The experimental technique that involves removing part of the brain is known asA. dissociation.B. brain ablation.C. EEG.D. fMRI.

Answers

Answer 1

The experimental technique that involves removing part of the brain is known as Brain ablation.Brain ablation.

An experimental technique that involves removing part of the brain, is used to study the impact of specific brain regions on cognitive function and behavior. This technique involves physically removing brain tissue from the organ, either by surgically excising it or using a chemical agent to ablate it.

Content-loaded refers to the amount of data that is stored on a particular medium. EEG (electroencephalography) and fMRI (functional magnetic resonance imaging) are techniques that are used to monitor brain activity and are often used to map brain function and identify areas of neural activity during cognitive tasks. Dissociation is a psychological phenomenon in which a person feels disconnected from their sense of self or reality.

to know more about brain visit :

https://brainly.com/question/29407892

#SPJ11


Related Questions

the s shape of the human vertebral column is formed by two curves. where are these two curves located?

Answers

The S-shape of the human vertebral column is formed by two curves known as the primary curves and the secondary curves.

What are the primary and secondary curves of the vertebral column?

The primary and secondary curves create the characteristic S-shape of the human vertebral column, providing balance, stability, and flexibility to the spine.

Primary Curves: The primary curves are present at birth and are retained throughout life. These curves are located in the thoracic and sacral regions of the vertebral column.

Secondary Curves: The secondary curves develop as a child grows and begins to sit upright and walk. These curves are located in the cervical and lumbar regions.

Learn more about the vertebral column at: https://brainly.com/question/18094930

#SPJ4

if cytosine makes up 40% of the nucleotides in a sample of dna from an organism. what percentage of the nucleotides in this sample will by thymine?

Answers

In a sample of DNA, thymine will make up 10% of the total.

DNA structure:

According to Chargaff, nucleotide subunits make up the DNA. The double-stranded DNA molecule is created by these nucleotides forming hydrogen bonds with one another.

The following nucleotides can be found in the DNA molecule:

AdenineGuanineThymineCytosine

While Guanine (G) couples with Cytosine (C), Adenine (A) pairs with Thymine (T).

According to Chargaff's rule, the ratio of adenine to thymine in a DNA molecule is equal. The same holds true for cytosine and guanine. The entire number of nucleotides, however, is 1, or 100%.

A + T + G + C = 100%.

if cytosine makes up 40% of the DNA sample, this means that guanine will also be 40%.

G (40) + C (40) = 80%

100% - 80% =20%

This means that Adenine and Thymine amounts to 20%. The amount of each nucleotide will be 20% ÷ 2 = 10% i.e. A = T = 10%

Therefore, the percentage of thymine in a sample of the DNA will be 10%.

To learn more about thymine click here,

https://brainly.com/question/907132

#SPJ4

Which trait is considered dominant?
HURRYYYY PLEASEEEEEE FASTTTT

which trait is considered dominant?

The trait that is hidden or covered up by the recessive trait.

The trait that is the most specific.

The trait that masks or covers up another trait and appears
any time its allele is present at least once in the gene pair.

The largest trait someone can have.

Which trait is considered dominant?HURRYYYY PLEASEEEEEE FASTTTT which trait is considered dominant?The

Answers

Answer:

D. The largest trait someone can have

Explanation:

This option makes the most sense to me because the dominant trait is the largest trait you can have, that is used the most often in your genetic code.

I hope it helps and is correct!

I thinks it’s C but I’m not sure. It could also be B. I’m pretty sure it’s not A or D. Sorry

Which two statements are true for fungi?
A.) They can produce their own food because they have chlorophyll.
B.) They often form symbiotic relationships with trees.
C.) They digest food externally.
D.) They can absorb nutrients from food, even though they lack digestive enzymes.

Edmentum (Plato)

Answers

Answer:

B They often for symbiotic relationships with trees
C They digest food externally

Explanation:

What pet ownership trend began in the 17th century? Why was this trend so popular and has it continued today?

