the following statements describe ideas about how students learn science that are supported by current learning theory, except:

Answers

Answer 1

Creating and utilizing the content utilizing their STEM expertise to address issues and provide information. Understanding and describing dynamic interactions by means of system behavior.

What are the three categories of scientific research?

Description inquiry, comparative enquiry, and experimental investigation are the three sorts of studies that scientists employ to explore and create answers for phenomena in nature.

What is involved in a scientific approach to education?

Through testing and experimentation, the scientific method develops facts in an objective manner. Making an observation, developing a hypothesis, making a prediction, carrying out an experiment, and evaluating the outcomes are the fundamental processes.

To know more about dynamic visit:

https://brainly.com/question/2363073

#SPJ4


Related Questions

What’s the use of short tandem repeat?

Answers

Answer: Ok So A short tandem repeat is a microsatellite with repeat units that are 2 to 7 base pairs in length, with the number of repeats varying among individuals, making STRs effective for human identification purposes.STRs are extremely useful in applications such as the construction of genetic maps (49), gene location, genetic linkage analysis, identification of individuals, paternity testing, as well as disease diagnosis 50., 51.. STR analysis has also been employed in population genetics.

Hope this helps have a awesome night/day❤️✨

Explanation:

explain two situations on a pedigree that would allow you to determine the genotype of an individual with the dominant phenotype

Answers

1) If the individual with the dominant phenotype has a parent with the recessive phenotype, the genotype of the individual is heterozygous (Aa).
2) If the individual with the dominant phenotype has offspring with the recessive phenotype, the individual must be heterozygous (Aa).

The two situations on a pedigree that would allow you to determine the genotype of an individual with the dominant phenotype.

Situation 1: Identify the individual with the dominant phenotype (let's call them Individual A).
Look for the parents of Individual A.
If one of the parents has the recessive phenotype (aa) and the other parent has the dominant phenotype (AA or Aa), then Individual A must be heterozygous (Aa). This is because the dominant phenotype is only expressed when at least one dominant allele is present.Situation 2: Identify the individual with the dominant phenotype (Individual B).
Observe the offspring of Individual B.
If Individual B has offspring with the recessive phenotype (aa), it means that Individual B must be heterozygous (Aa). This is because to have offspring with the recessive phenotype, both parents must contribute a recessive allele.

By analyzing the presence of the recessive phenotype in the parents or offspring of an individual with the dominant phenotype, we can determine their genotype as heterozygous (Aa).

For more such question on genotype

https://brainly.com/question/902712

#SPJ8

The dust bowl refers to _______. a. a football championship game b. a period of drought during the civil war c. years of dust storms in the Midwest in the 1930’s d. a large flood plain in Oklahoma Please select the best answer from the choices provided A B C D

Answers

The Dust Bowl was the name given to the drought-stricken Southern Plains region of the United States, which suffered severe dust storms during a dry period in the 1930s. Answer is C

The dust bowl refers to a period of drought during the civil war.

What do you mean by dust bowl?

The Dust Bowl was a period of severe dust storms that greatly damaged the ecology and agriculture of the American and Canadian prairies during the 1930s. The phenomenon was caused by a combination of both natural factors and manmade factors.

Economic depression coupled with extended drought, unusually high temperatures, poor agricultural practices and the resulting wind erosion all contributed to making the Dust Bowl.

The Dust Bowl, also known as “the Dirty Thirties,” started in 1930 and lasted for about a decade, but its long-term economic impacts on the region lingered much longer.

Learn more about dust bowl:

https://brainly.com/question/29761987

#SPJ6

Producers, consumers, and decomposers play important roles in the environment. Are there any organisms that would not fall into one of these categories? Explain your answer.

Answers

Answer:

No, there are no organisms that will not fall into these categories

Explanation:

Living organisms interact with one another in their natural environment in order to ensure that energy needed for their metabolic activities is obtained. To do this, each organism plays different or specific roles. The roles that every organism must fall into are as follows:

- Producers are groups of organisms that have the ability to synthesize their own food using light (photosynthesis) or chemicals (chemosynthesis). Examples are green plants, algae, some bacteria etc.

- Consumers- These are organisms that lack the ability to synthesize their own food and hence depend on other organisms for their energy source. Consumers can either be herbivores (eat plants) or carnivores (eat flesh) etc. Examples are all animals etc.

