The epidermis is avascular (lacks blood vessels). Therefore, oxygen, nutrients, and wastes must diffuse to and from blood vessels found in what region of the skin?

Answers

Answer 1

The blood vessels that supply the skin are located in the dermis, which is the layer of skin beneath the epidermis. The dermis is a highly vascularized layer of skin that contains blood vessels, nerves, hair follicles, and other important structures.

The blood vessels in the dermis are responsible for supplying oxygen and nutrients to the epidermis, as well as removing waste products from the skin. Oxygen and nutrients diffuse from the blood vessels in the dermis into the epidermis, while waste products such as carbon dioxide and urea diffuse from the epidermis back into the blood vessels in the dermis. This exchange of gases and nutrients is essential for the health and function of the skin, and it is facilitated by the close proximity of the blood vessels in the dermis to the epidermis. Therefore, even though the epidermis is avascular, it is still able to receive the necessary oxygen and nutrients from the blood vessels in the underlying dermis.

Learn more about blood vessels here:-

https://brainly.com/question/4601677

#SPJ11


Related Questions

a forest fire kills off 90% of a rabbit population. what has occurred in this population?

Answers

The forest fire has caused a significant reduction in the rabbit population, resulting in a 90% mortality rate.

This event is likely to have long-lasting effects on the remaining population, as they will have to adapt to the new conditions of their environment with a significantly reduced population size. Additionally, the loss of 90% of the rabbit population may have a ripple effect on other organisms that depend on them for food or as prey. Overall, this event is an example of a natural disaster that can have devastating impacts on a local population and ecosystem. In this situation, a significant decrease in the rabbit population has occurred due to the forest fire. This event is an example of a population crash, specifically caused by an environmental catastrophe.

To know more about forest visit:

https://brainly.com/question/29807522

#SPJ11

What is the end result of cytokinesis from a cell undergoing mitosis?

Answers

The end result of cytokinesis indicates the two cells with identical copies of DNA arise from a single parental cell.

What is Cytokinesis?

Cytokinesis may be defined as the process of separation of the cytoplasm at the end of mitosis.

Cytokinesis is the phase of mitosis which involves the overall division of cytoplasm and the construction of two copies of cells with identical DNA content.

It occurs after the process of karyokinesis, which results in the formation of two daughter cells from a single parental cell.

Therefore, it is well described above.

To learn more about Cytokinesis, refer to the link:

https://brainly.com/question/314066

#SPJ1

SPENT 100 POINTS, NEED HELP ASAP!!!


My assigned technology is GENE THERAPY!


Think about how the technology impacts the field of science and our society. Answer the following questions in your explanation:

· Why is this technology important to the advancement of science?

· What does this new technology allow- what doors are open because of this technology?

· How does this technology affect society?

· Include a picture that illustrates your point.

*** Explanation can be pretty short since it should only fit on one slide.

Answers

Explanation:

Gene therapy is a promising technology that has the potential to treat genetic disorders by replacing, removing, or modifying genes.

Why is this technology important to the advancement of science?

Gene therapy is important to the advancement of science because it provides a novel approach to treating genetic diseases that have previously been untreatable. By directly manipulating the genetic code of an individual, it is possible to address the root cause of many genetic disorders, potentially leading to improved outcomes for patients.

What does this new technology allow - what doors are open because of this technology?

Gene therapy allows for the possibility of treating genetic disorders that were previously thought to be incurable. It also allows for more targeted and personalized treatment approaches, as gene therapy can be tailored to an individual's specific genetic makeup. This technology opens the doors for developing more effective treatments for a wide range of genetic disorders.

How does this technology affect society?

Gene therapy has the potential to improve the lives of millions of people around the world who suffer from genetic diseases. This technology could reduce the burden of disease on individuals, families, and healthcare systems. However, there are also ethical and societal concerns around the use of gene therapy, such as issues related to access, cost, and potential unintended consequences of genetic manipulation.

Include a picture that illustrates your point:

[Picture of a DNA double helix with a medical symbol in the center to represent gene therapy]

Answer:

Gene therapy is a groundbreaking technology that has the potential to revolutionize healthcare. It involves the use of genetic material to treat or prevent diseases. This technology is important to the advancement of science because it allows researchers to identify and correct genetic mutations that cause diseases.

