The derivative of a continuous function f is given. Find the open intervals on which f is (a) increasing, (b) decreasing, and (c) find the x-values of all relative extrema. f,(x) = (x + 7)(x-1 )(x-2) (a) For which interval(s) is the function increasing? Select the correct choice below and, if necessary, fill in the answer box within your choice. O A. The function is increasing on O B. The function is never increasing (Type your answer in interval notation. Use a comma to separate answers as needed.)

Answers

Answer 1

The function f(x) = (x + 7)(x - 1)(x - 2) is increasing on the interval (-∞, -7) ∪ (1, 2) and decreasing on the interval (-7, 1) ∪ (2, +∞).

To determine where the function is increasing or decreasing, we need to examine the sign of its derivative. Taking the derivative of f(x), we get f'(x) = 3x^2 - 12x + 7. To find the intervals of increase and decrease, we need to determine the sign of f'(x) on different intervals.

To find where f'(x) > 0, we solve the inequality 3x^2 - 12x + 7 > 0. The solutions to this inequality are x < -7 and 1 < x < 2. Therefore, f(x) is increasing on the intervals (-∞, -7) and (1, 2).

To find where f'(x) < 0, we solve the inequality 3x^2 - 12x + 7 < 0. The solutions to this inequality are -7 < x < 1 and x > 2. Therefore, f(x) is decreasing on the intervals (-7, 1) and (2, +∞).

Hence, the function f(x) is increasing on the interval (-∞, -7) ∪ (1, 2) and decreasing on the interval (-7, 1) ∪ (2, +∞).

Learn more about derivative here:

https://brainly.com/question/25324584

#SPJ11


Related Questions

14. If the angle of elevation of the sun is 60 ∘ , how tall is a tree that casts a shadow 75 feet long? 15. If a vector v has a magnitude 10.0 and makes an angle of 30 ∘ with the positive y-axis, find the magnitudes of the horizontal and vertical components of v.

Answers

The angle of elevation of the sun is 60° and a tree casts a shadow of 75 feet long. Let's represent the height of the tree as 'h'.From the given figure below, we can see that the tree, the shadow, and the sun form a right-angled triangle.

From trigonometry, we know that:tanθ = opposite / adjacenttan60° = h / 75√3 = h / 75h = 75√3 feetTherefore, the height of the tree is 75√3 feet.15. If a vector v has a magnitude 10.0 and makes an angle of 30° with the positive y-axis, find the magnitudes of the horizontal and vertical components of v.We are given the magnitude (|v|) and the angle that vector v makes with the positive y-axis.

Let's represent the horizontal component of the vector as 'x' and the vertical component as 'y'.We can find the value of x and y as follows:x = |v| cosθy = |v| sinθwhere θ is the angle that the vector makes with the positive y-axis. Given that the angle θ is 30° and the magnitude of the vector is 10.0, we have:x = 10.0 cos 30°y = 10.0 sin 30°= 10.0 × √3 / 2= 5.0√3≈ 8.66The magnitudes of the horizontal and vertical components of the vector are approximately 5.0 and 8.66, respectively.

Learn more about angle of elevation:

brainly.com/question/25748640

#SPJ11

research and summarize a real-world application of statistics. in this application be sure to include one of the central tendencies such as mean, median, mode, or range. be sure to thoroughly describe the situation and the importance of statistics in it.

Answers

All of the following are measures of central tendency except the range

Mean

It is defined as the single number that represents the mean value for the given set of data or the closed value for each entry given in the set of data.

The mode, median, and mean are the three primary metrics for assessing central tendency. These metrics each give a different indication of the average or central value in the distribution.

Mode

The highest frequency of data and how many times the element is repeated in the data set is known as the mode value.

Median

A median is a middle number in a series of numbers that have been arranged to lift, and it might be more informative of the set of data than the average.

Mean, median and mode are different measures of center in a numerical data set. They each try to summarize a dataset with a single number to represent a typical data point from the dataset.

When there are extremes in the sequences that might affect the average of the numbers the median is sometimes employed instead of the mean.

Thus, all of the following are measures of central tendency except the range

To learn more about Mean Median Mode visit:

brainly.com/question/15323584

#SPJ4

If ||v|| = 7 and ||w|| = 4, what are the smallest and largest possible values
of ||v − w||? What are the smallest and largest values of v · w?

