The following data are for Lily Kay Company. Total sales revenue $250,000 Number of units sold 50,000 units Contribution margin per unit $3.50 Fixed costs $100,000 Calculate the number of units that must be sold to generate net income of $80,000.

Answers

Answer 1

Answer:

the number of units that generated net income is 51,429 units

Explanation:

The computation of the number of units that generated net income is shown below:

Here we have to find the break even point i.e. shown below:

= (Net income + fixed cost) ÷ (contribution margin per unit)

= ($80,000 + $100,000) ÷ ($3.50)

= 51,429 units

hence, the number of units that generated net income is 51,429 units and the same is to be considered


Related Questions

the change from traditional manufacturing to service and high-tech manufacturing requires highly job skills.

Answers

Answer:

Technical

Explanation:

The change from traditional manufacturing to service and high-tech manufacturing requires high job skills. Technical skills.

What are skills?

The term skills refer to the ability to do something as we see there are different jobs are we there and for the different, jobs different skills are required and for the skills, the knowledge about the particular things is needed by them, we can solve the problem. Nowadays, skills play an important role in the job profile.

As we see the manufacturing, different skills are required there are different machines being worked, and the bases of this the jobs are being done as compared to the high technology jobs which are being operated from the system needs to be technical skills are being required in it.

Therefore, high-tech manufacturing required technical skills as well.

Learn more about skills here:

https://brainly.com/question/22072038

#SPJ2

Match each business management role to its corresponding description.

Match each business management role to its corresponding description.

Answers

Answer:

Explanation:

1.) 3

2.) 4

3.) 2

4.) 1

The role of Chief operating officer is to develop policies and structure to protect company data. The appropriate response is statement 3.

Who is a Chief operating officer ?

A Chief Operating Officer (COO) is a corporate leader who is in charge of managing a company's continuing business operations. The COO is often the company's second-in-command and reports to the CEO. Chief Operations Officer, Operations Director, and Director of Operations are other titles for the COO.

The CEO is in charge of managing all resources and overseeing the staff, with the COO serving as his or her deputy. In all business meetings and management decisions, the CEO represents the company. The COO manages revenue, expenses, task distribution, client happiness, and efficiency.

The appropriate responses are

3421

To learn more about Chief operating officer

https://brainly.com/question/14610342

#SPJ2

Define and discuss the existence of the internal rate of return. Then, discuss its employment in finance as an evaluation instrument.

Answers

The internal rate of return (IRR) is a financial metric used to evaluate the profitability of an investment or project. It represents the annualized rate of return at which the net present value (NPV) of the cash flows from the investment becomes zero. In other words, it is the discount rate that makes the present value of the cash inflows equal to the present value of the cash outflows.

Here's a step-by-step explanation of how the IRR is calculated:

1. Identify the expected cash inflows and outflows from the investment or project over its lifespan.
2. Estimate the time period in which each cash flow will occur.
3. Apply a discount rate to each cash flow to calculate its present value. The discount rate is usually the cost of capital or the minimum desired rate of return.
4. Sum up the present values of the cash inflows and outflows.
5. Adjust the discount rate until the sum of the present values is zero. This is the internal rate of return.

Now, let's discuss the employment of IRR in finance as an evaluation instrument. The IRR is widely used in finance because it helps determine the attractiveness of an investment opportunity. By comparing the IRR of different projects or investments, financial analysts can make informed decisions about where to allocate resources.

Here are a few key points about the employment of IRR in finance:

1. Decision Making: The IRR is used to assess whether an investment or project is viable. If the IRR exceeds the cost of capital, the investment is considered profitable. On the other hand, if the IRR is lower than the cost of capital, it suggests that the investment may not generate sufficient returns to justify the associated risks.


2. Ranking Investments: The IRR allows for the comparison of multiple investment opportunities. Higher IRRs indicate more attractive investments, as they offer higher potential returns. By ranking investments based on their IRRs, financial managers can prioritize projects and allocate resources accordingly.