1. Why is this technology important to the advancement of science?

Ans:

Gene therapy is important to the advancement of science because it allows researchers to study the effects of specific genes on the body and to develop new treatments for genetic diseases. This technology also provides a better understanding of gene function and regulation, which can lead to the development of new drugs and therapies.

2. What does this new technology allow- what doors are open because of this technology?

Ans:

Gene therapy allows for the development of personalized medicine, where treatments are tailored to an individual's genetic makeup. It also enables the treatment of rare diseases that affect a small percentage of the population. This technology opens doors to the development of new treatments for diseases that were previously untreatable or incurable.

3. How does this technology affect society?

Ans: Gene therapy has the potential to significantly impact healthcare and society as a whole. It could lead to the eradication of genetic diseases, such as cystic fibrosis and sickle cell anemia, and reduce the prevalence of other diseases, such as cancer. However, there are also concerns about the ethics of gene therapy, including the potential for misuse and the possibility of creating "designer babies."

4: Include a picture that illustrates your point.

Ans: See atachment

SPENT 100 POINTS, NEED HELP ASAP!!!My assigned technology is GENE THERAPY!Think about how the technology

one day after a biology class four of your friends argue about the difference between phylogeny and systematics. which friend is right? multiple choice friend a states that systematics and phylogenies are really the same, one is more recent than the other, but basically they are the same. friend c argues that systematics is the actual collecting and cataloguing of specimens into museums that can be used later by scientists to construct clades and phylogenies. friend d says that the way she remembers is that systematics is the reconstruction and study of phylogenies. friend b says that systematics is the same as cladistics and cladistics is reconstructing clades, which ultimately lead to the development of phylogenies.

Answers

The correct option(A). Friend  A states that systematics and phylogenies are actually something very similar, one is later than the other, but fundamentally they are something very similar.

Recognize phylogeny and systematics. Phylogeny - > The transformative history of animal categories or gathering of related species. Systematics - > The investigation of natural variation in an ecological setting, enveloping scientific categorization and including the reproduction of phylogenetic history.

Significance. Phylogeny relates to the transformative history of a scientific categorization of organic entities and it is utilized as a premise in phylogenetics as the last option manages the connections of an organic entity to different organic entities as per developmental similitudes and contrasts.

To learn more about phylogenetics here

https://brainly.com/question/13577065

#SPJ4

over a span of 50 years, civil engineers built wildlife bridges to allow animals to safety cross highways that run through a forest. The first graph shows the change in the number of wildlife bridges during those 50 years . The second graph shows a deer population in the same area changed over the same period. Which hypothesis is supported by the data?

Answers

The hypothesis supported by the data is that the construction of wildlife bridges has positively impacted the deer population in the area.

The first graph shows an increasing trend in the number of wildlife bridges over the span of 50 years. This indicates that civil engineers have been actively constructing more bridges to facilitate safe animal crossings.

The second graph, depicting the deer population, shows an upward trend over the same period. This suggests that the deer population has increased over time.

Based on these two pieces of information, it can be inferred that the construction of wildlife bridges has provided a safe passage for deer and other wildlife, allowing them to move across the highways more freely and reducing the risk of road accidents and mortality.

This has likely contributed to the growth of the deer population in the area. The data supports the hypothesis that the implementation of wildlife bridges has had a positive impact on the deer population.

For more such answers on population

https://brainly.com/question/29885712

#SPJ8

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Describe a possible adaptation of a plant that utilizes wind dispersal as a way to spread its seeds.

Answers

Seeds from plants like dandelions, swan plants and cottonwood trees are light and have feathery bristles and can be carried long distances by the wind. Some plants, like kauri and maple trees, have 'winged' seeds. They don't float away but flutter to the ground.

What makes amino acids different from each other? (4 points)
Amino group
Carboxyl group
Hydrogen atom
Side chain

Answers

Answer:

The answer is side chain/group.

Answer:

d

Explanation:

If you wanted to see a cell wall, where could you look?.

Answers

Answer:

A cell wall is a structural layer surrounding some types of cells, just outside the cell membrane. It can be tough, flexible, and sometimes rigid. It provides the cell with both structural support and protection, and also acts as a filtering mechanism.