Answers

The smallest and largest possible values of ||v − w|| are 3 and 11, respectively. The smallest and largest values of v · w are 0 and 28, respectively.

The magnitude of a vector is a measure of its length or size. In mathematics, it is represented by two vertical bars surrounding the vector symbol, for example, ||v||.

In this case, we have two vectors, v and w, with magnitudes ||v|| = 7 and ||w|| = 4.

When the vectors v and w point in the same direction, the magnitude of their difference is at its minimum. In this case, ||v − w|| = ||v|| − ||w|| = 7 − 4 = 3.

On the other hand, when the vectors v and w point in opposite directions, the magnitude of their difference is at its maximum. In this case, ||v − w|| = ||v|| + ||w|| = 7 + 4 = 11.

Next, let's consider the dot product of v and w, also known as the scalar product. The dot product of two vectors is a scalar value that is proportional to the magnitudes of the vectors and the cosine of the angle between them.

The smallest possible value of the dot product of v and w is 0, which occurs when they are orthogonal or perpendicular to each other. The largest value of the dot product of v and w is equal to the product of their magnitudes, which occurs when they are parallel. In this case, the largest value of v · w is v · w = ||v|| * ||w|| = 7 * 4 = 28.

To learn more about vector, visit

brainly.com/question/14033610#

#SPJ11

Solve for h.

–10 − 8h − 14h = –15h + 18

h =

Answers

Answer:

\( \boxed{h = -4} \)

Step-by-step explanation:

\( = > - 10 - 8h - 14h = - 15h + 18 \\ \\ = > - 10 - 22h = - 15h + 18 \\ \\ = > - 22h + 15h - 10 = 18 \\ \\ = > - 7h - 10 = 18 \\ \\ = > - 7h = 18 + 10 \\ \\ = > - 7h = 28 \\ \\ = > 7h = - 28 \\ \\ = > h = - \frac{28}{7} \\ \\ = > h = -4\)

Mallory works 20 hours a week as a website designer and earns $42.50 per hour. If Mallory saves
1
2
of her total website-design earnings each week, how much will she save in 4 weeks?

Answers

If Mallory makes $42.50 per hour and she works 20 hours a week, we multiple those two and we get:

42.5 * 20 = 850

So she earns $850 per week.

Mallory saves half of that amount she would have $425 per week.

In 4 weeks she would have:

425 * 4 = 1700

Mallory will save $1,700 in four weeks.

Answer:

I believe it's 17000

Step-by-step explanation:

42.50 x 20 = 850

850 x 5 (5 business days) = 4250

4250 x 4 (4 weeks) = 17000

In the table, x represents minutes, and y represents the altitude of an airplane.

Altitude of an Airplane
Minutes, x
Altitude in feet, y
15
22,500
20
20,000
25
17,500
30
15,000

Which statement is correct about the slope of the linear function that the table represents?
The slope is positive because as the minutes decrease, the altitude increases.
The slope is positive because as the minutes increase, the altitude increases.
The slope is negative because as the minutes decrease, the altitude decreases.
The slope is negative because as the minutes increase, the altitude decreases.

Answers

Answer:

it is d i took the quiz

Step-by-step explanation:

Answer:

d

Step-by-step explanation:

i took the quiz

how many significant figures does the result of the following sum contain? 8.5201 1.93 a. 1 b. 2 c. 3 d. 4

Answers

The number of significant figures is:

c. 3

What is significant figure?

The crucial or important digits that accurately represent the meaning of a certain number are known as the significant figures of that number. 6.658, for instance, has four significant digits.

To determine the number of significant figures in the result of a sum, we need to consider the least number of significant figures present in the numbers being added.

In the given sum, we have 8.5201 and 1.93.

The number 8.5201 has five significant figures, and the number 1.93 has three significant figures.

When we add these two numbers, the result is 10.4501.

Since 1.93 has three significant figures, the result of the sum should also have three significant figures.