Answers

Answer:

Pet keeping wasn't generally accepted in Europe until the end of the 17th century, and it wasn't common among the middle classes until the late 18th century. Pet keeping in its present form is probably a 19th century Victorian invention. At this time, it was perceived as a link with the natural world, which itself was no longer seen as threatening. It also allowed a visible demonstration of man's domination over nature.

In present-day societies, dogs have a number of functional roles, from ornamental to status symbol, as helpers, and as companions. Dogs can also act as a channel for personal expression because people express their personality in the breed they own. For example, rare breeds are often used as indicators of status. Guide dogs for blind people and hearing dogs for deaf people are examples of pets who are kept as helpers.

But the most common reason for owning pets in Western societies is companionship. In recent years, there's been a growing awareness of the very positive effects this relationship can have on human health and psychological well-being, and a recognition of the therapeutic value of companion animals.

Answer:

Pet keeping wasn't generally accepted in Europe until the end of the 17th century, and it wasn't common among the middle classes until the late 18th century. Pet keeping in its present form is probably a 19th century Victorian invention.

Explanation:

hope this helps if not let me know have a good day

An __________________________ is caused by rock breaking under the surface of Earth and releasing energy that causes Earth to shake.

Answers

Earthquake

Hope this helps :D

About 3 million years ago, the Isthmus of Panama (a narrow strip of land connecting North and South America) formed, dividing marine organisms into Pacific and Caribbean populations. Researchers have examined species of snapping shrimp on both sides of the isthmus. Based on the morphological species concept, there appeared to be seven pairs of species, with one species of each pair in the Pacific and the other in the Caribbean. The different species pairs live at somewhat different depths in the ocean. Using mitochondrial DNA sequences, the researchers estimated phylogenies and found that each of these species pairs, separated by the isthmus were indeed each other's closest relatives. The researchers investigated mating in the lab and found that many species pairs were not very interested in courting with each other, and any that did mate almost never produced fertile offspring. Which process led to the formation of the species pairs of Pacific and Caribbean snapping shrimp

Answers

Answer:

Allopatric speciation

Explanation:

Allopatric speciation refers to the geographic separation of a continuous genetic background, originating two or more new geographically isolated groups. These divergences of the original population might be related to migration in different directions, extinction of geographically intermediate populations, or geological events. During these events of speciation, emerging new barriers impede genetic flow between groups, as the two new populations that are separated can not get together and mate anymore. These barriers might be geographical or ecological.  

Different stages are involved in the allopatric speciation process:

• The emergence of the barrier.  

• Interruption in the genetic flow

• Slow and gradual differentiation due to the occurrence of mutations in each population and their accumulation in time.  

• Genetic divergence by natural selection and reproductive isolation,  impeding the two groups to mate even if the barrier disappears.  

• Prezigotic isolation mechanisms favored by selection a secondary contact between the new species occurs.

The Panama isthmus is an example of allopatric speciation caused by an extrinsic geological barrier that interrupted the genetic flow between species driving to genetic changes and reproductive isolation.  

Two different groups that evolved in allopatry might meet again in secondary contact if the barrier that separated them, disappears. In the Panama isthmus example, the groups that did mate, could not produce any fertile progeny because of postzygotic reproductive isolation. And the groups that did not mate, were not attracted to each other because of prezygotic reproductive isolation.  

There are two continents with an ocean between them. Today the continents have very different plants and animals on them. However, a geologist found fossils of the same type of organism on both continents. Millions of years ago when this type of organism was alive, we know it lived in only one place. The geologist is using fossils as evidence to argue that the two contients used to be touching. How could the continents have gotten so far apart, and how long did it take for this to happen?

Answers

Answer:

A. Through geologic forces leading to continental drift.

B. It can take up to millions of years.

Explanation:

A. Continents rest on tectonic plates (a large slabs of rock). The plates are usually moving and interacting with one another. Seafloor spreading zones and giant rift valleys are the sites where tectonic activity are done.

However, in the process of seafloor spreading, molten rock emerges from within the Earth and produces an oceanic crust (a new seafloor) to the edges of the old one. Seafloor spreading occurs along giant underwater mountain ranges (also referred to as mid-ocean ridges).

Then, as the seafloor grows wider, the continents on opposite sides of the ridge move away from each other over time to experience a define continental drift.