Explanation:

A cell wall is a rigid, semi-permeable protective layer in some cell types. This outer covering is positioned next to the cell membrane (plasma membrane) in most plant cells, fungi, bacteria, algae, and some archaea.

just outside of the cell
membrane , the cell wall is located

why does saturn appear yellower in color than jupiter?

Answers

Saturn appears yellower in color than Jupiter due to the presence of more ammonia ice in its atmosphere. This ammonia ice absorbs the blue and green wavelengths of light, reflecting more of the yellow and red wavelengths. Jupiter, on the other hand, has less ammonia ice in its atmosphere, resulting in a more muted color.


The color of a planet's atmosphere is determined by the types of gases and particles present in it. Saturn's atmosphere is composed mostly of hydrogen and helium, with small amounts of other gases such as methane, ammonia, and water vapor. The ammonia in Saturn's atmosphere forms crystals of ammonia ice that reflect light differently than other gases. These crystals absorb blue and green light more efficiently, resulting in more yellow and red light being reflected back. In contrast, Jupiter's atmosphere is also primarily composed of hydrogen and helium, but with larger amounts of methane and other hydrocarbons. These gases absorb a broader range of colors, resulting in a more muted, beige-colored appearance.
Overall, the difference in the amount of ammonia ice in Saturn's atmosphere is the main reason why it appears yellower in color than Jupiter. However, other factors such as the thickness of the atmosphere and the angle of the sun's light can also affect a planet's color.

To know more about Saturn visit :

https://brainly.com/question/12181523

#SPJ11

. Another test that is used for identifying trypanosomiasis is the lumbar puncture. This test involves inserting a needle into the spine to extract spinal fluid. The spinal fluid is examined for presence of the parasites. Why do you think the C.A.T.T. test used for mass screenings instead of the lumbar puncture test

Answers

The C.A.T.T. (Card Agglutination Test for Trypanosomiasis) test is preferred for mass screenings for trypanosomiasis over the lumbar puncture test due to several reasons.

Firstly, the C.A.T.T. test is less invasive compared to the lumbar puncture test. In the C.A.T.T. test, a small blood sample is used to detect the presence of antibodies against the trypanosome parasite, whereas the lumbar puncture involves inserting a needle into the spine to collect spinal fluid. This makes the C.A.T.T. test less painful and safer for the patient.
Secondly, the C.A.T.T. test is quicker and more cost-effective than the lumbar puncture test. Since mass screenings often involve testing a large number of individuals, it is essential to use a method that can provide rapid results without incurring high costs. The C.A.T.T. test is relatively inexpensive and can be performed on-site, allowing for immediate results.
Finally, the C.A.T.T. test has a higher sensitivity compared to the lumbar puncture test, meaning that it is more likely to correctly identify individuals with trypanosomiasis. This is particularly important for mass screenings, as false negatives could result in the spread of the disease.
In summary, the C.A.T.T. test is preferred for mass screenings of trypanosomiasis due to its non-invasiveness, cost-effectiveness, and higher sensitivity compared to the lumbar puncture test.

For more information on spinal fluid see:

https://brainly.com/question/28977652

#SPJ11

What were the results Mendel consistently identified in his experiment

Answers

Answer:
Developed the model of heredity that now bears his name by experiments on various characteristics of pea plants:

Which of the following is found in BOTH plant and animal cells?

Choose 1 answer:

(Choice A) Lysosome

(Choice B) Chloroplast

(Choice C) Cell wall

(Choice D) Nucleus

Answers

Answer: The answer is D Nucleus

Explanation:

OPTION D) NUCLEUS.....

Explanation:

NUCLEUS IS FOUND IN BOTH PLANTS AND ANIMALS CELLS......

In my BIO lesson it's comes. I'm sure. NUCLEUS is the right answer.....

HOPE IT HELP........

lamar constantly thinks about dirt and bacteria that exist all around him, and he feels compelled to wash his hands many times throughout the day. these thoughts and actions upset him and he wishes that he could control them. this is an example of the criterion for defining abnormal behavior.

Answers

Any behavior that is abnormal, statistically rare, harmful to the individual or those around them, or that is otherwise uncharacteristic of the culture in question.