Therefore, the number of significant figures is:

c. 3

Learn more about significant figures on:

https://brainly.com/question/11566364

#SPJ4

A 10-ft ladder rests against a vertical wall. If the bottom of the ladder slides away from the wall at a rate of 1 ft/sec, how fast, in ft/sec, is the top of the ladder sliding down the wall, at the instant when the bottom of the ladder is 6 ft from the wall

Answers

At the instant when the bottom of the ladder is 6 ft from the wall and sliding away at a rate of 1 ft/sec, the top of the ladder is sliding down the wall at a rate of -3/4 ft/sec.

Let's denote the distance between the top of the ladder and the ground as y and the distance between the bottom of the ladder and the wall as x. We are given that dx/dt = 1 ft/sec and want to find dy/dt when x = 6 ft.

According to the Pythagorean theorem, we have the equation

\(x^2\) + \(y^2\) = \(10^2\).

Differentiating both sides with respect to time (t), we get:

2x(dx/dt) + 2y(dy/dt) = 0.

Substituting the given values, we have:

2(6)(1) + 2y(dy/dt) = 0.

Simplifying the equation, we get:

12 + 2y(dy/dt) = 0.

Now, we can solve for dy/dt:

2y(dy/dt) = -12,

dy/dt = -6/y.

To find dy/dt when x = 6 ft, we substitute x = 6 into the equation:

dy/dt = -6/y = -6/8 = -3/4 ft/sec.

Therefore, the top of the ladder is sliding down the wall at a rate of -3/4 ft/sec when the bottom of the ladder is 6 ft from the wall.

Learn more about Pythagorean theorem here:

https://brainly.com/question/14930619

#SPJ11

Solve for j
A = 4 j k

Answers

Answer:\(a=4jk\\isolate J: divide 4 and k\\= \frac{a}{4k} =J\)

Step-by-step explanation:

Answer:

\(a = 4jk \\ akj = a \\ \frac{akj}{4k} \: = \frac{a}{ak} \\ j = \frac{a}{4k} \\ \)

Here ur ans.

By:- Utsav Xettri

Which equation best represents the linear function formed by the table?

Answers

Answer:

what table?

Step-by-step explanation:

Find the slope of the line on the graph. Write your answer as a fraction or a whole number, not a mixed number or decimal.

Find the slope of the line on the graph. Write your answer as a fraction or a whole number, not a mixed

Answers

The slope of the given graph is determined as 1/3.

What is the slope of a graph?

The slope of a line is a measure of its steepness of the graph. Mathematically, slope is calculated as rise over run or  change in y divided by change in x.

The formula is given as;

slope = Δy / Δx

where;

Δy is the change in y valuesΔx is the change in  x values

The slope of the given graph is calculated as follows;

choose the following coordinate points;

( x₁, y₁) = (-6, 0 )

( x₂, y₂) = ( 6 , 4 )

The slope = ( y₂ - y₁ ) / ( x₂ - x₁)

slope = ( 4 - 0 ) / ( 6 - - 6)

slope = ( 4 ) / ( 12)

slope = 1 / 3

Learn more about slope here: https://brainly.com/question/3493733

#SPJ1

If CD = 12, find the value of EB.

If CD = 12, find the value of EB.

Answers

Answer:

6

Step-by-step explanation:

Here, we are told to find the length of EB

Since the chords AB and CD are both 5 units(equidistant) away from the center of the circle, then we can conclude that they are both congruent and thus are equal in length

Now we use a circle theorem to solve for the length EB

The theorem is that a line that joins the center of a circle to a chord makes a perpendicular angle with the chord and splits the chord into 2 equal parts.

Now we can say that; AB = AE + EB so we split 12 into 2 which is 6 units and that is the length of EB

An engineer accident What is the combined thrust of the rocket if Stage A is firing normally, but Stage B is applying reverse (negative) thrust?

Answers

Answer:

i  think 64 for your answer

Step-by-step explanation:

hello i have a question: when youre doing mean median range and mode, if you get the number 10.33 as the mean for example, do you round it to 10.30 or 10? or keep it as 10.33?? please help ty

Answers

Answer:

It depends on the question! You should look at the other values of the data and see what they are rounded to and apply it for the mean too. If not, I normally round it to 3 significant figures.

an individual is hosting a cookout for a kick ball team. the individual wants to have 3 hot dogs for each guest, and 10 extra hot dogs in case some teammates bring friends. which variable is dependent?

Answers

The dependent variable in this case would be the total number of hot dogs needed for the cookout.

What is variable in math?