- Decomposers- These are organism that have the ability to breakdown dead organisms into organic matter, thereby, adding nutrients back to the soil. Examples are fungi, bacteria, earthworm etc.

Based on this explanation above, no organism will not fall into any of these three categories. Some can even occupy two roles.

In E. coli bacteria, the lac operon contains genes that code for enzymes that break down lactose. Which statement describes when the genes in the lac operon are expressed?

Answers

The genes in the lac operon are expressed when lactose is present and the repressor protein is unable to bind to the operator region.

In E. coli bacteria, the lac operon contains genes that code for enzymes involved in lactose metabolism. The lac operon is a regulatory system that controls the expression of these genes. The expression of the genes in the lac operon is tightly regulated and depends on the presence or absence of lactose and glucose in the environment.When lactose is present, it binds to the repressor protein (lac repressor), causing a conformational change in the repressor. This change prevents the repressor from binding to the operator region of the operon. As a result, RNA polymerase can bind to the promoter region and transcribe the genes, leading to the production of the enzymes that break down lactose.In the absence of lactose, the repressor protein binds to the operator region and blocks RNA polymerase from initiating transcription. This prevents the expression of the genes in the lac operon.

For more questions on protein

https://brainly.com/question/884935

#SPJ8

Check all characteristics of life:

- Complex, ordered organization consisting of one or more cells (1)
- Use and transforms energy to perform work (2)
- Sensitive and responsive to the external environment (3)
- Regulate internal conditions(4)
- Grow, develop, and reproduce(5)
- Evolutionarily adapt and over time undergo descent but with modification(6)

Answers

The characteristics of life are complexity, ordered organization, energy use and transformation, and regulation of internal conditions. and all of the statements about life forms are correct.

What are the characteristics of the life forms?

There are both eukaryotic and prokaryotic life forms, as well as unicellular and multicellular animals, but all life forms grow, take nutrients, adapt, and evolve; some can regulate their internal temperature, use energy, and transform it, such as in photosynthesis.

Hence, the characteristics of life are complexity, ordered organization, energy use and transformation, and regulation of internal conditions. and all of the statements about life forms are correct.

Learn more about the character of the life forms here.

https://brainly.com/question/30056328

#SPJ1

WILL MARL BRAINLIEST!!!!
The islands bordering the deep-sea trenches
A. result from a series of quiet, continuous basaltic eruptions.
B. are accumulations of sediments on the margins of the trenches.
C.are formed from the activities of coral and other organisms.
D. are explosive volcanoes that emit lavas.

Answers

Answer:

i think its d

Explanation:

In Hereford cattle, one gene determines whether or not a cow will have horns. The allele that produces horns is recessive (h), and the allele
that results in no horns is dominant (H).
If 2 heterozygous cows mate, what are the predicted phenotypes of their offspring?

In Hereford cattle, one gene determines whether or not a cow will have horns. The allele that produces

Answers

Answer:

C 25%horns 75%no horns

Explanation:

using a punnet square for 2 heterozygouse cattle

      H       h

H    HH     Hh

h     Hh     hh

help me what is this stuff please i really need halp

help me what is this stuff please i really need halp

Answers

Answer:

i dont no the answer

Explanation:

hahahahahahahahahahahahahahahahahahahahahahahhahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahhahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahah

Is crick and Watson a type of genetic test

Answers

No, "Crick and Watson" is not a type of genetic test. Crick and Watson refer to James D. Watson and Francis Crick, who were scientists involved in the discovery of the structure of DNA. They proposed the double-helix structure of DNA in 1953, which provided the foundation for understanding genetic information and its role in heredity.

Genetic tests, on the other hand, are laboratory tests that analyze an individual's DNA or genes to provide information about their genetic makeup, potential genetic disorders, or predispositions to certain conditions.

These tests can be used for various purposes, such as diagnosing genetic disorders, predicting the risk of developing certain diseases, determining carrier status for genetic conditions, or providing ancestry and genealogical information.

While Crick and Watson made significant contributions to the field of genetics, they are not directly associated with genetic testing. Genetic tests are based on scientific advancements and technologies developed after their groundbreaking discovery of the DNA structure.

For more such answers on DNA

https://brainly.com/question/16099437

#SPJ8

Which statement would be MOST important to include in a summary of the article?


A
Models are used to represent objects and events in the real world.