Disorders of abnormal psychology include anxiety disorders, compulsive behaviors, PTSD, mood disorders, personality disorders, schizophrenia, delusional disorders, substance use disorders, dissociative disorders, and impulse control disorders. Such behavior is frequently seen as a sign of a mental or emotional disturbance, which can range from mild adjustment issues to serious mental disorders.

Learn more about the behavior

https://brainly.com/question/1741474

#SPJ4

how does the cell membrane work

Answers

Answer:

The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.

Explanation:

The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell. And that membrane has several different functions. One is to transport nutrients into the cell and also to transport toxic substances out of the cell

A disadvantage of sexual reproduction in plants is

Answers

Answer:

These are some of the disadvantages of sexual reproduction: time and energy are needed to find a mate.

hope this helps!

A disadvantage of sexual reproduction is the fact that ADDITIONAL ENERGY is required to complete a life cycle.

Sexual reproduction can be defined as a type of reproduction that involves a complex life cycle in which germinal haploid cells called gametes combine to produce a diploid (2n) cell called the zygote.

Subsequently, this zygote then divides to produce an adult organism.

In plants, the most important disadvantage of sexual reproduction is that energy is required to complete a complex life cycle (i.e., zygote development).

The diploid (2n) multicellular stage in the life cycle of a plant is known as the sporophyte.

In conclusion, a disadvantage of sexual reproduction in plants is that ADDITIONAL ENERGY is needed to complete a complex life cycle.

Learn more in:

https://brainly.com/question/1603846?referrer=searchResults

What are the strengths and weakness of gel electrophoresis ?

Answers

Answer:

Hello.

• gels can melt during electrophoresis, the buffer can become exhausted, and different forms of genetic material may run in unpredictable forms.

• And the strengths could be that it separates based on size, it is relatively easy to do.

Which pcs root operation is used for an adhesiolysis when adhesions are freed from a body part they are restricting?

Answers

Release pcs root operation is used for an adhesiolysis when adhesions are freed from a body part they are restricting.

What is release Root operations?

Root operation is refers to the cutting of the upper or lower extremities.

What is adhesiolysis?

Adhenolysis is the surgical procedure that removes abdominal adhesion to regain the normal anatomy and functionality of an organ.

What are adhesion?

Adhesions are the bands of scar-like tissue that form inside of the organ that cause tissue or organ to stick together.

Learn more about ICD 10 PCS Root operation here: https://brainly.com/question/19550778  

#SPJ4  

Are genes made up of base pairs?

Answers

Yes, genes are composed of base pairs. A gene is a DNA, and specific base pair sequence defines the genetic code and, eventually, the function of the protein for which the gene codes.

A gene is a DNA (Deoxyribonucleic Acid) sequence that contains the instructions for creating a protein. Adenine (A), guanine (G), cytosine (C), and thymine are the four nitrogenous bases that make up DNA (T). The "rungs" of the DNA "ladder" are formed by these nitrogenous bases, with A always partnering with T and C always coupling with G. The genes are made up of base pairs. The base pair sequence is unique to each person and serves as the foundation for genetic variability.

For more such questions on genes.

https://brainly.com/question/8832859#

#SPJ11

If a cell with six chromosomes undergoes mitosis, it will produce____________ (number) daughter cells that contain ______________ (number) chromosomes.

Answers

Answer:

hii dear your answer is here

2 daughter cells with 6 chromosomes each.

Explanation:

If a cell with six chromosomes undergoes mitosis, it will produce 2 (number) daughter cells that contain 6 (number) chromosomes.

Mitosis is a type of cell division where one parent cell divides to produce two genetically identical daughter cells. In diploid organisms, mitosis produces diploid daughter cells.

If a cell with six chromosomes undergoes mitosis, it will produce TWO daughter cells that contain SIX chromosomes.

A diploid (2n) organism has two copies of each chromosome in its somatic cells.

Mitosis can be divided into the following stages: prophase, metaphase, anaphase and telophase.

In conclusion, if a cell with six chromosomes undergoes mitosis, it will produce TWO daughter cells that contain SIX chromosomes.