3. Sensitivity Analysis: The IRR is also used to conduct sensitivity analysis, which assesses the impact of changes in key variables on the investment's profitability. By adjusting the cash inflows, outflows, or discount rate, analysts can determine how sensitive the IRR is to various factors, helping them understand the risk profile of the investment.

In summary, the internal rate of return (IRR) is a valuable tool in finance for evaluating investment opportunities. It helps decision-makers assess the profitability of projects, rank investments, and conduct sensitivity analysis. By understanding the IRR, finance professionals can make informed choices and optimize the allocation of resources.

To know more about internal rate of return visit:

https://brainly.com/question/31870995

#SPJ11

Where is the row selector located in Datasheet view?

above the top row of data
below the last row of data
to the left of the leftmost data
to the right of the rightmost data

Answers

Answer:

to the left of the leftmost data

Explanation:

A database management system (DBMS) can be defined as a collection of software applications that typically enables computer users to create, store, modify, retrieve and manage data or informations in a database. Generally, it allows computer users to efficiently retrieve and manage their data with an appropriate level of security.

A Datasheet view is simply the rows and columns of data in a table that are being displayed in database software application such as Microsoft Access and Excel.

In DBMS, rows are numbered numerically as 1, 2, 3, 4, 5, etc. from top to bottom while columns are labeled alphabetically as A, B, C, D, E, etc. from left to right. Thus, a row is the horizontal arrangement of cell while column is the vertical arrangement of cell in a spreadsheet (table of cells).

Generally, the row selector is located to the left of the leftmost data in Datasheet view.

Answer:

c

Explanation:

Please hurry!!!
how can a small company benefit from writing a marketing plan?

Answers

Answer:

One Page Marketing

Explanation:

One Page Marketing Plan can help simplify and maximize your marketing efforts as well as help you create an actionable to reach your business goals.

Where scaffolds are utilized they shall
be provided with _ for the entire
length, and shall have
to
prevent slipping.

Answers

Answer:

im not aure

Explanation:

im not aure

What measures the change in prices of a basket of goods and services in a given year
Choices
A. Recession
B. Depression
C. Deflation
D. Inflation

Answers

Hmm I think it’s D. Inflation

Answer:

d. inflation

Explanation:

PLATO

write a short response paragraph explaining how a credit score could contribute to keeping someone caught in a cycle of poverty

Answers

Answer:

A credit score is a numerical representation of a person's creditworthiness, which lenders use to determine their ability to repay loans. Unfortunately, people with low credit scores may find it difficult to access credit, which can make it challenging to obtain loans to start a business, purchase a home, or cover emergency expenses. This lack of access to credit can make it challenging for people caught in the cycle of poverty to break free, as they may not have the resources to address urgent financial needs or invest in income-generating opportunities. Additionally, without access to credit, they may turn to predatory lenders or high-interest credit cards, further perpetuating the cycle of poverty. Therefore, a low credit score can contribute to keeping someone caught in a cycle of poverty by limiting their financial options and making it difficult to improve their economic situation.

Explanation:

hich pricing strategy involves setting a high price for an exclusive, high-end product?

Answers

Yes, this encourages the buyer to pay more for an item especially if it is by a well known branded. This gives them to opportunity to brag and boast with their purchase. Also when the product is well known consumers are going to try their absolute best to buy it, this is going to make the product scare, hence increasing its price.

o estimate missed places, inc.'s (mp) external financing needs, the cfo needs to figure out how much equity her firm will have at the end of next year. at the end of the most recent fiscal year, mp's retained earnings were $158,000. the controller has estimated that over the next year, gross profits will be $360,700, earnings after tax will total $23,400, and mp will pay $12,400 in dividends. what are the estimated retained earnings at the end of next year?

Answers

The estimated retained earnings at the end of next year are $169,000

158,000 + 23,400 - 12,400 = $169,000

$169,000.

The retained earnings are calculated by including net earnings to (or subtracting internet losses from) the preceding time period's retained profits and then subtracting any internet dividend(s) paid to the shareholders. The parent is calculated at the giving up of every accounting length (month-to-month/quarterly/yearly).