B. The seafloor spreading rates is as low as 2.5 centimeters per year and take up to millions of years to see a well defined drift.

how are coecervates similar to living organisms​

Answers

Answer: Coacervates are similar to living organisms as they are capable of absorbing nutrition and also can grow under proper living conditions.

Explanation: Coacervates are regarded as the foundation of early life in Oparine Haldane theory's (abiogenesis) view. In order to manufacture organic compounds from an ocean of food, scientists think that they developed chemically.

They consist of a grouping of colloidal droplets held together by hydrophobic force.

Both live cells and non-living cells share certain commonalities with them. In a suitable physical and chemical environment, they can develop and absorb nutrients. Although they are incapable of reproduction, coacervates can maintain homeostasis just like living cells. A live organism's ability to reproduce is one of its most crucial characteristics. Therefore, we are unable to classify them as living entities.

To know more about Coacervates:

https://brainly.in/question/24557656

https://brainly.com/question/29217605

What change began the Neolithic age , about 8000 B.c.E

Answers

Answer:

Hunting and Gathering to Farming

Explanation:

what is the number of chromosomes in a gemete compared to a zygote and why ?

Answers

"Gametes" have 23 chromosomes, "Zygote" is the result of two gametes (haploid) cells fusing, and becoming a diploid cell. So a diploid cell has Double the cells it had before leaving it with 46 chromosomes.

Hope that helps!

What steps did the government take to contain the spread of cocoliztli?

Answers

The government originally used emergency pandemic response money for urgent medical requirements, the special wards to increase hospitalization and care capacity, and of vital medical supplies.

Briefing:

In 1576, there was an outbreak that followed a drought that stretched from Venezuela to Canada. The association between the drought and outbreak, according to proponents of the viral theory of Cocoliztli, may be explained by a rise in the population of vesper mice, which are carriers of viral haemorrhagic fever, during the rains that followed the drought.

What was the cause of the Cocoliztli epidemic?

The cocoliztli epidemics in 1545 and 1576 seem to have been hemorrhagic fevers exacerbated by peculiar climatic conditions and brought on by a local viral pathogen. The 20th century saw the Mexican population reach pre-Hispanic levels.

To know more about Cocoliztli visit:

https://brainly.com/question/29059755

#SPJ1

The most common use of radioactive isotopes in medicine is to diagnose disease. Typically, radioactive materials are injected into the body and then radiation-detecting cameras are used to build images of affected body parts or particular types of cells. This equation models the amount of a radioactive isotope in the bloodstream minutes after it is injected:

Answers

Radioactive substances are employed in therapy to destroy malignant tissue, shrink a tumor, or lessen discomfort.

What is the radioactive elements?

Two or more chemical species of an element with varying atomic masses and unstable nuclei are referred to as radioactive isotopes. Because of the excess radiation that these isotopes produce in the form of alpha, beta, and gamma rays.

Nuclear medicine treatments use a tiny amount of radioactive substance called a radiopharmaceutical to assist diagnose and cure disorders. To identify disorders, some radiopharmaceuticals are utilized in conjunction with imaging technology. To reduce or eliminate a cancerous tumor, radiopharmaceuticals can also be injected close to the tumor inside the body.

Learn more about radioactive elements here:

https://brainly.com/question/23759636

#SPJ1

The ____ are parasitic and infect with special cells called sporozoites.
a) ciliates
b) dinoflagellates
c) apicomplexans
d) Giardia

Answers

Together along with ciliates and dinoflagellates, Apicomplexa is a sizable phylum of parasitic protists that belongs to the Alveolata group cells.

Foraminifera are highly productive creatures that rule the deep water. These amoeboid protists have a life cycle that is frequently complicated but normally alternates between sexual and asexual generations, as well as a netlike (granuloreticulate) network of pseudopodia.  It is the only ciliate phylum member that is known to be harmful to humans.Together along with ciliates and dinoflagellates, Apicomplexa is a sizable phylum of parasitic protists that belongs to the Alveolata group cells. Ciliates typically come in free-living forms. Just one organisms, Balantidium coli, is found to be infected humans and is one of the relatively few parasitic species.

