The amniotic egg, which is present in reptiles, birds, and mammals, is a good example of: horizontal gene transfer. coevolution. homology. convergent evolution. analogy.

Answers

Answer 1

The amniotic egg, which is present in animals such as reptiles, birds, and mammals, is a good example of homo-logy.

What is homo-logy?

The term 'homo-logy' makes reference to the same evolutionary origin (ancestor) for a given structure.

A structure and/or sequence is homo-logous when it derives from the same evolutionary ancestor.

Conversely, an analogy means that the structure and/or nucleotide sequence do not share an evolutionary origin.

Learn more about homo-logies here:

https://brainly.com/question/13553174


Related Questions

when all puncta in both eyes are treated during the same encounter, the appropriate code is reported

Answers

When all puncta in both eyes are treated during the same encounter, the appropriate code is reported four times.

Repairing the lacrimal puncta, which are tiny apertures located in the inner canthus of the eyelids and are responsible for directing tears, is a technique that is performed often. In each eye, there is both an upper and a lower punctum. These are referred to as the puncta. As a result, you should submit the relevant code twice whenever both puncta in one eye are treated. According to CPT Assistant (June 1995), codes 68705 and 68760-68761 are recorded four times when all puncta in both eyes are treated. This results in a total of four puncta being treated.

EXAMPLE: Both of the patient's eyes were treated with laser surgery to close the puncta in the lacrimal gland. Please send in the following codes: 68760, 68760, and 68760.

To learn more about apertures click on the below link:

https://brainly.com/question/13972212

#SPJ4

Why is variation in populations necessary for evolution to occur? How is the variation generated?

Answers

Different traits can be introduced into an organism by genetic variations that change gene activity or protein function.

The likelihood of a genetic variation being passed down to the following generation increases if a trait is advantageous and aids the individual in surviving and procreating (a process known as natural selection).

Gene variants, also known as mutations, can cause genetic variations, or a normal process in which genetic material is rearranged as a cell prepares to divide can also cause genetic variations (known as genetic recombination). Different traits can be introduced into an organism through genetic variations that change gene activity or protein function.

Learn more about ‘ variation generated  ’ visit here;

https://brainly.com/question/15085018

#SPJ4

what is a _____ molecule this give it many unique properties

Answers

That molecule is called "DNA". It is the information that holds family history of any living species on earth and has the ability to give unique features and properties such as facial features, body features, etc.

The subangular blocky structure of the Bw1 horizon was destroyed as a result of deep tillage. How would this affect the capacity of this soil horizon to store water? Decrease It would not be affected

Answers

The capacity of the Bw1 horizon to store water would be decreased as a result of deep tillage. The subangular blocky structure of the soil plays a crucial role in water storage and movement.

The subangular blocky structure consists of aggregates with distinct boundaries that create pore spaces between them. These pore spaces allow water to infiltrate and be stored within the soil.

Deep tillage involves the disturbance of the soil by mechanical means, such as plowing or digging, to greater depths. This process disrupts the soil structure and breaks down the aggregates, leading to the destruction of the subangular blocky structure.

As a result, the pore spaces within the soil are reduced or eliminated, reducing the soil's ability to store water.

Without the subangular blocky structure, the soil becomes more compacted and dense, leading to decreased porosity and reduced water-holding capacity.

Water infiltration and drainage are also negatively impacted, as the disrupted soil structure hinders the movement of water through the soil profile. Therefore, deep tillage would decrease the capacity of the Bw1 horizon to store water.

To know more about "Deep tillage" refer here:

https://brainly.com/question/30336182#

#SPJ11

Does dna determine your traits

Answers

Answer:

yes

Explanation:

because i'm smart

The organisms that are most likely present in the largest numbers are
А
Microscopic algae
B
Herring gull
С
Crab
D
Common seals

Answers

Answer:

Microscopic algae should be the answer

What does DNA provide the code for?
A nitrogenous base pairing
B protein synthesis
C deoxyribose formation
D nucleotide synthesis
answer is protein synthesis

Answers

Answer:

protein synthesis

Explanation:

DNA provides the code for protein synthesis. This DNA code consists of the instructions needed to make proteins and molecules which are essential for our growth, development, and health.

20.
Plant and animal cells are _____ bacterial cells.

identical to

simpler than

made of

larger than

Answers

Answer:

larger than

Explanation:

Bacterial cells are very small - about 10 times smaller than most plant and animal cells

Answer:

Larger than

Explanation:

Describe the structure of large bones.

