordinate because_
A. the graph of a function
B. the graph of a function is a vertical line
C. each input value is mapped to a single output value
D. each input value is mapped to more than one output value
Answer:
a the graph of a function I hope it will help you please follow me
What is the answer to this question
Answer:
A characteristic or feature of a substance is called...
a property
Explanation:
could Marcie have found a mineral? explaim why or why not
Answer:
yes
Explanation:
(c) Nancy's muscle cells produce carbon dioxide as she dances.
Which of the following shows how the carbon dioxide is removed from Nancy's body?
Answer: there is no following choices.
Explanation:
Who is in control during the process of cloning? Man or nature?
Answer:
man
Explanation:
the person has to do the actual clonin
PLEASE HELP!!!!!!!!!!!!!!!!!! Dr. Budai is determined to find the best solution to help the hotel, the new species, the butterflies, and the flowering plants coexist in the same location. She is hoping to accomplish this goal by genetically modifying one of the three organisms: the new species, the butterfly, or the flowering plant.
Now that you have explored modifying a trait for one of the species in the previous activity, answer the following questions.
question 1.What was the species and trait you investigated?
question 2.Why do you think the modification you explored would best help the organisms and hotel coexist? Explain your reasoning.
question 3. Dr. Budai is hoping you can help design a different modification from the one you already explored. What modification would you suggest? Do you think it would be more or less beneficial than the modification you discussed in Question 2? Explain your reasoning.
The answers include the following:
The species and trait you investigated was the the flowering plant and the trait was the bright colored flowers. The modification I explored would best help the organisms and hotel coexist such that it will ensure that the hotel is beautified and the organism will be be attracted to the pollen grains as food.The modification I would suggest is for more nectar to be present and it would be more beneficial due to more pollination occurring.What is Pollination?This is referred to as the transfer of pollen from an anther of a plant to the stigma of a plant, later enabling fertilization and the production of seeds.
The modification would best help the organisms and hotel coexist such that it will ensure that the hotel is beautified and provide it with an aesthetic feeling by the visitors.
Read more about Pollination here https://brainly.com/question/3431390
#SPJ1
are the chemoreceptor cells inside the taste buds. each gustatory cell terminates in a gustatory hair, which projects into the saliva to detect dissolved chemicals
Answer:
Gustatory Cells are the chemoreceptor cells inside the taste buds.
Explanation:
Hope it helps:)
Heavy growth in the incubator after bacterial strains were incubated in candle and anaerobic jars
Answer:
Heavy growth in the incubator refers to the significant increase in the number of bacteria that were being cultured or grown in a controlled environment. The incubator refers to the device that provides the optimal conditions, such as temperature and humidity, for the growth of microorganisms.
Explanation:
When bacterial strains were incubated in candle and anaerobic jars, it means that the bacteria were placed in two different environments to observe their growth. The candle jar is used to create a low-oxygen environment, while the anaerobic jar creates a completely oxygen-free environment. The fact that there was heavy growth observed indicates that the bacteria thrived and multiplied rapidly in both the candle jar and anaerobic jar. This means that the bacterial strains were able to adapt and survive in low-oxygen or oxygen-free conditions. Overall, the observation of heavy growth in the incubator after incubating the bacterial strains in candle and anaerobic jars highlights the ability of these bacteria to flourish in specific environments with limited or no oxygen availability.
In ecosystems, plants transform light energy from the Sun into chemical energy when they make sugar. This sugar can then be consumed by other organisms to be used as building blocks for other molecules, such as proteins and fats, or it can be transformed into other forms of energy, such as kinetic energy, when the organism moves. Which of the following statements is supported by the above information? A. Energy can change forms, but only one kind of matter exists. B. Matter can change forms, but only one kind of energy exists. C. Matter and energy can change forms and locations in ecosystems. D. Matter and energy must always remain in the same form and location.
Answer:
The answer is C. Matter and energy can change forms and locations in ecosystems.
Explanation:
.............................................................................
Answer:
thanks for this information but it seems like a great opportunity to work
Discuss the influence of environment on neonatal development
can affect neural, reproductive, immune and cardiovascular function
through air, water, food
pubmedncbinlmnihgov
HELLPPPP!!!!!! PLEASE 100 POINTS!
Cell Division Virtual Lab Activity
Instructions: The Virtual Cell Division Lab is on the lesson assessment page. On the image, it says “Click Anywhere to Start.” Follow the instructions as you move through the lab. The lab activity will keep count of your data on the right, and you can record this into the data table.