Learn more about cells

https://brainly.com/question/13524386

#SPJ4

how did adaptive radiation affect plants after they first moved to land

Answers

Explanation:

it gradually stops seed growth and sprouting depending on how much radiation is released.If there is too much evaporation due to intense radiation,the stomata closes to reserve water and if the stomata is unable to open for a long period of time the growth of the plant is stunted.

all of the following are functions of muscles except a. control of openings. b. heat production. c. respiration. d. secretion. e. stability.

Answers

The function of muscles except option D. Secretion.

The muscular machine is composed of specialised cells known as muscle fibers. Their principal characteristic is contractibility. Muscle mass, attached to bones or inner organs and blood vessels, are chargeable for motion. Nearly all movement within the body is the end result of muscle contraction.

Those muscle tissues assist you flow, carry things, pump blood through your frame, and even help you breathe. While you reflect onconsideration on your muscle tissue, you probably suppose most about those you can manipulate. These are your voluntary (VOL-uhn-ter-ee) muscular tissues, which means you may control their movements.

Muscle tissue flow body components by using contracting and then enjoyable. Muscle tissues can pull bones, however they cannot push them back to the authentic role.

Learn more about Muscle here:-https://brainly.com/question/25778330

#SPJ4

If you wanted to see a section through both lungs at the same time, you could make a cut in the __________ or the __________ plane. If you wanted to see a section through both lungs at the same time, you could make a cut in the __________ or the __________ plane. transverse; parasagittal midsagittal; coronal coronal; transverse parasagittal; median

Answers

If you wanted to see a section through both lungs at the same time, you could make a cut in the parasagittal or the coronal plane. Coronal; transverse.

Coronal Plane: It is a vertical plane that divides the body into anterior and posterior sections. The plane is also known as the frontal plane and is perpendicular to the sagittal plane.

Transverse Plane: It is a horizontal plane that divides the body into superior and inferior sections. The plane is also known as the axial plane and is perpendicular to the sagittal and coronal planes.

Parasagittal Plane: It is a vertical plane that divides the body into unequal left and right sections.

Midsagittal Plane: It is a vertical plane that divides the body into equal left and right sections.

Median Plane: It is also known as the midsagittal plane. It is a vertical plane that divides the body into equal left and right sections.

The section through both lungs at the same time can be seen by making a cut in the coronal or transverse plane. Therefore, the correct option is C: coronal; transverse.

If you want to see a section through both lungs simultaneously, you can make a cut in the coronal or transverse plane. A coronal plane is a vertical plane that divides the body into anterior and posterior sections, while a transverse plane is a horizontal plane that divides the body into superior and inferior sections.

A coronal or transverse plane is used to see a section through both lungs at the same time.

To know more about Coronal visit

https://brainly.com/question/11514679

#SPJ11

which type of organic molecule serves as long-term energy storage in humans? a. Proteinsb. Starchc. Nucleic Acidd. Fats (Triglycerides)e. B and D

Answers

Option D: Fats or triglycerides are the type of organic molecules that serve as long-term energy storage in humans.

Triglycerides, sometimes known as fats, are the chemical compounds that can store the greatest energy. The animal body employs fats or triglycerides (lipids) for long-term energy storage and carbs (glycogen) for medium-term energy storage. Esters of glycerol and three fatty acids constitute what are known as triglycerides. The three fatty acids are often distinct from one another, yet the majority of common triglycerides include 16–18–20 carbon atoms.

Even when a person does not consume food continuously for several days, he can survive for a long period of time. This is because initially your stores carbohydrates get used up, then proteins, and then finally fats reserves are getting used up which keeps a man alive for several days without eating.

To know more about organic molecules, refer:

https://brainly.com/question/30714936

#SPJ4

As Kudzu became prosperous to certain regions of U.S land, in 1876, it was not long until inhabitants and wildlife acknowledged it as a threat and branded it (with reason) as pestilent. * Pestilent means destructive to life *Is this accurate? If not, explain why it is not. What should be restated/reworded

Answers

The word "pestilent" is an accurate word to describe kudzu.