B
Maps can be created on paper as well as digitally in people's phones.

C
Scales on maps use measurements in miles or kilometers.

D
Microscopes use lenses that bend light to make objects appear larger.

Answers

Answer:

D.) Microscopes use lenses that bend light to make objects appear larger.

Explanation:

I believe this is correct because it gives more detail in its sentence providing more information on a subject.

Where is the youngest crust on earth most likely located

Where is the youngest crust on earth most likely located

Answers

Answer:

near the seafloor spread in the centers or mid-ocean ridges.

Explanation:

The earths crust is the outermost part of the earth

What is the relationship between the levels of CO2 in the atmosphere and the levels of CO2 in the ocean?

Answers

Answer:

Because of human-driven increased levels of carbon dioxide in the atmosphere, there is more CO2 dissolving into the ocean. The ocean's average pH is now around 8.1 , which is basic (or alkaline), but as the ocean continues to absorb more CO2, the pH decreases and the ocean becomes more acidic.

How is carbon dioxide produced in a cement plant

Answers

Carbon dioxide is produced in a cement plant when limestone is decomposed.

Cement is produced using lime stone as raw material. The limestone is decomposed according to the reaction;

CaCO3(s) -----> CaO(s) + CO2(g)

The CaO is used to produce cement while CO2 is a waste gas that escapes.

Hence, carbon dioxide is  produced in a cement plant limestone is decomposed.

Learn more: https://brainly.com/question/1407217

was early earth a friendly environment to living things

Answers

Answer:

At first, the Earth was not even able to support life. There was no oxygen in the atmosphere, and Earth's surface was extremely hot. Slowly, over millions of years, the Earth changed so that plants and animals could begin to grow.

Explanation:

pls Mark brainlist

The table shows the chromosome numbers for four different organisms..
Organism Chromosome number
Chicken
Gypsy moth
Human
Strawberry
D Chicken
Which organism can produce the highest number of genetically varied
gametes as a result of independent assortment?
OA. Gypsy moth
OB. Strawberry
OC. Human
78
62
46
56

Answers

The number of Nucleotide sequences or chromosomes during various cell cycle stages can be easily counted. Rule of thumb: Count the number of operational centromeres to get the number of chromosomes.

What exactly is an organism?

A living creature with a well-organized structure, the capacity to respond to stimuli, procreate, grow, adapt, and keep homeostasis. Etymology: Organon, which means "instrument" in Greek, is where the word organism gets its name. Synonyms include live thing, living being, and life form.

What are living things, exactly?

A living organism is anything that contains cells as its fundamental unit of organization and has the ability to sustain life. A few examples of living things are people, fungi, vegetation, trees, animals, microbes, protozoa, and insects.

To know more about Organism visit:

https://brainly.com/question/16296324

#SPJ1

Which of the following is a molecule that combines with an enzyme to activate it and help it do its job? a) a transport protein b) collagen c) a coenzyme d) a prion

Answers

The molecule that combines with an enzyme to activate it and help it to do its job is called a coenzyme. So option c. is correct.

Coenzymes are organic compounds required by many enzymes for catalytic activity. They are often vitamins or derivatives of vitamins. Sometimes they can act as catalysts in the absence of enzymes, but not so effectively as in conjunction with an enzyme. As with metal-enzyme linkages, there is a range of bond strengths for coenzymeenzyme links, the point of distinction between tightly-bound cofactor and loosely-bound cofactor being arbitrary.

Learn more about coenzymes here:

https://brainly.com/question/24066145

#SPJ4

Salt is most likely to be mined using which mining technique?

A.) Mountaintop removal

B.) Solution mining

C.) Placer mining

D.) dredging

Answers

Answer:

B.) Solution Mining

Explanation:

Definintion: solution mining is mining of underground, water-soluble minerals, usually using one or more drilled wells to dissolve the minerals with water.

Sorry if it's wrong!

Hey there!

The answer is option (B) Solution mining.

☆Some extra points to know:

Solution mining is also called deep-shaft mining or solar evaporation.

¤ How it is done?

=> Solution mining is done by pumping water into subterranean salt deposits, found in many parts of the world, dissolving the salts and pumping the brine to the surface for drying and further use.