Retained profits are a part of an employer's income this is held or retained from net earnings at the cease of a reporting duration and stored for future use as shareholder's equity. Three Retained profits also are an important thing element of shareholder fairness that facilitates an enterprise determine its e-book value.

Retained earnings are the earnings that continue to be on your business in spite of everything fees were paid and all distributions have been paid out to shareholders. Retained income is not the same as coins or your business financial institution account balance.

Learn more about retained earnings  here https://brainly.com/question/25998979

#SPJ4

Identify and discuss five areas of modern business and the role ICT play in achieving business success

Answers

Answer:

The five areas of modern business and the role ICT play in achieving business success is discussed below in complete details.

Explanation:

ICT incorporates all digital technology that supports people, businesses, and establishments in managing messages and information. ICT helps by making a business more productive, efficient, and quickly react to customers' requirements. ICT can serve business ventures including layouts, production, Research and development, shipping and commerce, and feedback.

Suppose the demand for a product is perfectly elastic. At a price of $20, 10 units of a product are sold. If the price is increased to $40, then one would expect sales __________. a) to remain at 10 b) to fall below 5 c) to equal 5 d) to fall to zero

Answers

Answer:

B

Explanation:

$20, 10 units are sold.

$40, no one wants to buy it as much but, won't go down completely so it would be B.

Hope this helps!

It is common practice among currency traders worldwide to both price and trade currencies against the U.S. dollar. Consider a currency dealer who makes a market in 5 currencies against the dollar. If he were to supply quotes for each currency in terms of all of the others, how many quotes would he have to provide?

A) 36.

B) 30.

C) 60.

D) 120.

E) none of the options.

Answers

30 bc i did this question alread

Many of you live in cities, and for those of you who do not, you likely visit cities for various reasons. What are some of the fundamental reasons that you live in or visit a city? Would you define these reasons primarily as economic, social, cultural, etc.?

Answers

Social, economic, and cultural reasons are the three fundamental reasons why people live in or visit cities. Cities offer a wide range of social activities, job opportunities, and cultural experiences.

Many people live in cities, and some of the fundamental reasons for living in or visiting a city include social, economic, and cultural reasons. Let's take a closer look at each of these reasons.
Social reasons for living in or visiting a city
People often move to cities for social reasons. Cities are often known for their diverse populations and wide range of social activities. Many people move to cities to meet new people, find new friends, and experience different cultures. Cities offer a great opportunity to meet people from different backgrounds, ethnicities, and religions.
Economic reasons for living in or visiting a city
Economic reasons are another significant reason why people live in or visit cities. Cities offer more job opportunities, higher salaries, and better education. People often move to cities to pursue a career and improve their economic prospects. Moreover, cities are often the centers of industry, commerce, and trade, which makes them more economically prosperous than rural areas.
Cultural reasons for living in or visiting a city
Cultural reasons are another fundamental reason why people live in or visit cities. Cities are often known for their vibrant cultural scenes. They offer a wide range of cultural activities, such as art galleries, museums, theaters, and music venues. People often move to cities to immerse themselves in different cultures, learn about history, and explore the arts.
They are often the centers of industry, commerce, and trade, making them economically prosperous than rural areas. Cities are melting pots of different cultures, making them an ideal destination for cultural exploration and learning.

for such more questions on job

https://brainly.com/question/28187988

#SPJ8  

Why do corporations, companies, and government agencies use formal application forms?Select the best answer from the choices provided.A.they only hire part-time or entry-level employeesB.they do not have time to interview everyone they employC.it is the first step in the employment processD.due to the amount of employment requests they need a uniform document to organize records and identify candidates' skills

Answers

Answer:

D

Explanation:

they can not hire everyone


Office Supplies are not audited until the end due to the low
risk in having a material misstatement on the financial statements.
What type of procedure would be used for this account?






Auditor's

Answers

Substantive analytical procedures would be used for auditing the Office Supplies account, as it is considered low-risk. These procedures involve analyzing trends, ratios, and relationships to assess the reasonableness of the recorded amount, without extensive testing.  