While kudzu may have its beneficiary moments, such as serving as cattle feed, its destructive cons outweigh its pros. Kudzu as we know is an invasive species. Why is that? It is because it grows extremely well, too well in fact. When a kudzu crown (basically the seed) is present, it will continue to grow. Even if there is a tiny piece of that kudzu crown left when you relocate soil or try to eradicate it, kudzu will continue to grow. Scientists also found that kudzu emits chemicals that form ground-level ozone, which is bad for the environment.

Overall, kudzu is an invasive species that destroys ecosystems and causes a ton of environmental issues.

PLEASE HELPP!! GIVING BRAINLIEST!!!!!!!

PLEASE HELPP!! GIVING BRAINLIEST!!!!!!!

Answers

Answer:

c

Explanation:

if it does not involve 2 parents it will produce offspring identical to parents

Answer: I think that Mode 1 produces offspring identical to their parents

Explanation: I think to me other statements according to the pictures don't seem biologically correct

What type of functional groups or atoms would need to be present in the r-groups for hydrogen bonding to occur between two amino acids in a protein chain?.

Answers

R-groups would have to include polar groups such as alcohols (O-H), acids (COOH), or amines (NH2), which would have either oxygen or hydrogen on the end of a polar bond.

Which functional group does chemical R belong to?

R stands for alkanes, alkenes, and alkynes, as well as benzene derivatives on occasion. Since they exclusively contain carbon and hydrogen atoms, these groups are also known as hydrocarbyl groups.

What atoms do hydrogen bonds involve?

In an N-H, O-H, or F-H bond, the lone pair of a highly electronegative atom (usually N, O, or F) and the hydrogen atom engage in an unique sort of dipole-dipole interaction known as hydrogen bonding.

To know more about functional group visit:

https://brainly.com/question/14618322

#SPJ4

pros that animals need to survive a stampede

Answers

Some of the pros that animals need to survive a stampede are;

speedAgilitySizeStrength

What is Stampede?

A stampede is described as a situation in which a group of large animals suddenly start running in the same direction, especially because they are excited or frightened.

The animals that has speed and agility may be able to evade the stampeding herd by running  to the side or running away and this feature is important for small animals  because they may be trampled or crushed in the chaos.

Learn more about stampede at:

https://brainly.com/question/17613158

#SPJ1

The image below compares a normal DNA
sequence and one mutated to produce sickle
cell. Describe how the DNA strand has
been mutated and examine the amino
acid sequence. Is this a frameshift
mutation? How do you know?
Hemoglobin DNA strand
ATGGTGCACCIGACTCCTGAGGAGAAG
amino acid sequence (val his leu thr pro glu glu
Sickle cell hemoglobin DNA strand
ATGGTGCACCTGACTCCTGTGGAGAAG
amino acid sequence val his leu thr pro val glu

Answers

The image is unattached. A DNA strand can be mutated through various mechanisms, such as exposure to ultraviolet light, radiation, and certain chemicals, or spontaneous errors during DNA replication.

How is the DNA strand mutated?

These mutations can take the form of base substitutions, insertions, or deletions, and may affect a single nucleotide or a larger segment of DNA.

Amino acid sequences are determined by the sequence of nucleotides in a DNA strand. In the process of transcription, DNA is copied into RNA, and during translation, the RNA is read by ribosomes and translated into a sequence of amino acids, forming a protein. Each set of three nucleotides, called a codon, corresponds to a specific amino acid. If a mutation occurs in a DNA strand, it may alter the sequence of codons, which in turn could lead to a change in the amino acid sequence of the resulting protein.

To examine the amino acid sequence, the mutated DNA sequence must first be transcribed into RNA, and then translated into a protein. The resulting amino acid sequence can be analyzed and compared to the original, non-mutated sequence to determine the effects of the mutation.

Read more on DNA strand here:https://brainly.com/question/29037480

#SPJ1

what is chyme and how does the stomach mix this material?

Answers

Chyme is a viscous semi-fluid that develops in the stomach and intestine during digestion and is made up of partially digested food and digestive secretions. To create chyme, which is a mixture of food and digestive fluids, the muscles of the stomach walls flex.