Hope it helps

can someone please help

can someone please help

Answers

Answer:

attached is the correct answer

The respiratory system of an elephant functions in a similar way to which organelle in a single called organism

Answers

I believe it’s the plasma membrane

At what temperature, do these three phases exist in equilibrium A. 45 degreesB. 60 degreesC. 100 degreesD. 110 degrees

At what temperature, do these three phases exist in equilibrium A. 45 degreesB. 60 degreesC. 100 degreesD.
At what temperature, do these three phases exist in equilibrium A. 45 degreesB. 60 degreesC. 100 degreesD.

Answers

Considering the graph in the question we can say that the three phases (A, B, and C) are in equilibrium in 60°C (alternative B), because it is the point in the graph in which we can see the interception between the three phases, being therefore the equilibrium point between them.

please help me i’ll give you brainlist

please help me ill give you brainlist

Answers

Answer:

B) Daughter Cells

Explanation:

When a cell divides, the parent cell divides to form two daughter cells.

Answer:

The answer is daughter cells.

Hope that helps. x

An ecosystem is composed of only one community.


Please select the best answer from the choices provided

T
F

Answers

i think it’s false :)

If the sequence of bases in mRNA is U, C, A, the sequence of bases in DNA is
A, G, and T.
T, G, and U.
A, C, and A.
A, G, and U.

Answers

Answer:

A-G-T

Explanation:

mRNA → Polypeptide

In order to translate an mRNA sequence into a polypeptide chain, it is important to establish the correct reading frame

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon

A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U


The chromosomes replicate and are seen as a pair of sister
chromatids.


A. Anaphase

B. Telophase

C. Cytokinesis

D. Prophase

E. Metaphase

Answers

sister chromatids appear in prophase :)

The chromosomes replicate and are seen as a pair of sister chromatids in metaphase.

What is metaphase?

Metaphase is a stage in the cell cycle that occurs during mitosis, which is the process of cell division that results in the formation of two identical daughter cells. During metaphase, the chromosomes align in the center of the cell and form a structure called the metaphase plate. The chromosomes are still attached to each other by the centromere, and they appear as two identical sister chromatids.

In this stage, the spindle fibers, which are microtubules that extend from opposite poles of the cell, attach to the centromeres of the chromosomes and help to align them in the center of the cell. The chromosomes are positioned so that they can be separated evenly during the next stage of mitosis, anaphase, where the sister chromatids are separated and move to opposite poles of the cell.

Learn more about metaphase, here:

https://brainly.com/question/9360168

#SPJ6

which of the following inhibits glycolysis and glucose uptake by muscle cells, and causes a rise in blood glucose concentration?

Answers

Answer:

You didn't include the answer choices, but "glucagon" would be the answer.

Explanation:

Glucagon is a hormone created by the pancreas that regulates sugar/glucose levels. It prevents blood sugar from lowering to an unhealthy level, which means that it increases the blood sugar level.

It's basically the opposite of insulin, another hormone, which lowers blood sugar levels.

Give an example of a good hypothesis, and explain why a hypothesis is important.

Answers

Explanation:

it ensures the entire research methodologies are scientific and valid

PLS HELP!!!!!!!! 50 POINTS!!!!!!!! ACCURATE ANSWER PLS!!! ILL GIVE BRAINLIEST AND 5 STARS. What is the difference between anaerobic and aerobic systems and give some examples of sports which use either the aerobic or anaerobic system.

Answers

Answer: The difference between anaerobic system and aerobic system is that Aerobic exercises are endurance-type exercises that increase a person's heart rate and breathing rate over relatively long durations. Anaerobic exercises are exercises that involve short bursts of intense activity. Examples of aerobic exercise include brisk walking and riding a bicycle. Examples of anaerobic activities include sprinting, long jump, making a tackle in football, shooting at goal in netball and serving in tennis.

Minerals are prone to destruction by elements such as oxygen, heat, and acid.

True or False

Answers

Answer:

True

Explanation:

Minerals are prone to destruction by different elements such as oxygen, heat, and acids treatment. The given statement is true. On treatment with these elements, minerals loose their properties.

What are minerals?

Minerals are the naturally occurring inorganic elements or compounds which posses an orderly internal structure and characteristics with the specific chemical composition, crystal form, and properties such as physical properties and chemical properties. Minerals differ from the rocks, which are the naturally occurring solids that are composed of one or more types of minerals.