In mathematics, a variable is a symbol, usually a letter, used to represent a quantity in an equation or in a mathematical expression. It can be thought of as a placeholder that can take on different values in a given equation or expression. Variables are essential for mathematics because they allow us to explore different scenarios and solve problems.

This is dependent on the number of guests attending, which is the independent variable. Depending on how many people show up, the individual will need to adjust the amount of hot dogs to accommodate the guests.

To know more about variables click-
https://brainly.com/question/25223322
#SPJ4

The sum of two numbers is 201 and their difference is 69. Find the
numbers.

Answers

Answer:

\(let \: the \: numbers \: be \: x \: and \: y \\ then \\ \)

\(x + y = 201(equation \: 1) \\ x - y = 69(equation \: 2)\)

According to 2nd equation

\(x = 69 + y\)

Putting the value of x in the first equation

\(69 + y + y = 201 \\ \implies \: 69 + 2y = 201 \\ \implies \: 2y = 201 - 69 \\ \implies \: y = \frac{132}{2} \)

\( \implies \: y = 66\)

We know that

\(x = y + 69 \\ \implies \: x = 66 + 69 \\ \implies \: x = 135\)

If you have any doubts you can comment and ask

Answer:

135 and 66

Step-by-step explanation:

Solve the system of equations

Equation 1: x + y = 201

Equation 2: x - y = 69

9. Simplify the expression. 4x + 7y - 2 + 6y + 6y - 8x - 5 Your answer

10. Simplify the expression. 2 (5 + 3x) + (x + 10) Your answer

please help!​

Answers

Answer:

9. -4x+19y-7

10. 7x+20

Step-by-step explanation:

9. To simplify this expression, simply combine like terms. Add all of the terms with the x variable together, then the terms with the y variable, then the constant terms. I will show this step by step, but usually you do not have to show this work. The order of the terms does not matter.

x variable terms: (4x-8x)+7y-2+6y+6y-5= -4x+7y-2+6y+6y-5

y variable terms: (7y+6y+6y)-4x-2-5=19y-4x-2-5

constant terms: (-2-5)-4x+19y=-4x+19y-7

10. To simplify this expression, expand all terms and then combine like terms. The first term can be expanded by multiplying each term in the parentheses by 2.

Expand terms: 2(5+3x)+(x+10)= 10+6x+x+10

Now, you can combine like terms as done on the last problem. Note that I got rid of the parentheses in the second term, as they did not matter (since there was no term in front of them).

x variable terms: (6x+x)+10+10=7x+10+10

constant terms: (10+10)+7x=7x+20

Answer:

9 = 15x - 7    10=7x +20

Step-by-step explanation:

if you ever need any more math help

I need help.please with this math problem

I need help.please with this math problem

Answers

Oh easy just do what the formula tells you to

Write in your calculator = 4/3 x pie x 7 squared and that’s your answer

Answer:

1372 cubic centimeters

Step-by-step explanation:

V = 4/3(π)(r^3)

Exchange π for 3

4/3(3)(r^3) = ?

Exchange r for the radius, 7

4/3(3)(7^3) = ?

4/3(3)(343) = ?

4(343) = 1372

1372 cubic centimeters

Evaluate 9 ÷ 3[(18 − 6) − 2^2]. Answers A.0.188 B.0.375 C.24 D.48

Answers

Answer:

C. 24

Step-by-step explanation:

Answer:

C

Step-by-step explanation:

9 ÷ 3[12 - 4]

3[8] = 24

Example of dilation in real life?

Answers

Answer:

In order to make the building true to the prototype, they must dilate the scale and measurements. In the doctor's office. Dilation is used in eye exams so that the eye doctor can view the patient's eye better.

Step-by-step explanation:

find the expression for the function f when the differential equation is put into the form y ( n ) = f ( x , y , y ' , y ' ' , ... , y ( n − 1 ) )

Answers

F(x, y, y', y",..., y(n-1)) is the expression for the function f.

1. Rewrite the given differential equation as y (n) = f (x, y, y', y",..., y (n 1)).

2. Identify y as the dependent variable, y', y",..., y(n-1), as the derivatives of y up to order n-1. X is the independent variable.