Answers

Answer:

Periosteum, Compact Bone, Spongy Bone, Bone Marrow, Articular Cartilage, Medullary Cavity

Explanation:

Periosteum: The outermost layer of a bone is called the periosteum. It is a tough, fibrous membrane that covers the bone's surface. The periosteum contains blood vessels, nerves, and connective tissue that nourish and support the bone.

Compact Bone: Beneath the periosteum lies a layer of compact bone, also known as cortical bone. Compact bone is dense and hard. It forms the main shaft or diaphysis of the long bone. Its structure consists of multiple layers of tightly packed mineralized matrix called lamellae, which contain collagen fibers. Compact bone provides strength and protection to the bone.

Spongy Bone: The interior of the bone, particularly at the ends and in the middle of long bones, contains spongy bone, also called cancellous or trabecular bone. Spongy bone has a porous, lattice-like structure composed of thin, branching bony plates called trabeculae. The spaces between the trabeculae are filled with bone marrow. Spongy bone helps reduce the weight of the bone while providing support and flexibility.

Bone Marrow: Within the spaces of spongy bone is bone marrow. There are two types of bone marrow: red marrow and yellow marrow. Red marrow is responsible for producing blood cells, including red blood cells, white blood cells, and platelets. Yellow marrow consists mainly of fat cells and serves as a storage site for adipose tissue.

Articular Cartilage: At the ends of long bones, where they articulate with other bones in joints, there is a layer of smooth, slippery cartilage called articular cartilage. It helps reduce friction and absorbs shock during movement, facilitating smooth joint motion.

Medullary Cavity: Within the diaphysis or shaft of the long bone, there is a hollow space called the medullary cavity. The medullary cavity contains bone marrow and serves as a storage site for yellow marrow.

what is a benefit of the pigments in photosynthesis

Answers

Answer:

The importance of pigment in photosynthesis is that it helps absorb the energy from light. The free electrons at the molecular level in the chemical structure of these photosynthetic pigments revolve at certain energy levels.

Explanation:

I hope it helps

Answer: Energy

Explanation:

The pigments can be used for absorption of energy through light. The pigments can also absorb different amounts of light, which can be beneficial when wanting as much energy as possible.

The phase during mitosis in which chromosomes move into the center of the cell is

prophase
anaphase
interphase
metaphase​

Answers

Answer:

Metaphase

Explanation:

Metaphase, which is the stage between Prophase and Anaphase, is when the chromosomes line up at the equator of the cell, where their centromeres are attached to the spindle.

Answer:

Metaphase

Explanation:

Metaphase, which is the stage between Prophase and Anaphase, is when the chromosomes line up at the equator of the cell, where their centromeres are attached to the spindle.

Beeswax is a waxy substance that is produced by bees and then harvested by humans for a variety of uses. Ancient Romans used beeswax as a waterproofing agent because it is not water-permeable. Beeswax is which of the following types of organic molecule?
1- carbohydrate
2- lipid
3- nucleic acid
4- protein​

Answers

Lipid is the answer

nitrogen is the most abundant elemnt in the atmosphere and acrucial c omponent of prorteisn vitams ns and nucelic acids hwoevber plants and other proerucers cannot use nirotgen in its natural form nitrogend has to undergod a process called nitrogen fixcation what does this process involve

Answers

Nitrogen fixation is the process by which atmospheric nitrogen \((N_2)\) is converted into a form that can be used by plants and other organisms.

It involves the conversion of \(N_2\) into ammonia \((NH_3)\) or nitrate \((NO_{3}^-)\) through various biological or industrial processes. The most common natural nitrogen fixation occurs through symbiotic relationships between certain bacteria and leguminous plants. These bacteria, called nitrogen-fixing bacteria, convert atmospheric nitrogen into ammonia, which can then be utilized by plants for their growth and development.

Nitrogen fixation can also occur through non-biological means such as lightning strikes and industrial processes like the Haber-Bosch process. Lightning provides enough energy to convert nitrogen gas into nitrogen oxides, which subsequently dissolve in rainwater, forming nitrates that can be absorbed by plants.

To learn more about nitrogen follow the link:

https://brainly.com/question/28916783

#SPJ4

The complete question is:

Nitrogen is the most abundant element in the atmosphere and a crucial component of proteins vitamins and nucleic acids. However, plants and other producers cannot use nitrogen in its natural form nitrogen has to undergo a process called nitrogen fixation what does this process involve?

Red maple tree seeds are dispersed by the wind. this species of tree can be found in fields, woods, and even wetlands. this is an example of a ________ distribution.

Answers

Red maple tree seeds are dispersed by wind. This is an example of Anemophilic distribution.

Maple tree seeds are lightweight They have wing like outgrowth.Maple tree have efficient seed dispersion system.The seeds descend to the ground known as Samaras.

Learn more about Anemophily here, https://brainly.com/question/13976657?referrer=searchResults

#SPJ4

As shown in the diagram, solar radiation strikes the Earth at different angles, resulting in certain areas experiencing much more solar energy per unit area per year. The differences in heat distribution create three climate zones: tropical, temperate, and polar.

1. Use the information in the diagram and the passage to describe the relationship between latitude, solar energy, and climate in the three labeled zones.

As shown in the diagram, solar radiation strikes the Earth at different angles, resulting in certain

Answers

According to the graph and the information, it can be inferred that in the equatorial zone the sun is greater and its incidence will reduce at higher latitudes (polar zones).

What is the relationship between latitude and solar energy?

The relationship between earth's latitude and solar energy is defined by the latitudinal location of a point. For example, the equatorial zones receive most of the sun's rays throughout the year, for this reason there are no seasons and, on the contrary, there are constant hot days.

In tropical areas, the sun's rays vary depending on the position of the earth with respect to the sun, so that in some seasons there is more incidence of the sun and in others there is less incidence. This gives rise to the seasons of the year.

Finally, in the polar areas the temperature is constantly cold, this is due to the fact that the angle of incidence of the sun's rays is very indirect. Due to the above, there are days in which the sunlight is not seen. In addition, the temperature is low there throughout the year.

Learn more about latitude and weather in: https://brainly.com/question/12725953

#SPJ1

Fat and ATP are different molocules that can both be described as molocules in terms of energy storage.
This is a question from flvs and the awnsers are to long to type

Answers

That’s cool lol I need points

Choose all the answers that apply.
All cells

reproduce
have a cell membrane
have a membrane-bound nucleus
break down food into energy
contain hereditary information

Answers

Answer:

reproduce

Explanation:

cells reproduce

An environmental impact refers to a change in the habitat and living conditions in ecosystems for plant and animal species. Which of the following
describes an environmental impact of using direct seeding mulch-based cropping (DMC) instead of traditional agricultural methods?
A. Reduced labor costs
B. Increased amount of food source
C. Stimulated biological activity in soils
D. Less equipment needed to farm

Answers

The statement that describes an environmental impact of using direct seeding mulch-based cropping instead of traditional agricultural methods is that there is reduced labor costs.

What is direct seeding mulch-based cropping (DMC)?

The direct seeding mulch-based cropping is one of the agro-ecology strategies to improve agricultural practices.

Prior to the implementation of DMC, traditional approach of agriculture has been used. This has been labor-intensive i.e. uses a lot a labor.

Therefore, the statement that describes an environmental impact of using direct seeding mulch-based cropping (DMC) instead of traditional agricultural methods is that there is reduced labor costs.

Learn more about DMC at: https://brainly.com/question/3632132

If the Watson strand for a double stranded DNA is 5’ ATGGTCATGGGTTCCAATGCA 3’, what is the sequence of the Crick strand?

Answers

The sequence of the Crick strand can be determined by using the complementary base pairing rules of DNA. The Watson strand is read in the 5' to 3' direction, so the complementary Crick strand will be read in the 3' to 5' direction.

The complementary base pairs are:
- Adenine (A) pairs with Thymine (T)
- Guanine (G) pairs with Cytosine (C)

Starting from the 3' end of the Watson strand, we can write the sequence of the Crick strand:

3’ TACCATGTACCCAGGTTACGT 5’

Therefore, the sequence of the Crick strand is 3’ TACCATGTACCCAGGTTACGT 5’.
Hi! To find the sequence of the Crick strand for a double-stranded DNA with a given Watson strand of 5' ATGGTCATGGGTTCCAATGCA 3', you need to understand the base pairing rules for DNA. In DNA, adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C).

Your Watson strand: 5' ATGGTCATGGGTTCCAATGCA 3'

Step 1: Determine the complementary base pairs for each base in the Watson strand.
A pairs with T
T pairs with A
G pairs with C
C pairs with G

Step 2: Replace each base in the Watson strand with its complementary base pair.
TACCATGTCCCAAGGTTACGT

Step 3: Write the Crick strand in the 5' to 3' direction.
5' TACCATGTCCCAAGGTTACGT 3'

The sequence of the Crick strand for the given double-stranded DNA is 5' TACCATGTCCCAAGGTTACGT 3'.

The Crick strand for the given Watson strand (5' ATGGTCATGGGTTCCAATGCA 3') can be determined by using complementary base pairing rules. The Crick strand sequence is: 3' TACCAGTACCCAAAGGTTACG 5'

The Watson and Crick strands of double stranded DNA run antiparallel to each other, meaning that they run in opposite directions. The Watson strand runs from 5' to 3' and the Crick strand runs from 3' to 5'. Therefore, to determine the sequence of the Crick strand, we need to first reverse the direction of the Watson strand.
The reverse of the Watson strand would be 3' TACCGTACCCCAAGGTTACGT 5'. To determine the sequence of the Crick strand, we need to find the complementary base pairs for each nucleotide on the reverse of the Watson strand. Adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C). Therefore, the sequence of the Crick strand would be:
3' TACCGTACCCCAAGGTTACGT 5' (reverse of Watson strand)
    |||||||||||||||||||
5' ATGCAGTACCCAGGTTACGTA 3' (Crick strand)

To know more about strand visit :-

https://brainly.com/question/30641440

#SPJ11


• Identify the independent variable in this experiment
IV:
• Identify the dependent variable in this experiment
DV:
• Who had the highest heart rate at the end of the experiment?
Test subject:

 Identify the independent variable in this experimentIV: Identify the dependent variable in this experimentDV:

Answers

Answer:

Exerise time- IV  Heart Rate- DV

Explanation:

The epiglottis acts as another set of vocal folds. You can vibrate it to make sound. True or False

Answers

The statement "The epiglottis acts as another set of vocal folds. You can vibrate it to make sound" is FALSE.

The epiglottis does not act as another set of vocal folds and cannot be vibrated to produce sound. The epiglottis is a flap-like structure located at the base of the tongue, above the larynx. Its main function is to prevent food and liquids from entering the airway during swallowing. When we swallow, the epiglottis folds over the opening of the larynx, directing the food or liquid towards the esophagus.

Sound production, on the other hand, involves the vocal folds within the larynx. The vocal folds, also known as vocal cords, are two folds of mucous membrane that can vibrate and produce sound when air passes through them. These vibrations are then shaped and modulated by other structures in the throat, mouth, and nasal cavity to produce speech and various vocal sounds.

Therefore, the epiglottis is not involved in sound production, and it does not contribute to creating vibrations for making sound. Its role is solely focused on protecting the airway during swallowing.

To know more about Epiglottis here:

https://brainly.com/question/13252472

#SPJ11

why do points on earth travel at different speeds?

why do points on earth travel at different speeds?

Answers

Answer:

b

Explanation:

Being poisonous, spicy, or tasty are different ways plants can protect themselves or help their seeds spread. What's another internal structure that helps a plant to survive?

Being poisonous, spicy, or tasty are different ways plants can protect themselves or help their seeds

Answers

Another internal structure that helps a plant to survive is the xylem to suck up water. The correct option is B.

What are adaptations for survival?

Adaptations are structures or features that an organism such as a plant or animal has that help it survives in a specific environment.

There are several forms of adaptation such as:

Structural AdaptationsBehavioral AdaptationPhysiological AdaptationsCoadaptation.

For example, being poisonous, spicy, or tasty are different ways plants can protect themselves or help their seeds spread.

Learn more about adaptations at: https://brainly.com/question/29594

#SPJ1

scientists estimate that whaling activity in the 19th and early 20th centuries had reduced the number of adult female southern right whales to as few as sixty individuals by 1920. this reduction resulted in a genetic bottleneck for the species. treaties to stop whaling have substantially increased the number of southern right whales. despite this increase, the bottleneck still threatens the future of the species. which capacity of the species is most severely diminished by the bottleneck?
a. acquiring random mutations
b. responding to environmental changes
c. maintaining a healthy social structure
d. remaining genetically stable.

Answers

The capacity of the southern right whale species that is most severely diminished by the bottleneck is the ability to remain genetically stable and maintain a diverse gene pool.

A genetic bottleneck is a reduction in the size of a population that leads to a loss of genetic diversity. This can occur due to a number of factors, including natural disasters, disease outbreaks, or human activities such as hunting or habitat destruction. In the case of the southern right whales, the population was severely reduced by whaling activity in the 19th and early 20th centuries, leading to a genetic bottleneck. The capacity of the species that is most severely diminished by the bottleneck is the ability to maintain a diverse gene pool, which is necessary for the species to adapt to changing environmental conditions and respond to new challenges. When a population experiences a genetic bottleneck, the number of different genes available for selection is reduced, leading to a loss of genetic diversity. This can make it more difficult for the population to adapt to new challenges and can increase the risk of extinction.

To know more about population

https://brainly.com/question/27991860

#SPJ4

Veins have valves to prevent the backflow of blood because the blood in veins flow ________.
A at a low pressure
B at a high pressure
C at a neutral pressure
D at atmospheric pressure

Answers

Veins have valves to prevent the backflow of blood because the blood in veins flows at a low pressure.

The correct answer is A) at a low pressure. Veins are blood vessels that carry deoxygenated blood back to the heart. Unlike arteries, which carry oxygenated blood away from the heart under higher pressure, veins experience lower pressure due to the distance from the heart and the resistance encountered in the peripheral circulation.

Veins have valves located at intervals along their length, particularly in the limbs, to ensure the one-way flow of blood toward the heart. These valves open when blood flows toward the heart and close to prevent the backflow of blood. The low pressure in veins makes them more susceptible to backflow, especially when influenced by factors such as gravity or muscular contractions.

By closing the valves, the blood is directed toward the heart, preventing retrograde flow and enhancing the efficiency of venous return. This mechanism helps maintain the proper circulation of blood throughout the body, allowing for effective oxygenation and nutrient delivery.

To learn more about low pressure click here : brainly.com/question/32237753

# SPJ11

1. What is meant by adaptive evolution?

Answers

Explanation:

changes in an organism that make it suitable to its habitat

At the end of Chapter 5, Berck and Helfand find compensating variation (CV) and equivalent variation (EV) for wolves in Yellowstone Park - a publicly provided good. Assume wolves are a good to the individual whose preferences we are modeling, i.e., the individual wants more wolves in the wild, all else equal. Suppose there exists 5 wolves in Yellowstone Park, and the average individual has income of \$y. The individual's consumption bundle is A, and the initial indifference curve is I0. Suppose an environmental group provides funds for habitat, and it's expected this habitat will result in 5 more wolves in Yellowstone. Assume the individual's income stays the same. The new consumption bundle is B, and the new indifference curve is I'. Complete the following tasks all on one graph. A. Using our properties of indifference curves (i.e., make them crescent shaped), plot the initial bundle (A) and label with appropriate income and wolf count. Draw the initial indifference curve (I
0

). Be sure to label the graph completely. (Hint: Easiest to place a composite good on the vertical axis, wolf count on the horizontal axis) ( 2 pts) B. Draw the new indifference curve and identify the new consumption bundle (B) while labeling with the appropriate wolf count. ( 2 pts) C. Identify the theoretical consumption bundle (call it C ), that uses the original wolf count but lies on the new indifference curve I'. (2 pts) D. Label the area on the on the vertical axis that corresponds to the EV and CV of these changes. Then in the margins, define CV and EV as it relates to this specific problem

Answers

The initial bundle (A) is represented by the consumption combination (A, I0) with an income of y. Consumer surplus and compensating variation are both concepts in microeconomics that relate to the study of consumer behavior.

The initial indifference curve (I0) is a curved line that slopes upward to the right, indicating that as the individual consumes more of the good, their preference for that good increases, but their preference for the other good remains constant.

The new indifference curve (I') is a curved line that slopes upward to the right, indicating that as the individual consumes more of the good, their preference for that good increases, but their preference for the other good remains constant.

The new indifference curve (I') is plotted on the any type of graph as a curved line starting from the origin, with the vertical axis representing wolf count and the horizontal axis representing income.

Learn more about consumption Visit: brainly.com/question/30155938

#SPJ11

Correct Question:

At the end of Chapter 5, Berck and Helfand find compensating variation (CV) and equivalent variation (EV) for wolves in Yellowstone Park - a publicly provided good. Assume wolves are a good to the individual whose preferences we are modeling, i.e., the individual wants more wolves in the wild, all else equal. Suppose there exists 5 wolves in Yellowstone Park, and the average individual has income of y. The individual's consumption bundle is A, and the initial indifference curve is I0. What is the difference between consumer surplus and compensating variation?

The genetic code is carried ____ molecule in most organisms.
chromosomal
DNA
Guanine
hereditary​

Answers

the answer is DNA :) !!

A 0.25 m2 quadrat was placed in a 50 m2 field. 22 daisy plants were counted under the quadrat. What is the estimated number of daisies in the field?

Answers

If we assume that the distribution of daisy plants in the field is uniform, we can use the following formula to estimate the total number of daisies in the field:

Total number of daisies in the field =

(Number of daisies in the quadrat / Area of the quadrat) x Area of the field

Plugging in the given values, we get:

Total number of daisies in the field = (22 / 0.25) x 50

Total number of daisies in the field = 8.8 x 50

Total number of daisies in the field = 440

Therefore, the estimated number of daisies in the field is 440.

Learn more about quadrat:

https://brainly.com/question/31308853

#SPJ11

7. Cassie is writing an equation to show the effect of the gravitational pull of the Sun and the Moon on tidal range. Which equation would Cassie use to show the effect of the
Sun and the Moon on spring tides?

a. Earth-Moon = spring tides

b. Moon-Sun = spring tides

c. Sun + Earth = spring tides

d. Sun+ Moon = spring tides

Answers

The equation that Cassie would use to show the effect of the sun and the moon on spring tides would be Sun + Moon = spring tides

Effects of the sun and the moon on spring tides

Spring tides occur when the gravitational forces of the Sun and Moon combine, causing a greater tidal range.

Therefore, Cassie would use an equation that shows the effect of the gravitational pull of both the Sun and Moon, which is represented by the equation Sun + Moon = spring tides.

More on sun and moon spring tides can be found here: https://brainly.com/question/15141841

#SPJ1

Other Questions
What was considered Alexander the Greats greatest victory? Why was it considered so impressive? Which army did he defeat? 12+1+1 1/2+1/8=?? To find the area of the family room True or FalseSPAC is also referred to as a blank check company Sarah uses 1/4 cup of cookie dough to make 6 cookies. Use a number line to find the fraction of a cup used for each cookie. 4. you amplified a segment of your own mitochondrial dna. do you expect the sequences of your pcr product vary from those of your classmates? why or why not Beginning at the equator and heading toward either the north or south pole, which pattern of biomes is correct? The sum of three numbers is 90. The third number is 10 less than the first. The second number is 3 times the third. What are the numbers? What is data analysis in data life cycle? Here are two relations: "is married to" and "is not married to." Supposing the universe is the set of all living human beings, which of these is... (a) reflexive (b) irreflexive (c) symmetric (d) asymmetric (e) antisymmetric 234% as a simplifed fraction Polymetrics can help a person maintain cardiorespitory fitness T or F Smoking in a social situation to fit in, even though you don't want to, is an example of __________. which event most likely would occur in story set in the mountains A company profit of $20,000 decreases by 13.4% each year. Ebony earned scores of 71 , 70, 87, 97 , and 82 on five math tests. Determine herscore on the sixth test if her average for the six tests was 83? Enter your answer as awhole number Question 2 of 30Would you use addition or subtraction to eliminate the variable that is easiestto eliminate in this system of equations?-2x = 4y+72x = 3y + 10Answer hereSUBMIT ifyou could please help me solve for fx, fy, fx (-2,5) fy (2,-5)2 For the function f(x,y)=x5xy, find fx, fy, fx(-2,5), and f,(2,-5). e 11 NEED DONE ASAP WORTH 50 POINTS, DONT WORRY ABOUT VOCAB PART JUST WRITE SOMETHING PLS PLS PLSWrite the final draft of your informative description paragraph. You may copy and paste the accented and special characters from this list if needed: , , , , , , , , , , , , , , Your final draft should be written in complete sentences in Spanish and include the following requirements: (30 points)tener + que + infinitive to show the first thing your neighbor must do to get to the final destinationan affirmative t command to show your neighbor where to stopa negative t command to guide your neighbor where not to goestar + preposition to give the specific location of the final destinationvocabulary words and expressions to describe the road signs, traffic signals, and places your neighbor will seeacabar + de + infinitive to tell your neighbor he just arrived at his final destination POINTS 50 - 30!!! in my bio to find some of my unanswered questionsalso this is 10 points so good luck What criteria can you use to show these two triangles are congruent?AASSASASANot congruent