Minerals show properties which can be lost by the treatment with different elements. Minerals have been found to be prone to destruction by the elements such as oxygen, heat, and acids. Minerals undergo chemical and physical change on treatment with these elements and form different products which show different characteristics than the parent minerals.

Learn more about Minerals here:

https://brainly.com/question/13770820

#SPJ2

Why is protein folding important in the search for cures to diseases such as cancer and HIV/AIDS?

Answers

Answer:Protein misfolding is detrimental as it results in a loss of native protein function and can lead to a toxic gain of function due to aggregation

Explanation:

Other Questions
Below you will find the requirements to identify the Account Diversity Grade of a user. Read the requirements carefully and identify what test users you need to setup in order to completely test and make sure all the below requirements are covered. (Note: you should identify the optimum (minimum) number of users needed to test all of the requirements)Requirements:A user can have different types of loan accounts. Now we grade a users Account Diversity based on two factors.1) loanTypeCount2) totalAccountsloanTypeCount = the number of different (distinct) LoanType values for all accounts that the user has.However do not include LoanType = Unknown & Collections but include all othersApplicable values for LoanType are ( Home Loan, Heloc, Credit Card, Car Loan, Collections, Unknown)totalAccounts = total number of loan accounts user has (do not include LoanType = Unknown & Collections but include all others)example-> if user has 3 credit cards and 2 home loans and 1 Collection account, then totalAccounts = 5 and loanTypeCount = 2)The logic to determine accountDiversityGrade is the following:If totalAccounts> 20 or loanTypeCount >= 4, accountDiversityGrade = AElse if totalAccounts> 10 or loanTypeCount = 3, accountDiversityGrade = BElse if totalAccounts>= 5 or loanTypeCount= 2, accountDiversityGrade = CElse if totalAccounts > 0 or loanTypeCount = 1, accountDiversityGrade = DElse accountDiversityGrade=null (n/a) How is science fiction different than realistic and historical fiction? please solve this for me Simple the following equation -10x + 3y + 7x How would you make $17.84. (Use the least amount of bills and coins.) * the domain of y=x^2 is The range of y=x^2 is pls answer fast and make it be the right answer. if u answer it right u get brainliest and 5 stars and a heart As an infant, chloe had typical childhood illnesses and no significant earaches. however, chloe is now age 4 and she is experiencing frequent earaches. what is the most likely reason for this? The sum of three numbers is 23. The first number is 7 less than twice the second number. The third number is one greater than the sum of the first and second numbers. the humerus articulates with what bone marking of the scapula Help me: Solve for x. 7-2x=9 What is the most important point that the authors make in this paragraph most enslaved people worked under fair to good conditions? Score on last try: 0 of 1 pts. See Details for more. You can retry this question below In 1993, the moose population in a park was measured to be 4060. By 1997, the population was measured again to be 4220 . If the population continues to change linearly: Find a formula for the moose population, P, in terms of t, the years since 1990. P(t)= What does your model predict the moose population to be in 2006? Question Help: Video Hello can you help me with this PROMPT : You have just read "The death of a soldier" by Wallace Stevens. How does the nature imagery in this poem develop the meaning ? Make sure your response is strong by :. starting with an argument that clearly answers all part of the prompt. . including two pieces of evidence that support your argument. . using transitions to help readers follow your ideas. . explaining how your evidence supports your argument. One criticism of the Food and Drug Administration is that it takes a long time for a drug to be approved for distribution to the public because of all the testing and standards that need to be met. What is the BEST counterpoint to this argument?A. Less testing would mean less assurance that drugs are safe.B. Testing means that no unsafe drugs are ever released to the public.C. Needless bureaucracy is one of the key factors that slows progress.D. Most of the testing requirements are based on practice of earlier eras. 9)To extract the inner boundaries in image (A)using morphological operator via structure element (B), you can use: A) C = A B then boundary = A - C B) C = A + B then boundary = A - C C) C = A B then boundary = A - C D) C = A + B then boundary = A - Why did Max Gladwell create his blog post?O A. To reflect on the rapid changes in social mediahB. To call for the protection of the environmentC. To urge people to use analog technologyD. To encourage people to take part in revolutionsSUBA Is 9x-3y=12 and 27x+9y=38 parallel or perpendicular I am a solution. If you square my number, the answer will equal 441. What number am I? (hint: there are two of me) Discuss the benefits and drawbacks of the directive, participative, and free-rein styles of leadership.