For the audit of Office Supplies, a substantive analytical procedure would be used. This involves analyzing the account balance and related transactions to assess the reasonableness and accuracy of the recorded amount. Since Office Supplies are considered a low-risk account with a low likelihood of material misstatement, substantive analytical procedures provide sufficient assurance without the need for extensive testing.

In this procedure, the auditor would review the trends, ratios, and relationships related to Office Supplies. They would compare the current year's balance to prior years, industry benchmarks, or other relevant data to identify any significant fluctuations or anomalies. They may also consider the company's purchasing patterns, usage rates, and internal controls over Office Supplies.

By performing substantive analytical procedures, the auditor can gain reasonable assurance regarding the accuracy and completeness of the Office Supplies account without incurring excessive time and cost. This approach is suitable for low-risk accounts where the likelihood of material misstatement is minimal.

References:

1. Arens, A., Elder, R., Beasley, M., & Splettstoesser-Hogeterp, I. (2019). Auditing and Assurance Services: An Integrated Approach. Pearson.

2. Louwers, T. J., Ramsay, R. J., Sinason, D. H., Strawser, J. R., & Thibodeau, J. C. (2015). Auditing & Assurance Services. McGraw-Hill Education.

Learn more about analytical procedure

https://brainly.com/question/31311799

#SPJ11

The NASAA Statement of Policy on Dishonest or Unethical Business Practices of Broker-Dealers and Agents includes prohibitions against certain practices designed to manipulate market prices of securities. An activity that would fall within the spectrum of the prohibitions would be A) front running B) wash trades C) guaranteeing customers against loss D) churning customer accounts

Answers

Answer:

B) wash trades

Explanation:

In the case when the wash trades are performed so it consists the simultaneous or near-simultaneous i.e. selling and the repurchase of the similar security for the motive of producing the trading activity due to which price rise. This is the form of how the market manipulates. The other options i.e. given in the question is not considered the market manipulation

Therefore the option B is correct

EXPLAIN 5 IMPORTANCE OF DIVISON OF IABOUR IN PRODUCTION

Answers

The division of labor is a production strategy where different tasks are assigned to different individuals or groups. It is an essential concept in modern-day manufacturing and production processes. Here are five reasons why it is important:

1. Efficiency: Division of labor makes production more efficient by allowing workers to specialize in specific tasks. This leads to increased productivity as workers become more skilled and experienced.

2. Cost Reduction: By assigning tasks to workers with specific skills, companies can reduce costs associated with hiring and training new workers.

3. Quality Improvement: The division of labor ensures that each worker is responsible for a specific task, making it easier to identify defects and improve quality control.

4. Time Saving: By dividing tasks into smaller, more manageable pieces, production time can be reduced. This means that products can be produced more quickly and efficiently.

5. Innovation: The division of labor creates an environment where workers are encouraged to innovate and find new ways of doing things. This can lead to the development of new technologies and production methods, which can ultimately improve overall productivity and competitiveness.

you know more about production strategy pls visit-

https://brainly.com/question/28788924

#SPJ11

You see Paul dealing with Susan, an upset employee from another department. Susan is complaining about something that your department was supposed to do but didn't. You are in a back room and have not been seen by Susan. Paul is obviously frustrated and unable to deal with Susan effectively. You should:

a. Walk up to the pair and attempt to change the conversation.
b. Introduce yourself to Susan and offer your assistance.
c. Ask your supervisor to offer some interpersonal skills training to Paul.
d. Tell Paul that Susan is needed by the supervisor to end the situation.

Answers

I think option (b) is the correct

Which is true of community cloud computing?

a.
The costs are spread over fewer users than with a public cloud.

b.
It offers higher security as compared to private clouds.

c.
The infrastructure can be owned by just one organization.

d.
It exposes mission-critical applications and data to the outside world.

Another commonly used name for collaborative computing is _____ computing.

a.
group

b.
analysis

c.
GIS

d.
DSS

Answers

The truth that can be said about community cloud computing is : The costs are spread over fewer users than with a public cloud. Option A.