The partially digested food-containing acidic liquid known as chyme is transported to the small intestine. By combining food, enzymes, and gastric juices, the stomach combines this. (The stomach produces this clear fluid.) Chyme is a viscous semi-fluid that develops in the stomach and intestine during digestion and is made up of partially digested food and digestive secretions. To create chyme, which is a mixture of food and digestive fluids, the muscles of the stomach walls flex. Since the majority of the stomach wall is formed of proteins, it needs to be protected because the acid in our stomachs would otherwise eat right through

Mostly protein makes up the gut wall. Gastric juices would eat through the stomach walls if allowed unchecked. Fortunately, the lining of the stomach walls contains epithelial cells that secrete a coating of mucus and bicarbonate that acts as protection.

To learn more about the Chyme please click on the given link: https://brainly.com/question/13147084

#SPJ4

What is Mendel famous for doing? What did he want to learn from this experiment?

Answers

Answer:

Mendel discovered the basic principles of heredity through experiments in his   garden.

Explanation:

His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Answer:

he bred pea plants

Explanation:

Mendel bred pea plants and discovered that there are multiple alleles for every gene. some are dominant and others are recessive.

It is not likely that any living organism could survive on the Martian surface because of
O ultraviolet radiation
O warm temperatures
O abundance of water

Answers

It is not likely that any living organism could survive on the Martian surface because of Ultraviolet radiation. Thus, the correct option for this question is A.

What is the Martian surface?

The Martian surface may be defined as a type of surface that is rocky in nature with canyons, volcanoes, dry lake beds, and craters all over it. Red dust covers most of its surface. It is basically made up of iron, nickel, and sulfur.

There have been organisms found in places on the Earth where everyone said it would be impossible to for anything to survive. This is because of the emission of high amounts of ultraviolet radiation that makes an environment unfit for an organism's survival.

Therefore, the correct option for this question is A.

To learn more about the Ultraviolet radiations, refer to the link:

https://brainly.com/question/1377878

#SPJ1

What is the meaning of the term disturbance?
Group of answer choices

an event that makes a species extinct) A

an event that changes a community) B

an event that decreases resource availability) C

an event that kills organisms) D

Answers

Answer:

B

Explanation:

B and b represent, respectively, the dominant and recessive alleles of a gene pair. Half of the F1 generation expresses the recessive condition, and the other half expresses the dominant condition. What are the most likely genotypes of the P generation

Answers

Answer:

Bb and bb

Explanation:

The most likely genotypes of the parental generation would be Bb and bb.

If Bb and bb are crossed, such that:

                       Bb    x    bb

offspring:     Bb   Bb   bb   bb

Bb = 2/4 = 1/2 = 50%

bb = 2/4 = 1/2 = 50%

hence;

1/2 or 50%% of the offspring would express the dominant condition in the form of Bb and the remaining 1/2 or 50% of the offspring will express the recessive condition in the form of bb.

Answer:

the dude above me correct

Is the elephant shrew more closely related to the elephant or the shrew?

How do we know?

Why are elephant shrews and shrews so similar?

Answers

The response to all the above questions on if the elephant shrew more closely related to the elephant or the shrew are given below.

In reality, elephant shrews are not shrews. Recent research indicates that they are more closely connected to an African mammal clade that includes elephants, sea cows, and aardvarks. The Macroscelididae, which consists of four genera and 19 extant species, is the only family that includes elephant shrews (also known as sengis).

Are shrews and moles closely related to elephant shrews?

Elephant shrews, also known as sengis, are not closely related to shrews, despite what their name might imply, nor are they rodents. Instead, they are distantly linked to elephants and belong to the Macroscelidea family, which is separate from that of shrews.

Note that Elephant shrews are tiny, hairy creatures with large ears that resemble gerbils or gigantic mice. They are not actually shrews, despite their name, and they are not rodents, despite their look. Moles and tenrecs are the closest relatives of elephant shrews.


Therefore, one can say that despite having a long snout and similar exterior features to mice, shrews are not rodents like mice. In actuality, it is far more closely related to hedgehogs and moles; the only thing shrews have in common with rodents is that they are both members of the Boreoeutheria magnorder.