Title:
Objective(s):
Hypothesis:
Variables:
Data:
Record the number of cells you observed in the lab activity.
Stages
Number of Cells
Interphase
Prophase
Metaphase
Anaphase
Telophase
Cytokinesis
Observations:
Record any observations about the cells you observed. What does the cell look like for each stage? What is a distinguishing visible feature of each stage of the cell cycle?
Stages
Description of Cell
Interphase
Prophase
Metaphase
Anaphase
Telophase
Cytokinesis
Data Analysis:
Part 1: Calculate the percentage of the cell cycle spent in each stage. Number of cells in given stage ÷ total number of cells counted × 100 = % of the cell cycle spent in this stage
Part 2: Using your percentages in part 1, create a graph that represents the time spent in each stage of the cell cycle.
Insert chart [Hint: Don’t forget to consider the relationship between your data and the type of chart to best represent your data.]
Conclusion:
Include the following as a summary paragraph in the conclusion of your lab report:
Analysis of the results of the experiment
Based on your data, what can you infer about the length of time spent in each stage of the cell cycle?
What stages were the longest and shortest? Give a brief explanation of why these stages may have that time period.
Rationale for the support or rejection of the hypothesis
Questions:
Using what you have learned in the lesson and the virtual lab activity, answer the following questions in complete sentences.
What differences can you see when you compare the nucleus of a dividing cell with that of a non-dividing cell?
If your observation had not been restricted to the tip of the onion root, how would the results be different?
Answer:
Explanation:
Title: Cell Division Virtual Lab Activity
Objective(s):
To observe and record the stages of the cell cycle in onion root tip cells.
To calculate the percentage of time spent in each stage of the cell cycle.
To create a graph representing the time spent in each stage of the cell cycle.
Hypothesis: The time spent in each stage of the cell cycle will be approximately equal.
Variables:
Independent variable: stages of the cell cycle
Dependent variable: percentage of time spent in each stage
Data:
Record the number of cells you observed in the lab activity.
Stages Number of Cells
Interphase
Prophase
Metaphase
Anaphase
Telophase
Cytokinesis
Observations:
Stages Description of Cell
Interphase Around the nucleus, a membrane is visible. The chromatin is diffuse and spread out.
Prophase Chromosomes are visible and condensing. The nuclear envelope is breaking down.
Metaphase Chromosomes are aligned in the middle of the cell.
Anaphase Chromosomes are pulled apart and moving towards opposite poles.
Telophase Nuclear envelope is reforming around chromosomes. Chromosomes begin to uncoil.
Cytokinesis Cytoplasm begins to divide into two daughter cells.
Data Analysis:
Part 1: Calculate the percentage of the cell cycle spent in each stage. Number of cells in given stage ÷ total number of cells counted × 100 = % of the cell cycle spent in this stage
Stages % of the Cell Cycle
Interphase
Prophase
Metaphase
Anaphase
Telophase
Cytokinesis
Part 2: Using your percentages in part 1, create a graph that represents the time spent in each stage of the cell cycle.
[Insert chart]
Conclusion:
Based on the data collected, it can be inferred that the time spent in each stage of the cell cycle is not approximately equal. The longest stage is Interphase, while the shortest stage is Cytokinesis. This may be due to the fact that Interphase is a stage of cell growth and DNA replication, while Cytokinesis is simply the division of the cytoplasm. Therefore, more time is needed for the growth and replication processes. The hypothesis that the time spent in each stage of the cell cycle will be approximately equal is rejected.
Questions:
The nucleus of a dividing cell appears to be more condensed and visible, while the nucleus of a non-dividing cell appears more diffuse and spread out.
If the observation had not been restricted to the tip of the onion root, the results may have been different as the cell cycle may be different in different parts of the plant.
Which of the following substances can pass through the cell membrane?
A. Chloroplasts
B. Cytoplasm
C. Organelles
D. Waste
➯ According to me, the answer is D.
A. Chloroplasts.
B. Cytoplasm.
C. Organelles.
D. Waste. ✔See more at: https://brainly.com/question/16578706
➥ I hope I have helped you, greetings! Atte: ღTheGirlSadღa) Look back at your hypothesis from question 2. Could this hypothesis become a theory if
you repeated your experiment 100 different times and got the same results? Can a theory be
I
created by just one person? (2 points)
A car starts from rest and gains a velocity of 20 m/s in 10 s. Calculate acceleration and average velocity.