Another commonly used name for collaborative computing is group computing. Option A.

What is community cloud computing?

A community cloud computing initiative is characterized as a cooperative undertaking in which infrastructure is not owned by a single entity but rather shared by a number of organizations with related issues. Compared to a public cloud, fewer users are responsible for the costs. It does not, however, give the same level of tight security as a private cloud offers. Consequently, the appropriate choice is (a). The other suggestions regarding a community cloud are all false.

Groupware computing and group computing are other names for collaborative computing. It enables a group of people to exchange information. It makes it possible for team-based enterprises to expand. Consequently, the appropriate choice is (a). None of the other choices are considered collaborative computing, hence they are all incorrect.

Read more on community cloud computing here: https://brainly.com/question/19057393

#SPJ1

Select the correct answer.
Some merchandisers design window displays.
A. True
B. False

Answers

this answer is true, because merchandisers design window displays, t shirts, and all kinds of stuff

Answer:

your answer would be (A)  True

Explanation:

make a budget of 2000 dollars for a grade six pupil​

Answers

Answer:

Spend half save half

Explanation:

At Ancestry, even in a job as seemingly specialized as that of genealogist, the component parts of the job are quite varied. If Ancestry asked you to advise the company on restructuring job design, how would you explain a recommendation for further specialization?
The workers in highly specialized jobs tend to report higher levels of job satisfaction.
When workers perform small, simple tasks, they become very proficient at each task.
Specialization increases the transfer time between tasks.
Highly specialized workers may feel their jobs are too stimulating.

Answers

A recommendation for further specialization within the job of a genealogist would involve breaking down the job into smaller and more specific tasks. By doing this, the genealogist would be able to focus and become more proficient in certain specialized areas.

What does a genealogist do?

A genealogist is a person who studies and traces family histories and lineages. They use a variety of sources such as birth, marriage, death and census records to build family trees and track down historical information about ancestors.

This would allow for a higher transfer time between tasks, resulting in increased job satisfaction. For example, a genealogist may specialize in researching a particular geographic area or time period.

In addition to increasing job satisfaction and providing the opportunity to specialize, further specialization also has the potential to increase the efficiency and quality of the genealogists’ work. By breaking down the job into smaller tasks and becoming more proficient in certain areas, the genealogist is better able to focus on the quality of their work and deliver results more quickly.

By breaking down the job into smaller tasks, the genealogist is able to focus, become more proficient, and specialize in certain areas. This leads to increased job satisfaction and improved work quality.

For more questions related to ancestors

https://brainly.com/question/1234951

#SPJ1

FIRST ANSWER WILL BE NAMED BRAINLIEST
Which action would effectively and appropriately address a budget deficit?
A. reduce income
B. reduce expenses
C. apply for bankruptcy
D. apply for new credit

Answers

Answer:

It is letter B

Explanation:

Reducing expenses would effectively and appropriately address a budget deficit. Thus option B is correct.

What is the budget?

A budget is a financial plan that projects future earnings and costs. A budget, put simply, forecasts future finances in addition to anticipated revenues and expenditures. Calculating the company's earnings and costs for a set period of time is the procedure for creating a budget.

Increasing tax rates while decreasing government expenditures are the two apparent ways to minimize a budget deficit. the reduction of government spending and/or the raising of taxes, which results in either a rise in the primary surplus or a decrease in the budget deficit. greater taxes and less funding by the government. If public spending is lower than tax receipts, a budget surplus results.

Therefore, option B is the correct option.

Learn more about budget, Here:

https://brainly.com/question/15683430

#SPJ2

Can you guys help me with this ethical case? I know how to do these generally but this one specifically confuses me. I need to know the following: The ethical issue, who the primary and secondary stakeholders are, the different courses of action and their impacts as well as what the best solution would be. Thanks :)​

Can you guys help me with this ethical case? I know how to do these generally but this one specifically

Answers

A combination of personal, moral, legal, and social norms of what is proper determine the ethics, which are a set of principles for thinking and acting.

Ethical Issues: What Do They Mean?

When a particular action, course of action, or judgment runs afoul of a society's moral standards, an ethical problem arises. Since any of their actions could be questioned in terms of their ethicality, both individuals and corporations can be implicated in these disputes.

The three different categories of ethical problems are what?

Utilitarian, Deontological, and Virtue concerns are the three primary subcategories of ethical problems. While deontological ethics emphasize the act itself, utilitarian ethics place more emphasis on the results of a choice. The character of the person acting is a key component of virtue ethics.

To know more about  moral visit:

https://brainly.com/question/13324831

#SPJ1

Gaby is motivated to work hard in a capitalistic society, because: ________

Answers

Gaby is motivated to work hard in a capitalistic society, because  she wants to do well for herself.

What is the name of a capitalist society?

Since the end of feudalism, capitalism, also known as the market economy or the free enterprise economy, has dominated in the Western countries. Under capitalism, the majority of the mode of production are privately owned, and production is controlled and income is distributed primarily through the the functioning of markets.

The benefits of capitalism

Contrary to socialism, marxism, or authoritarianism, capitalism encourages individual initiative and a solid work ethic. By working hard or come up with an original concept, everyone can elevate their position in life. In many nations around the world today, that is still not the case and has hardly shown to be the case through human history.

To know more about capitalistic society visit:

https://brainly.com/question/13840645

#SPJ4

With very few exceptions, most entrepreneurs do not scale—meaning they have a difficult time moving from the entrepreneur role to the executive role. True or False?

Answers

The given statement that most entrepreneurs have a difficult time moving from the entrepreneur role to the executive role is false.

Scaling a business involves taking it from a small, startup stage to a larger and more established enterprise.

It requires implementing strategies and processes that enable growth, such as hiring and managing employees, establishing effective operations, developing a strong organizational structure, and implementing scalable business models.

While entrepreneurs often excel at the early stages of a venture, some may face difficulties when it comes to managing larger teams and implementing more complex systems.

However, it is important to note that entrepreneurship and executive roles require different skill sets, and not all entrepreneurs may have the desire or aptitude for executive-level responsibilities.

Some entrepreneurs may prefer to focus on the creative aspects of their business, innovation, or generating new ideas, rather than assuming a more administrative or managerial role.

In such cases, they may choose to bring in executives or managers who specialize in scaling and leading organizations.

For such more question on entrepreneur:

https://brainly.com/question/353543

#SPJ8

how can software assist in project stakeholder management? do you think social media tools are more likely to help or hinder projects?

Answers

For successful stakeholder involvement, you need a tool that was developed with your unique needs in mind. The cost savings brought on by a boost in project task efficiency is one of the main benefits of deploying stakeholder management software.

Do you think social media tools are more likely to help or hinder projects?

Social media helps you share crucial information like deadlines, important files, and progress reports while also connecting everyone on a team and facilitating communication between them.

We frequently see these real-world events through the eyes of individual stories and experiences posted on social media, as opposed to the reporting of major news organizations.

Therefore, We feel the need to react in some way as a result of the greater emotional and empathic reaction this causes.

Learn more about stakeholder management from the given link.

https://brainly.com/question/28462062

#SPJ4

comparing actual results to a budget based on the actual activity for the period is possible with the use of a:

Answers

Comparing actual results to a budget based on the actual activity for the period is possible with the use of a variance analysis.

A variance analysis is a tool that helps identify the differences between actual results and the budgeted amounts, which are often based on a set of assumptions about the level of activity that will occur during a specific period.

This tool helps organizations determine how closely they have been able to meet their financial goals and objectives, and whether they need to adjust their spending or revenue projections in order to achieve better outcomes in the future.

To conduct a variance analysis, an organization typically compares the actual results of its operations to the budgeted amounts for each expense and revenue category. This comparison helps identify areas where the organization has overspent or underspent its budget, as well as areas where it has generated more or less revenue than expected.

The analysis can be conducted on a monthly, quarterly, or annual basis, depending on the organization's needs and the level of detail required. By comparing actual results to a budget, organizations can better understand their financial performance and make more informed decisions about how to allocate their resources in the future.

To know more about  comparing refer home

https://brainly.com/question/14908224#

#SPJ11

In marketing his new product, Presley decides to price it as low as he can possibly afford to price it in the hopes of discouraging or undercutting any competitors and in the hopes of capturing a large share of the market in such products. He figures that, once he has captured a large share of the market, his customers will remain loyal and continue to buy from him if he (a) continues to make a quality product and (b) slowly raises his prices a little at a time. This strategy is a long-term strategy. He is betting that, while he probably won't make huge profits at the beginning, he'll make more money in the long run. What type of pricing strategy is he engaging in?

Answers

Presley's pricing strategy is known as a penetration pricing strategy. He is focusing on capturing a large share of the market by offering a lower price, which will discourage or undercut any competitors and attract a large number of customers to his new product.

What is a penetration pricing strategy? A pricing strategy in which a product is sold at a low price to capture a large market share is known as a penetration pricing strategy. This strategy is employed when the product is new to the market or when the company is attempting to capture a significant portion of the market quickly. The goal of a penetration pricing strategy is to stimulate demand and develop customer loyalty, which will eventually lead to higher sales.

The idea behind a penetration pricing strategy is that the low price will be enough to convince customers to switch from a competitor's product to the new one.

Read more about employed here;https://brainly.com/question/27404382

#SPJ11

Other Questions
A bike was on sale for $3600 Sam makes an offer equal to 3/4 of the price how much does Sam offer In the diagram, if lm, which statement is NOT correct? PLEASEEE HELP PLLLZZZZ There are 3 green apples and 8 red apples in a basket what is the ratio of the red apples and the green to all the apples in the basket a. ratio for red b. ratio for green The length of a screw is 0. 75 centimeter. How many screwscan be placed end to end to make a row that is18 centimeters long The contestant at a game show had alreadywon a total of $2750 when the game show wascontinued today. He earns an additional $250for each question he answers correctly today. DNA sequence: 5 CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 33 restriction enzymes: (| = cleavage site)Hindlil5-A|AGCTT-33-TTCGA|A-5BamHI5-G|GATCC-33-CCTAG|G-5Pstl5-CTGCA|G-3G33-G|ACGTC-5Q: If the DNA sequence is mixed with all 3 restriction enzymes, what is the digestion product sequence for both DNA strands?Show transcribed data5' CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 3' Hindlil 5-A|AGCTT-3' 3'-TTCGA|A-5 BamHI 5-G|GATCC-3' 3-CCTAG|G-5 Pstl 5'-CTGCA|G-3 G3 3-G|ACGTC-5 The price of an iPod is reduced in a sale from 200 to 145.Find the % loss in price.i need help right now anyone please? Which of these is a ratio table? How many grams of carbohydrate can your body make from 1 gram of Fatty Acids? Find the distance between the two points in simplest radicalform.(3,0) and (-3, -8) Helppppp plssssss its urgent patient medical records doctorname diagnosisid function Which red line shows the same action spectrum corrected for the unequal number of photons emitted across the visible spectrum?. Fill in the blanks to express the quantities given in ratio language. Ratios must be expressed in simplest form. Deondra 36 Bo 42 Myesha 30. For every___miles Bo drove, Myesha drove___miles. Chinese and Japanese languages are SIMILAR in what way? A They both use katakana. B They both use hiragana. C They both use characters. D They both use the alphabet. Broke Benjamin Co. has a bond outstanding that makes semiannual payments with a coupon rate of 5.8 percent. The bond sells for $974.17 and matures in 14 years. The par value is $1,000. What is the YTM of the bond? A. 3.04% B. 5.77% C. 6.08% D. 5.47% D. 4.56% Mr Harrison is 9 months old. How old is Mr Harrison daughter in days How can the president use the mass media as a tool for the expansion of executive power ?. Would a drug that acts by disrupting the nuclear envelope (the double membrane surrounding the nucleus) be effective for treating bacterial infections