3. The right-hand side of the equation, f(x,y,y',y",...,y(n-1)), provides the expression for the function f.f(x,y,y',y",...,y(n-1)) is the expression for the function f, where x is an independent variable, y is the dependent variable, and y', y",...,y(n-1) are y's derivatives up to order n-1. The right-hand side of the equation provides the expression for the function f when the differential equation is written as y (n) = f (x, y, y', y",..., y (n 1)). Consequently, f is a function of x, y, y', y",..., and y. (n-1). The differential equation is resolved using this expression for f.

Learn more about expression here

https://brainly.com/question/14083225

#SPJ4

A point (a,b) shown in below graph in polar coordinates is given. Convert the point to rectangular coordinates.

a = 6, b = pi/2

A point (a,b) shown in below graph in polar coordinates is given. Convert the point to rectangular coordinates.

Answers

Answer:

When converting the polar coordinates a=6, b=pi/2. the rectangular coordinates would be

C) (0,6)

−12 = 2 + 5v + 2v
help me plzzzzzzzzzzzz

Answers

Answer:

v = - 2

Step-by-step explanation:

Given

- 12 = 2 + 5v + 2v ( subtract 2 from both sides )

- 14 = 7v ( divide both sides by 7 )

- 2 = v

I need help with this problem

I need help with this problem

Answers

Square root of 121 is 11

Answer is 11

A square root of a number x is a number y such that y² = x. Or, √x = y.

Therefore the square root of 121 is:

\( \sf\sqrt{121} \\ = \sf{ \sqrt{11 \times 11} } \\ = \sf \: \: 11\)

Answer:

11

Hope you could understand.

If you have any query, feel free to ask.

i need help with this problem it says

one less than triple a number is the same as six times a number reduced by 7

15 points

Answers

Answer:

3x - 1 = 6x - 7

x = 2

Explanation and Check part below

Hope this helps :)

Step-by-step explanation:

1. To solve it, first get the variable on same side.

3x - 1 = 6x - 7

- 3x - 3x

- 1 = 3x - 7

2. Isolate the variable by doing the inverse operation which is in this case addition (adding 7).

- 1 = 3x - 7

+ 7 + 7

6 = 3x

3. Isolate variable by doing the inverse operation which is in this case division (dividing by 3).

6 = 3x

3 3

2 = x

OR

x = 2

Check:

1. Substitute x with 2 and solve.

3(2) - 1 = 6(2) - 7

6 - 1 = 12 - 7

5 = 5

True statement.

State whether the data described below are discrete or​ continuous, and explain why.
The movie ratings of a critic with possible ratings being 0 stars comma one half star comma 1 star comma and so onThe movie ratings of a critic with possible ratings being 0 stars, 1/2 star, 1 star, and so on up to 5 stars

Answers

The data described in the first statement, "The movie ratings of a critic with possible ratings being 0 stars, one-half star, 1 star, and so on," is discrete data.

Discrete data consists of distinct, separate values or categories that have gaps between them. In this case, the possible movie ratings are specifically defined as 0 stars, one-half star, 1 star, and so on. Each rating is a distinct category with no intermediate values or measurements. The ratings are not continuous and cannot take on any value within a range.

In contrast, continuous data represents measurements or values that can take on any value within a range or interval. For example, if the movie ratings were described as a continuous scale from 0 to 5 stars, where any fractional value within that range is possible, it would be considered continuous data.

Since the movie ratings in the given statement are defined as specific categories without any intermediate values, they are classified as discrete data.

Learn more about Discrete data here -: brainly.com/question/9933039

#SPJ11

help me pleaseeeeeeeeeeeeeeeeee

help me pleaseeeeeeeeeeeeeeeeee

Answers

A

this question did by quadratic formula means x = -b ± √b^ - 4ac / 2a by this formula first arrange the equation -5 x^ + 7 -2 and

a = -5

b = 7

C = -2

after that substitute in the formula


Find all second partial derivatives of the following function
at the point x_{0}; f(x, y) = x * y ^ 10 + x ^ 2 + y ^ 4; x_{0} =
(4, - 1); partial^ 2 psi partial x^ 2 = Box; partial^ 4 f partial y
part

Answers

To find the second partial derivatives of the function \(f(x, y) = x \cdot y^{10} + x^2 + y^4\) at the point \(x_0 = (4, -1)\), we need to calculate the following derivatives:

1. \(\frac{{\partial^2 f}}{{\partial x^2}}\):

Taking the partial derivative of \(f\) with respect to \(x\) once gives: \(\frac{{\partial f}}{{\partial x}} = y^{10} + 2x\). Taking the partial derivative of this result with respect to \(x\) again yields: \(\frac{{\partial^2 f}}{{\partial x^2}} = 2\).

2. \(\frac{{\partial^4 f}}{{\partial y^4}}\):

Taking the partial derivative of \(f\) with respect to \(y\) once gives: \(\frac{{\partial f}}{{\partial y}} = 10xy^9 + 4y^3\). Taking the partial derivative of this result with respect to \(y\) three more times gives: \(\frac{{\partial^4 f}}{{\partial y^4}} = 90 \cdot 10! \cdot x + 24 \cdot 4! = 90! \cdot x + 96\).

Therefore, the second partial derivative \(\frac{{\partial^2 f}}{{\partial x^2}}\) is equal to 2, and the fourth partial derivative \(\frac{{\partial^4 f}}{{\partial y^4}}\) is equal to \(90! \cdot x + 96\).

In conclusion, the second partial derivative with respect to \(x\) is a constant, while the fourth partial derivative with respect to \(y\) depends on the value of \(x\).

To know more about derivatives, visit;

https://brainly.com/question/23819325

#SPJ11

Dianes salary is $32,000 per year. Her car payments total $2,880 per year. What percentage is her salary

Answers

Answer:

9%

Step-by-step explanation:

Calculation for What percentage is her salary

Using this formula

Dianes salary percentage=Car payments per year/Salary per year

Let plug in the formula

Dianes salary percentage=$2,880 per year/$32,000 per year

Dianes salary percentage=0.09*100

Dianes salary percentage=9%

Therefore the percentage of her salary is 9%

On the blueprints of their new home, Paul and Gretha notice the balcony is 9 inches long and 4 inches wide. They know
that the actual balcony will be 11.7 ft long. How wide will the balcony be?

Answers

The wideness of the actual balcony would be = 5.2 feet.

What is a scale factor?

A scale factor is defined as the ratio between the scale of a given original object and a new object.

The actual size = scale factor × blueprint

where actual length = 9 inches

blueprint = 11.7 = 140.4 inches

scale factor = actual size/blue print

= 140.4/9 = 15.6

If the blue print width size = 4

the actual size = 4× 15.6 = 62.4 inches = 5.2 feet

Learn more about scale factor here:

https://brainly.com/question/28339205

#SPJ1

Other Questions
____ allow you to access web content or take some action based on selected webpage text. What do deal of the day website offer subscribe read the passage from hamlet, act i, scene iii. polonius: costly thy habit as thy purse can buy, but not expressd in fancy; rich, not gaudy; for the apparel oft proclaims the man, and they in france of the best rank and station are most select and generous, chief in that. which meaning of habit does shakespeare use in this passage? hy is the poem the ancient mariner important to walton? how is the stranger similar to the ancient mariner? what mood does shelley create by alluding to this poem? What is f(x)=x2-5 btw that 2 is square activists formed the populist party most directly in response to the a. growth of corporate power in agriculture and economic instability in farming. b. emergence of concerns about abuses of the environment c. development of reform movements inspired by the second great awakening. d. rise of monopolies and reduction of wages for industrial workers. 3. the ideas of the populist party, as expressed in the excerpt, had the most in common with the ideas of the a. federalists in the 1790s b. progressive movement c. whigs in the 1830s d. civil rights movement 1. Given the double-stranded stretch of DNA below, determine the base sequence ofmessenger RNA strand produced using this gene as the template. *Hint: Only one of thetwo strands is used as the template.5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'3' TACGGTAACG AATTCGCCCGTAAT ATGGTACT 5AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGAHow many amino acids will this protein contain? If 10 percent of a number equals 30, find 40 percent of that number. brainliest 4 brainliest? Polka Dot Boutique is having a sale of 15% off previously marked down items. Gwen finds a pair of jeans originally priced at $45.00 and marked down 25%. She must pay a 6% sales tax on the final prices of the jeans. How much does Gwen spend at Polka Dot Boutique? Group of answer choices If the graph of f(x) = square rootX + 3 is translated 2 units right and 4 units down, which of these functionsdescribes the transformed graph?8(x)=x-2-18(x) = 1x + 2 - 18(x) = x- 2 + 78 8(x) = 1x + 2 + 7 In the United States ____ spending is the spending component of GDP that is the most volatile (has the largest fluctuations in growth rates), and ____ spending is the largest.1. investment/government/consumption2. investment/government/consumption/net export What is an example of an imbalance of situated social power, according to stephanie coontz? Paul and anna plan to form the pa llc by the end of the current year to produce and sell specialty athletic apparel. paul and anna will both serve as member-managers of the llc and will be active in its operations. the members will each contribute $80,000 cash, and in addition, the llc will borrow $440,000 from first state bank. the $600,000 will be used to buy equipment and to lease a property they can use as a small manufacturing facility and a storefront. the bank has stated that the debt must be guaranteed, and anna has agreed to guarantee the entire amount. at the end of the year, the llc also expects to have accounts payable of $40,000 for inventory and supplies. the llc's operating agreement provides that all llc items will be allocated equally. the agreement also provides that capital accounts will be properly maintained and that each member must restore any deficit in the capital account upon the llc's liquidation. if the llc claims 100% bonus depreciation, it will report a loss of about $580,000 in its first year, which the llc members would like to deduct. paul and anna would like to know how the debt ($440,000 loan and $40,000 of accounts payable) will be allocated between them, and how that allocation affects their ability to deduct the losses. paul and anna are single individual taxpayers. consider all potential loss limitations and assume that neither paul nor anna will have business income or losses from other sources. complete the memo for the pa llc tax planning file for your manager's review that describes how the debt will be shared between paul and anna for purposes of computing the adjusted basis of each llc interest. if an amount is zero, enter "0". tax file memorandum date december 11, 2020 from jane diaz subject pa llc debt allocation facts: the pa llc will be formed before the end of the current year to manufacture specialty athletic apparel. the llc will be equally owned by paul and anna, and both parties will be managing members. it will purchase equipment and pay o Vote you brainiest please help w Dos gatitos, nada ms, haba tenido la gata de Doa Casimira Vallejo, y ya haban pedido a lacitada seora nada menos que catorce. Y es que los gatitos eran completamente negros, ysabido es que hay muchas personas que creen que aquellos traen la felicidad a las casas.De buena gana Doa Casimira no se hubiera desprendido de aquellos dos hijos de su Sultana;pero su esposo le haba declarado que no quera ms gatos en su vivienda, y la buena seoratuvo que resignarse a regalarlos el da mismo que cumplieran dos meses.Mucho tiempo estuvo pensando dnde quedaran mejor colocados; el vecino del piso bajoperda muchos gatos y no faltaba quien sospechase que se los coma; el tendero de enfrentelos dejaba salir a la calle y se los robaban; la vieja del cuarto entresuelo era muy econmica yno les daba de comer; el cura tena un perro que asustaba a los animalitos; y as, de uno enotro, result que los catorce pedidos se redujeron para Doa Casimira solamente a dos,casualmente el nmero de gatos que tena. Aun as, no acabaron sus cavilaciones.Moro, el ms hermoso y ms grave de los dos gatitos, convendra mejor a Doa Carlota, lavecina del tercero de la izquierda, que tena una hija muy juiciosa a pesar de sus cortos aos;pero Fgaro (as nombrado por el marido de Doa Casimira por haberle hallado un da jugandocon su guitarra), no estara del todo bien en casa de don Serafn, cuyos nios eran muyrevoltosos y trataban con dureza a los animales.*preguntas*cual es la importancia de la lectura?*enliste 3*cararactersticas principales de la lecturacomente una reflexion de la lectura to find the most accurate approximations to the roots of the following quadratic equations. compute the absolute errors and relative errors. a. 1/3x^2 = 123/4x+1/6 =0 Subtract.27 5/6 2/7Enter your answer as a mixed number in simplest form by filling in the boxes.PLEASE QUICK To help them operate the business, _____ accounting provides information and analysis to decision makers inside the organization. Michael drove to a friends house at a rate of 45 mph. He came back by the same route, but at a rate of 30 mph. If the round-trip took 5 hours, what is the distance michael traveled to visit his friend?.