Learn more in:

https://brainly.com/question/13536882?referrer=searchResults

Which term refers to a variable that is not allowed to change during an
experiment?
O A. Controlled variable
OB. Dependent variable
OC. Random variable
OD. Hypothetical variable

Answers

A. Controlled Variable

Student Instructions: In this activity you are going to participate in a Discussion Board. To prepare yourself for the discussion, read the Case Study 7.1. Pathology of beluga whales in the St. Lawrence estuary, Quebec, Canada which you may find on page 399 of the textbook. Open a trend by answering one of the following questions: - Which was the origin and number of the control beluga population used to study the population of the St. Lawrence estuary? - Make a list of possible pollutants and origin which pose a toxic effect responsible of diminishing the Beluga population in the St. Lawrence estuary. - Stablish the relation chemical compound - symptom or damage for two pollutants. - Name one of the symptoms associated with endocrine disruption.

Answers

Regarding the relation between chemical compounds and symptoms/damage, let's choose two pollutants. For instance, PCBs can lead to reproductive issues in beluga whales, while mercury can cause neurological damage.
Finally, one symptom associated with endocrine disruption is the disturbance of hormone levels, leading to reproductive abnormalities in beluga whales.

The Case Study 7.1 discusses the pathology of beluga whales in the St. Lawrence estuary, Quebec, Canada. To answer the question regarding the origin and number of the control beluga population used for studying the St. Lawrence estuary population, we need to refer to the textbook's page 399.

To address the question about possible pollutants and their origins that have toxic effects on the beluga population, we can compile a list. Examples include heavy metals like mercury from industrial activities, polychlorinated biphenyls (PCBs) from electrical equipment, and polycyclic aromatic hydrocarbons (PAHs) from oil spills.

Regarding the relation between chemical compounds and symptoms/damage, let's choose two pollutants. For instance, PCBs can lead to reproductive issues in beluga whales, while mercury can cause neurological damage.

Finally, one symptom associated with endocrine disruption is the disturbance of hormone levels, leading to reproductive abnormalities in beluga whales.

To know more about polychlorinated biphenyls visit:

brainly.com/question/33710986

#SPJ11

Two brown-eyed parents have a child. The child has blue eyes.
Which term best describes the allele for the child's blue eyes?
O heterozygous
O homozygous
O dominant
O recessive

Answers

The term that best describes the allele for the child's blue eyes is recessive. Thus, the correct option for this question is D.

What is a Recessive allele?

A recessive allele may be defined as a kind of allele that when present on its own will not affect the individual. It will only be expressed in the phenotype if two copies of it are present.

According to the context of this question, the brown eye (B) is dominant over the blue eye (b). The parents have genotypes brown-eyed which means they are heterozygous for brown-eye (Bb) and when they interbreed with each other, they produce a blue eyes child which has a recessive allele of (bb).

Therefore, the term that best describes the allele for the child's blue eyes is recessive. Thus, the correct option for this question is D.

To learn more about Recessive alleles, refer to the link:

https://brainly.com/question/463037

#SPJ1

Identify two solutions that have more OH- ions than H+ ions.

Answers

Answer:

Lemon juice and human blood are both acidic and, therefore, contain more H+ ions than OH- ions.

Could two parents with cleft-chin have a child without cleft-chin?

Answers

Answer:Cleft chins were believed to be a dominant trait: if two parents had cleft chins, their kids could have a cleft or might not  But it turns out a cleft chin is too complicated to be simply dominant. Two parents without a cleft have kids with cleft chins way more often than predicted with this simple model.

Explanation:

Answer:

A

B

Explanation:

:))))))))

FILL IN THE BLANK HELP!! 15 POINTS!

Density is a physical property that measures the _________ per given ________of a solid liquid or gas.
Density is most commonly used for determining how different ________ interact with one another.
Objects will _______ densities will generally float above objects with ________ densities.

FILL IN THE BLANK HELP!! 15 POINTS!Density is a physical property that measures the _________ per given

Answers

Explanation:

-Mass per given unit volume

-substance

-less and more

What is the implication of the different classification of cells. Is it necessary to sustain life? Why? ​

Answers

Answer:A: "Where's Anna?" - B: "She's not here. She's over __________." *

1 điểm

there

here

out

in

Look at the sky! It__________. *

1 điểm

is going to rain

will rain

rains

is raining

We__________ a new car soon. *

1 điểm

get

will get

are getting

are going to get

He made __________ a sandwich. *

1 điểm

itself

himself

herself

yourself

A: "Would you like to come over for dinner?" - B: "__________." *

1 điểm

I'd love to but I have a lot of homework tonight

You're welcome

There are lots of drinks, food and desserts

I'm fine. Thank you.

A: "Let's make a new poster for our project." - B: " __________." *

1 điểm

Sure

That sounds great

Good idea

All are correct

We have a ____________ house. *

1 điểm

nice small old green

green old small nice

small nice old green

old green nice small

The children are playing _________. They are in the garden. *

1 điểm

inside

upstairs

outside

downstairs

Class *

Come in and have a seat! Help __________, children! *

1 điểm

itself

yourselves

ourselves

themselves

I am not __________ to play basketball. *

1 điểm

enough tall

tall enough

too tall

tall too

Explanation:

What do sister chromatids contain?

Answers

The sister chromatids consists of genes that are exactly same in both the chromatids. This is because sister chromatids are identical copies of each other.

Chromatid is one of the two parts of a chromosome. Two chromatids of the same chromosome are called sister chromatids because they are identical in nature. The sister chromatids are joined together at the centromere.

Genes are the factors that contain the genetic information of an individual. These are also the basic unit of heredity. There are several genes present in a chromosome of an organism that encodes for a specific information. A gene is actually a part of the DNA strand.

To know more about genes, here

brainly.com/question/29367774

#SPJ4

How can a change in genotype affect the phenotype?

Answers

Answer:

The genome in which a genotype is found can affect the expression of that genotype, and the environment can affect the phenotype. Genes can also be pleitropic when they affect more than one trait. The single base pair mutation that lead to sickle cell anemia is a classic example.

Answer: population

Explanation: An organism's genotype is the set of genes that it carries. ... However, since an organism's genotype generally affects its phenotype, the phenotypes that make up the population are also likely to change. For example, differences in the genotypes can produce different phenotypes.

Scare Monsters can be blue, purple or blue with purple spots. If we
cross a purple scare monster with a blue scare monster, what will be the
phenotypes of the offspring?

Scare Monsters can be blue, purple or blue with purple spots. If wecross a purple scare monster with

Answers

Answer:

Incomplete Dominance

Explanation:

Its incomplete dominance because if it has anything to do with colors blending to make anything new its always going to be incomplete dominance.

Other Questions
La siguiente figura representa una torre de transmisin de energa elctrica: Mediante cual razn trigonomtrica se puede determinar la altura de la torre? dejar procedimiento o justificacin. A. sen = BC/c B. sen = BC/b C. sen = c/b D. sen = b/c Things turned upside down during the Great Depression. America was in chaos, from severely high unemployment rates, to the Dust Bowl destroying farms and crops, to a mass migration from the east to west with people in search of jobs. Discuss in detail the different issues the nation went through. Are there any similarities with what you see today? To tie up the conversation, discuss how the government was involved in solving the Depression. Examine the map and answer the following question: Which inference doesthe locations of Nazi extermination camps support?EXTERMINATION CAMPS INOCCUPIED POLAND 1942Extermination CampsPoland 1939 BoundaryPre German-Soviet PactHamburgGREATERGERMANYMunichBerlinBalticSeaChelmnoAuschwitzREICHSKOMMISSARIATOSTLANDSLOVAKIATreblinkaBelzecMajdanekREICHSKOMMISSARIATUKRAINESobiborGENERALGOUVERNEMENTHUNGARYUNDERGERMANMILITARYADMIN.ROMANIA a) unemployment and the price level. b) unemployment but not the price level. c) the price level, but not unemployment. d) neither the price level nor unemployment. Ms. Spencer is packing orders for her bath supply business. One customer ordered 8 bath fizzies and 4 jars of sugar scrub. Each bath fizzy weighs 5 ounces, and each jar of sugar scrub weighs 1.5 pounds. How many pounds does this customer's entire order weigh? Which type of statement proves a possible answer to a Scientific question based on scientific knowledge un leopardo recorre una distancia de 10 metros de un tiempo de 5 segundos en linea recta. Considerando la anterior , con que rapidez se desplaza el leopardo? Why is dance important as a teacher? as used in line 4 ("divined") , "divined" most nearly means choose 1 answer: anticipated. deduced. proven. hypothesized. the 2017 balance sheet of kerbers tennis shop, inc., showed $2.45 million in long-term debt, $730,000 in the common stock account, and $6.15 million in the additional paid-in surplus account. the 2018 balance sheet showed $3.65 million, $925,000, and $8.25 million in the same three accounts, respectively. the 2018 income statement showed an interest expense of $210,000. the company paid out $570,000 in cash dividends during 2018. if the firm's net capital spending for 2018 was $810,000, and the firm reduced its net working capital investment by $135,000, what was the firm's 2018 operating cash flow, or ocf? a multiplication problem that will have the answer of -48. Alyssa is going to invest in an account paying interest rate of 4.3% compounded daily how much would a Lissa need to invest to the nearest dollar for the value of the cow to reach $330 in 17 years? the united states government has become concerned that corn farmers are not able to make enough money to raise their families comfortably. congress has voted to increase the level of corn subsidies given to farmers: what effects will this have? which pair of enzymes, if used simultaneously, will produce the greatest amount of glucose if the experiment is repeated? Susan's cell phone plan includes unlimited texting. The amount she pays for texting eachmonth can be described by the function y = 20, where y is the number of dollars spent ontexting as a function of x, the number of texts.What is true about the function?It is linear because the rate of change is zero.It is linear because the rate of change is increasing.It is nonlinear because the rate of change is zero.It is nonlinear because the rate of change isincreasing. 1.30 grams of H2 are reacted with an excess of N2 to produce 4.21 grams of NH3. 3H2 +N2 2NH3 What was the percent yield for ammonia in this reaction? Select the correct text in the passage. Which quotation in the text foreshadows a romantic encounter? from The Squatter and the Don by Mara Ruiz de Burton The Squatter and the Don involves two families in San Diego in the 1870s. The Alamar family, headed by Don Mariano, has lived on a large ranch for decades. But since the Mexican-American War ended, settlers from the eastern United States have been occupying the Alamars land. In this excerpt, Clarence Darrell, the son of one such settler, runs into Seor Alamars son Don Victoriano. "Good morning," said Clarence, "I am glad to catch up with you, Don Victoriano. I have been wanting to speak to you. " Victoriano bowed, saying, "Will you go to my house?" "No, I'd rather not. I am not dressed to be seen by ladies. I would rather speak to you here. " "You are going to build a large house, Mr. Darrell? " said Victoriano, turning his horse so as to ride beside Clarence; "judging by the amount of lumber being hauled. " "Yes; rather. We are a large family, and require a good deal of room. But before we do any more work I want to speak with your father. I want to ask himask him as a favorand yet, as a business proposition"he hesitated; he was evidently embarrassed; but Victoriano, not guessing the drift of his words, remained waiting silently, offering no assistance. "Well," he continued, "I mean this: I don't like this fashion of taking people's lands, and I would like to pay to Seor Alamar for what has been located by us, but at the same time I do not wish my father to know that I have paid for the land, as I am sure he would take my action as a reproachas a disclaimer of his own action, and I don't wish to hurt his feelings, or seem to be disrespectful. " "I understand, and I think my father will be willing to sell the land. He is at home now. Let us go up to see him. " "Had you not better speak to him, and make an appointment for me to see him to-morrow, or some other time? I'd rather not risk being seen by the ladies in this blue flannel shirt and heavy boots. I. When the stoma is closed what two plant processes cannot occur? Factor 24j-1624j1624, j, minus, 16 to identify the equivalent expressions.Choose 2 answers:Choose 2 answers:(Choice A)A8(3j-2)8(3j2)8, left parenthesis, 3, j, minus, 2, right parenthesis(Choice B)B6(4j-2j)6(4j2j)6, left parenthesis, 4, j, minus, 2, j, right parenthesis(Choice C, Checked)C4(6j-4)4(6j4)4, left parenthesis, 6, j, minus, 4, right parenthesis(Choice D)D2(12-8)2(128) Is (3, -5) a solution to this system of equations?y = -1/3x - 4 y = -2x + 1Yes or No