Learn more about elephant from

https://brainly.com/question/26065446
#SPJ1

After Gerry mows his lawn, he often puts the grass clippings into his flower garden. How will this affect his garden?
A. It will decrease the amount of carbon in the soil and decrease the amount of carbon dioxide released by decomposers.
B. It will increase the amount of carbon in the soil and decrease the amount of carbon dioxide released by decomposers.
C. It will decrease the amount of carbon in the soil and increase the amount of carbon dioxide released by decomposers.
D. It will increase the amount of carbon in the soil and increase the amount of carbon dioxide released by decomposers.

Answers

Answer:

D.

Explanation:

I don't really have an explanation for this but here is the answer!! <3

Other Questions
which do you think was most important to theoutbreak of WW1?MilitarismNationalismAlliancesImperialism Help me pls:'(((!!!!!!!!!!!!!!!!!!!!!!! HELP PLEASE ITS DUE IN 10 MIN Use algebraic strategies to solve for x.Check your solutions algebraically and identify any extraneous solutions. Write it step by step. The overall long-term effects of air pollution are not yet certain.True False 1. It is believed that what we know is actually a constructed knowledge. Elaborate on the idea of constructed knowledge and illustrate your answer with examples. Help Please... giving brainliest.. On which sectors did the Four Modernizations focus? Select four options.agricultureartsbankingdefenseeducationindustryscience In schizophrenia research, patients who 'jump to conclusions' (JTC) in probabilistic reasoning tasks tend to display impaired decision-making and delusional belief. Personality psychologists conducted an empirical survey of the correlates of JTC behavior to predict the number of judgmental errors in a series of reasoning tasks in a sample of 288 individuals, half of which identified as having a diagnosis of schizophrenia, the other half did not. Pls help will give brainlist If you bought a hamburger for $2.30 and paid for it with a 5 dollar bill, how much change would you receive? a 5 kg ball on the end of a chain is whirled at a constant speed of 1.0 m/s in a horizontal circle of radius 3.0m. what is the work done by the centripetal force during one revolution? 5) So far you have a MP3 Player with 0.5 GB of music already stored on the MP3 player and know that each song is about 0.002 GB of memory. What are the possible numbers of additional songs that you can put on the MP3 player if it holds at most 2 GB? Consider the following vectors.u = i + 4 j 2 k, v = 4 i j, w = 6 i + 7 j 4 kFind the scalar triple product u (v w).u (v w) =Are the given vectors coplanar?Yes, they are coplanar.No, they are not coplanar.Need Help? Read It respond in a paragraph and make sure your answer is written in 2. Given the equation of a circle in standard form, identify the center, radius, and graph the circle.(x + 1)2 + (y - 2)2 = 36Center:Radius: I need it done asapp Will give brainly!! External conflict is a struggle between a character and an ..........force.)outside )inside )flying Consider in the figure below.The perpendicular bisectors of its sides are , , and . They meet at a single point .(In other words, is the circumcenter of .)Suppose , , and .Find , , and .Note that the figure is not drawn to scale. How does a computer do its work? Mention its working principle "Computer is a system." Justify this statement. Explain three most significant features of computer. What are the basic components of a computer? Briefly mentio a labelled diagram. Write the fulform of (i) CT scan (v) RAM (vi) ROM RI. r Science: Grade 8 (iii) ECG (iii) CAL (iv) (vii) ATM (viii) GIGO Suppose that the demand and supply of jeans in Italy are described by the following equations: D:P = 150-4Q S:P= 6 + 20 (a) Draw a graph for this. What are the autarky price and quantity in Italy? (b) Suppose a UK producer is willing to sell the same jeans at a price of 30 EUR. Under free trade, how many pairs of jeans will be produced domestically? How many pairs of jeans will Italians buy? Will Italy import or export jeans? (c) Suppose that after protests from Italian jeans producers, the government decides to impose a tariff of 20% on imported jeans. Will Italian consumption and production of jeans change? By how much? How much revenue does the government earn from the tariff?