The acceleration of the car is 2 m/s².
The average velocity of the car is 2 m/s.
How to calculate acceleration ?The equation acceleration = (final velocity - beginning velocity) / time can be used.
Given:
Initial velocity (u) = 0 m/s (since the car starts from rest)
Final velocity (v) = 20 m/s
Time (t) = 10 s
Using the formula, we can substitute the values:
acceleration = (20 m/s - 0 m/s) / 10 s
acceleration = 20 m/s / 10 s
acceleration = 2 m/s²
Therefore, the acceleration of the car is 2 m/s².
You can use the following equation to determine the average velocity: average velocity = total displacement / total time.
The initial position and the final position are identical since the automobile begins at rest. As a result, the displacement and the ultimate position are equal.
Given:
Displacement = 20 m
Time (t) = 10 s
Using the formula, we can substitute the values:
average velocity = 20 m / 10 s
average velocity = 2 m/s
Therefore, the average velocity of the car is 2 m/s.
Learn more about substitute here : brainly.com/question/26094713
#SPJ1
HURRY
2. Identify two advantages of sexual propagation and two disadvantages.
Answer:
advantages and disadvantages of sexual and asexual reproduction produce Dun natak variation in the offspring the species can adapt to new environment due to variation which gives them a survival advantage a disease is less likely to affect all adventure in a population
The branch shown below has FOUR individual leaves. Use the dichotomous key to identify the tree’s genus and species.
A.Albizia julibrissin
B.Cornus florida
C.Juglans nigra
D.Pinus taeda
Im giving brainlist
Please select the word from the list that best fits the definition
minerals mined for titanium
usefulness, profitability
lightness, durability
ilmenite, rutile
automobiles, aircraft
beauty, rarity
Mark this and retum
Answer:
e
Explanation:
im just built different
Answer:
E
Explanation:
Which biome receives the most rain?
tropical rain forest
temperate rain forest
taiga
tundra
Answer:
do not know
Explanation:
Answer:
answer is A
tropical rain forest
Explanation:
got it right!
hope this helps
How would you explain the key concepts for the CWA in less than two minutes?
Answer:
Explanation:
vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.
Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.
Navigable Waters of the United States For the purposes of the Clean Water Act, the term "navigable waters" includes:
all waters used in commerce, including groundwater;
all interstate waters including wetlands, mudflats, and sand-flats; and
all other waters such as lakes, rivers, streams, wetlands and sloughs.
EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters." The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect. In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.
Additional executive orders were issued 2015 in 2019. Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.
Could the requirement for one or more NPDES Discharge Permit apply to my campus?
If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.
Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.
Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.
What do I have to do related to NPDES Discharge Permits?
Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.
French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.
Details of NPDES
A group of scientists build a net along a section of the river to separate a group of foreign fish species from the rest of the river. They wish to determine whether their experiment is a closed system by placing a colored dye in the fish's habitat and observing whether the dye escapes from the enclosure. Could this experiment determine whether the system is closed or not? Justify your answer based on the definition of a closed system
Answer:
This experiment would not be able to determine whether the system is closed or not
Explanation:
Sure, this experiment has the potential to determine whether the system is closed or open. If no dye departs the net and nothing comes into the net, it is a closed system.
What is a closed system?A closed system is a natural physical system that does not permit the transfer of matter into or even out of the system, though energy transfer is permitted in contexts such as physics, chemistry, and engineering.
A closed system is one in which only energy exchange is permitted but no matter exchange is permitted.
Yes, this experiment has the potential to determine whether or not the system is closed.
It is a closed system if no dye leaves the net and no dye enters the net. The description of a closed system is a region that is detached from its exterior by an edge that confesses no transfer of matter or energy across it.
Thus, the given one can be said to be in a closed system.
For more details regarding open and closed system, visit:
https://brainly.com/question/28354181
#SPJ2
Which organelle should be listed under “Both” in the diagram?
centriole
mitochondrion
chloroplast
cell wall
Answer:
Mitochondria is a powerhouse of the cell, it produces ATP by utilizing the energy released from oxidation while chloroplast produces energy through photosynthesis. Mitochondria are found in all types of living organisms while chloroplast is only found in green organisms. Though they have differences between them, they show some similarities in structures. Both have e a double wall layer that is an external and internal wall. Mitochondria and chloroplast both have genetic material which is DNA. After considering this similarities, they can be consider in both.
Explanation: