True. The statement "People with more shared SINEs are likely more closely related than those that share fewer SINEs" is True.
Explanation:Short Interspersed Nuclear Elements (SINEs) are a group of repeated sequences of nucleotides that are interspersed throughout the genome. These SINEs are used as molecular markers because they differ in number and location among individuals or species, but they are very similar within individuals or species.SINEs are used as a tool in population genetics because they show that people with more shared SINEs are likely to be more closely related than those who share fewer SINEs, as they are used to determine how closely related two individuals or groups are.
As we know, humans share approximately 99.9% of their DNA sequence. This implies that any two random human genomes will be almost identical, with less than 0.1% of their DNA sequence differing. Thus, the answer is ".1%."The genomic differences between humans, however, are not distributed evenly throughout the genome. Furthermore, a significant number of these differences are located in regulatory regions that influence gene expression or protein function, resulting in significant phenotypic variability.
To know more about SINEs visit:
A certain organism has a diploid number of 10. Using this number, indicate the number of chromosomes that would be present in each cell at the end of the indicated stage in mitosis. Interphase Prophase Metaphase Anaphase Telophase
In a certain organism with a diploid number of 10, the number of chromosomes present in each cell at different stages of mitosis would be as follows:
Interphase: During interphase, which is the resting phase of the cell cycle, the chromosomes are not condensed and appear as long, thin threads. The number of chromosomes remains the same as the diploid number, which is 10 in this case.
Prophase: Prophase is the stage where chromosomes condense and become visible. Each chromosome consists of two sister chromatids held together by a centromere. Therefore, the number of visible individual chromosomes would be twice the diploid number. So, in this case, there would be 20 chromosomes present in each cell during prophase.
Metaphase: In metaphase, the chromosomes align along the equatorial plane of the cell. Again, each chromosome consists of two sister chromatids. Therefore, the number of visible individual chromosomes would still be twice the diploid number. So, there would be 20 chromosomes present in each cell during metaphase.
Anaphase: Anaphase is the stage where the sister chromatids separate and move towards opposite poles of the cell. Each chromatid is considered a separate chromosome. So, the number of chromosomes would be twice the diploid number. Thus, there would be 20 chromosomes present in each cell during anaphase.
Telophase: Telophase is the final stage of mitosis where the separated chromosomes reach the poles of the cell and decondense. Each chromosome still consists of two sister chromatids. Therefore, the number of visible individual chromosomes would still be twice the diploid number. So, there would be 20 chromosomes present in each cell during telophase. It's important to note that these numbers represent the visible individual chromosomes and not the number of chromatids or DNA molecules.
To know more about chromosomes visit:
https://brainly.com/question/32019468
#SPJ11
1. What is the primary organ used in the nervous system?*
A.Brain
B.Heart
C.Kidney
D.Skin
Answer:
A. Brain
Explanation:
Answer:
i would have to say A. Brain
Explanation:
because it is the only organ shown in the questions that is associated with the nervous system
The tactile sensitivity of a body part is _____ related to the size of the _____ cortex devoted to processing its sensations.
Answer:
1) Directly
2) Somatosensory
Explanation:
The tactile sensitivity of a body part is directly related to the size of the somatosensory cortex devoted to processing its sensations.
Let me know if I helped :)
A tick lives on a dog by biting into its skin and drinking the blood. The tick gains nutrients from the blood and also sometimes passes on diseases to the dog. The dog loses blood and sometimes gets a disease. What type of symbiosis is this considered?
Informational Writing-Write a strong Table of Contents
Answer:
to write a table of contents you will need to list your chapters from first to last.
Explanation:
if you have a table of contents you need to write, you can list your chapters and the page numbers in the comments and I can type it up for you.
use what you know about the bcl-2 family of genes (which includes the ced-9 gene in c. elegans) to predict the outcomes of the situations described below. select the three correct statements. view available hint(s)for part c use what you know about the bcl-2 family of genes (which includes the ced-9 gene in c. elegans) to predict the outcomes of the situations described the three correct statements. in humans with follicular lymphoma, a potential therapeutic would be to increase the expression of bcl-2 in the cancerous cells. in human cells, underexpression of bcl-2 is associated with uncontrolled cell growth that leads to a type of cancer called follicular lymphoma. in humans, cells that express high levels of bcl-2 are more susceptible to apoptosis. in human cell lines, scientists can manipulate the cells to force the expression of bcl-2 to prevent apoptosis. in humans, cells that express high levels of bcl-2 are less likely to undergo apoptosis. in c. elegans, overexpression of ced-9 during embryonic development leads to the survival of cells that would normally undergo apoptosis.
The correct statements regarding the outcomes predicted by the Bcl-2 family of genes are as follows:
1. In humans with follicular lymphoma, a potential therapeutic strategy would be to increase the expression of Bcl-2 in the cancerous cells.
2. In humans, cells that express high levels of Bcl-2 are less likely to undergo apoptosis.
3. In C. elegans, overexpression of ced-9 during embryonic development leads to the survival of cells that would normally undergo apoptosis.
The Bcl-2 family of genes, including the ced-9 gene in C. elegans, plays a crucial role in regulating programmed cell death, or apoptosis. The correct statements reflect the known functions and effects of Bcl-2 in different contexts.
Follicular lymphoma, a type of cancer, is characterized by the abnormal growth of B-cells. In humans, underexpression of Bcl-2 is associated with uncontrolled cell growth that leads to follicular lymphoma.
Thus, increasing the expression of Bcl-2 in cancerous cells could potentially be a therapeutic approach to promote apoptosis and inhibit the uncontrolled growth of these cells.
High levels of Bcl-2 expression in human cells are known to confer protection against apoptosis. Apoptosis is a natural process of cell death that helps maintain tissue homeostasis and eliminate damaged or unwanted cells.
Cells with elevated levels of Bcl-2 are less likely to undergo apoptosis, which can have implications in various cellular processes, including cancer development.
In the nematode C. elegans, overexpression of the ced-9 gene (which is a member of the Bcl-2 family) during embryonic development leads to the survival of cells that would typically undergo apoptosis.
This suggests that the ced-9 gene acts as a key regulator in determining cell survival or death during the nematode's development.
Understanding the functions and effects of Bcl-2 and related genes provides valuable insights into cellular processes, including apoptosis and cancer development.
The manipulation of Bcl-2 expression levels holds potential for therapeutic interventions in certain diseases, while also shedding light on fundamental mechanisms of cell survival and death.
To know more about Apoptosis here: https://brainly.com/question/22264931
#SPJ11
A person suffers a stroke that affects the base of the anterior cerebral artery. This will likely result in reduced blood flow to the:
The person suffering from a stroke that affects the base of the anterior cerebral artery is likely to experience reduced blood flow to the frontal lobes of the brain.
The anterior cerebral artery (ACA) is responsible for supplying oxygenated blood to the medial and superior parts of the frontal lobes, which are located at the front of the brain. The frontal lobes play a critical role in various cognitive functions, including motor control, decision-making, personality, and judgment.
When a stroke affects the base of the anterior cerebral artery, it can lead to a blockage or reduced blood flow in this area. As a result, the frontal lobes may be deprived of oxygen and nutrients, leading to impaired function. Symptoms of reduced blood flow to the frontal lobes can include weakness or paralysis on one side of the body, difficulties with speech and language, changes in personality or behavior, and problems with decision-making and problem-solving.
Immediate medical attention is crucial in the case of a stroke to minimize the damage and optimize chances of recovery. Rehabilitation and therapy may be required to regain lost functions and improve quality of life.
learn more about anterior cerebral artery here:
https://brainly.com/question/30762177
#SPJ11
do crocdiles lay eggs
Answer:
Yes, crocodiles lay eggs
Explanation:
3. Algae makes energy-rich carbon compounds through
photosynthesis.
4. A volcano erupts.
5. Carbon dioxide dissolves in rainwater.
<
6. Humans use gasoline to power their cars.
7. Organisms carry out cellular respiration to release
energy from food molecules.
Check Answer
A complementary process in nature either adds (options 3, 6, and 7) or removes ( options 4 and 5) carbon dioxide from the atmosphere.
Complementary processes and it's benefitsThe processes that leads to the addition of carbondioxide back to the atmosphere include the following:
The eruption of volcanoes.Cellular respiration carried out by organisms to release energy from food molecules.The use of gasoline to power carsThe processes that leads to the removal of carbondioxide from the atmosphere include:
The production of energy-rich carbon compounds through photosynthesis.The dissolution of carbondioxide in rainwater.Learn more about photosynthesis here:
https://brainly.com/question/19160081
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?
a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.
A group of students designed an experiment in an ice rink to represent the solar system. The steps of the experiment are listed below.
1. Choose a student to represent the sun. The planets are represented by two tennis balls.
2. Ask the student to hold the tennis balls in each palm and spin on the ice with arms stretched out.
3. Ask the student to draw in the arms after about 10 spins.
4. Observe the student’s arms rotate faster when they are closer to the body.
The experiment most likely demonstrates that
A. Planets exert gravitational force on the sun.
B. The sun exerts gravitational force on the planets.
C. Speed of a planet depends on its distance from the sun.
D. Speed of Earth depends on its distance from other planets.
I’m suspecting C, but I don’t know.
Answer:
You're right the answer is C
Explanation: Hope this helps:)
Answer:
Definitley C!
Explanation:
The other answer was right thank you!
Natural selection, mutation, genetic drift, nonrandom mating, and gene flow are all mechanisms of ______ and can change allele frequencies in populations.
They are all mechanisms of Evolution and can change allele frequencies in populations
Natural selection, mutation, genetic drift and gene flow are all capable of causing varying changes in allele frequencies in a population. and these changes leads to the violation of Hardy-Weinberg assumptions
Hardy-Weinberg assumption states that; for a population to experience an unchanged allele frequencies, certain conditions must be met by the population such as ; absence of natural, random mating , absence of migration and absence of mutation.
Hence we can conclude that Natural selection , mutation, genetic drift and gene flow are all mechanisms of Evolution and can change allele frequencies in populations
Learn more : https://brainly.com/question/20938537
Which class of macromolecules is not organized in repeating units of monomers? proteins lipids nucleic acids carbohydrates
Answer:
lipids
Explanation:
Answer:
lipids
Explanation:
macromolecules are large molecules that are formed by the joining of smaller units. Lipids fit that description, but they aren't polymers because they are made up of smaller units of different kinds (like glycerol and fatty acids) rather than monomers that repeat themselves
Which answer shows the correct arrangement of terms from smallest to largest?
The correct answer is organism, ecosystem, biome, and biosphere.
An ecosystem is a complex network of living organisms and their interactions with each other and their physical environment. It encompasses both the biotic (living) and abiotic (non-living) components that coexist and influence one another within a specific area. Organisms within an ecosystem rely on each other for survival, forming intricate food webs and nutrient cycles.
The abiotic factors, such as sunlight, temperature, water, and soil, provide the necessary resources and conditions for life. Ecosystems can range from small-scale, like a pond, to large-scale, like a forest or a coral reef. They play a crucial role in maintaining ecological balance, supporting biodiversity, and providing vital services such as air and water purification, carbon sequestration, and climate regulation.
Therefore, the correct answer is organism, ecosystem, biome, and biosphere.
For mored details regarding the ecosystem, visit:
https://brainly.com/question/31861714
#SPJ1
In pea plants, long stems are dominant to short stems, purple flowers are dominant to white, and round seeds are dominant to wrinkled. each trait is determined by a single, different gene. a plant that is heterozygous at all three loci is self-crossed, and 2048 progeny are examined. how many of these plants would you expect to be long stemmed with purple flowers, producing wrinkled seeds
You might anticipate that 864 of all these plants have long stems, purple flowers, and produce seeds with wrinkles.
Which definition of plants is the most accurate?A living item with a stem, leaves, & roots that develops in the soil is called a plant. ... exotic plants, water each bush as often as necessary. Synonyms include flower, shrub, veggie, and herb. other words for plant
The significance of plantsLife could not be possible on Earth without plants. Basic human requirements including food, clothing, shelter, or medicine are all met by plants for people. Because of rising affluence, urbanization, and global population growth, these fundamental human needs are currently expanding quickly.
To know more about plants visit:
https://brainly.com/question/13976657
#SPJ4
What is the purpose of a root hair and what helps it carry out its function?
Answer:
Explanation:
Root hair helps in absorption and this is enhanced by its large surface area. Water moves from the soil water to the root hair cytoplasm through osmosis. This is because osmosis allows for movement from a region of higher concentration which is the soil water to the region of low concentration which is root hair cell cytoplasm.
Root hairs absorbs water and mineral nutrients that are available in the soil and taking it up through the roots to the rest of the remaining part of the plants. Absorption is possible because of the large surface area the root air has.
When you see someone you have a crush on and your heart pounds, your hands get sweaty, and your cheeks feel hot, your __________ nervous system is active
Answer:
central nervous system
Explanation:
Develop a model to illustrate the role of photosynthesis and cellular respiration in the cycling of carbon among the biosphere, atmosphere, hydrosphere, and geosphere.
The Carbon cycle model illustrates the role of photosynthesis and cellular respiration in the cycling of carbon among the biosphere, atmosphere, hydrosphere, and geosphere.
Carbon cycle is the process in which carbon compounds are interchangeable between biosphere, atmosphere, hydrosphere, and geosphere. The steps of the carbon cycle are as follows,
1. Plants absorb the carbon found in the atmosphere for the process of photosynthesis.
2. Animals consume or eat the same plants and the carbon gets bioaccumulated in the bodies of the animals or we can say that it gets accumulated in the biosphere.
3. Both animals and plants die over time and through decomposition of their remains, carbon is given back into the atmosphere.
4. The carbon which is not released into the atmosphere through decomposition becomes fossil fuel in the geosphere.
5. The fossil fuels are useful for various man-made activities, which eventually gives the carbon back into the atmosphere.
6. There is also exchange of carbon between the ocean or the hydrosphere and the air with the help of phytoplankton.
To learn more about carbon cycle,
https://brainly.com/question/30633292
#SPJ1
Are the proteins of one specialized cell made in specialized cells of a different type?
Yes; The proteins of One specialized cell are made in specialized cells of a different type.
A cell that is specialised has particular features that enable it to perform its specific function in the body.
All cells begin as stem cells, which can differentiate into a wide variety of other cell types. To become specialised, they go through a process known as differentiation.
Diverse environmental factors influence how the cell makes proteins during differentiation.
Through gene regulation, individual genes can be activated or inactivated, which results in the production of unique proteins that give cells their structure and function.
Protein translocation: At this stage, protein synthesis is stopped, allowing fully produced proteins to be released into the cytoplasm. Then, in order for these proteins to act by a certain type of mechanism, they are directed to various places.
To know more about Protein synthesis refer to:
https://brainly.com/question/18800216
Slit-like structures found beneath the cap of a typical mushroom are known as
A. Volva B. Gills C.Pileus D.Annulus
Answer:
B
Explanation:
Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as:
Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as homeostatic mechanisms.
Homeostasis is the body's ability to maintain a stable internal environment despite external changes.
In the context of the brain, homeostatic mechanisms involve various processes that regulate physiological functions and maintain optimal levels of essential substances.
These mechanisms can include feedback loops that detect imbalances and initiate corrective actions.
For example, if there is a deficiency in a particular nutrient or hormone, the brain may activate mechanisms to increase its production, decrease its consumption, or enhance its absorption from the environment.
Homeostatic mechanisms play a crucial role in ensuring the body's overall stability and functioning, helping to maintain proper levels of various substances and promoting overall well-being.
To know more about Homeostasis, refer here:
https://brainly.com/question/15647743#
#SPJ11
the bottom question I'm stuck on, please help me
Pedigrees are representations of families hystories used to determine inheritance patterns and genotypic and phenotypic probabilities. 12) 1 dominant allele is needed to express the dominant trait. 13) Yes, it is possible to know the genotypes in the third generation. Shapes should be shaded.
What is a pedigree?
A Pedigree is the representation of a family's history. This graph is used to track a trait through different generations, and analyze the inheritance pattern of a particular gene and its expression.
It is a tool used to understand how genes are transmitted from the parental generation to the descendants, and what are the probabilities of inheriting them.
In the exposed example, we know an autosomal gene is involved. The dominant allele codes for peak hairline while the recessive allele does not express the peak.
Assuming complete dominance, the presence of only one dominant allele is enought to express the dominant trait.
12) Only 1 dominant allele is needed to express the dominant trait.
13) Yes, it is possible to know the genotypes in the third generation.
Genotypes are provided for generations I (grandparents) and II (parents). We know that
individual II1 ⇒ father ⇒ is hh (no hair peak) individual II2 ⇒ mother ⇒ is HH (hair peak)So the cross is between an homozygous dominant (mother) with an homozygous recessive (father). All children are expected to be heterozygous, since the mother can only transmit dominant alleles and the father can only transmit recessive alleles.
Since all children carry one dominant allele, they express the peak hairline (dominant trait), so their shapes should be shaded.
You can learn more about pedigrees at
https://brainly.com/question/19516649
#SPJ1
What choices did the farmers have regarding the Dust Bowl? What issues/elements were out of their control? What impact do you think the Migrant Mother photo had in the public’s perceptions about the plight of the farmer? What was it about the photograph that made it the Depression’s most enduring image?
During the Dust Bowl, farmers faced several choices, but many of them were limited by circumstances outside of their control.
What was the Dust Bowl?One option was to continue farming, despite the severe drought, high winds, and blowing dust. This was often difficult, as the soil was depleted of nutrients and water, and crops failed to grow. Another option was to leave their farms and try to find work elsewhere.
Some farmers chose to sell their land and equipment and move to other parts of the country in search of jobs. Others stayed put, hoping that the weather would improve and that they would be able to resume farming.
Learn more about dust bowl on
https://brainly.com/question/13820169
#SPJ4
Describe the different morphological types of viruses and give examples of each type:
a. Helical
b. Icosahedral
c. Complex
2. Compare and contrast the multiplication of bacteriophages versus the multiplication of animal viruses:
3. Describe how arthropods can act as mechanical vectors and biological vectors:
4. Describe five (5) characteristics of fungi and how they differ from othermicroorganisms: 5. Describe common characteristic of protozoans (protists). Name three (3) protozoans that are human parasites:
6. What are helminths? Name and describe three (3) that can cause problems in humans
Bacteriophages multiply within bacterial cells through the lytic or lysogenic cycle, while animal viruses typically use the steps of attachment, penetration, uncoating, replication, assembly, and release.
Helical viruses have a coiled or spiral-shaped capsid, such as the tobacco mosaic virus. Icosahedral viruses have a symmetrical icosahedral-shaped capsid, like the adenovirus. Complex viruses have a combination of both helical and icosahedral components, such as bacteriophages.
Bacteriophages multiply within bacterial cells through the lytic or lysogenic cycle, while animal viruses typically use the steps of attachment, penetration, uncoating, replication, assembly, and release.
Arthropods can act as mechanical vectors by carrying pathogens on their bodies or in their mouthparts, transmitting them to humans through physical contact. They can also act as biological vectors by harboring and transmitting pathogens within their bodies, such as mosquitoes transmitting malaria parasites.
Fungi are eukaryotic organisms characterized by their filamentous structure (hyphae) and reproduction through spores. They differ from other microorganisms in their mode of nutrition (absorptive), cell wall composition (chitin), mode of reproduction (asexual and sexual), growth at low pH, and preference for organic substrates.
Protozoans are single-celled eukaryotic organisms classified under the kingdom Protista. They exhibit characteristics such as being unicellular, heterotrophic, motile (using cilia, flagella, or pseudopods), and capable of reproduction through binary fission or sexual processes. Examples of human parasites include Plasmodium (causing malaria), Giardia lamblia (causing giardiasis), and Trichomonas vaginalis (causing trichomoniasis).
Helminths are parasitic worms that infect humans. Three examples of helminths that can cause problems in humans are Ascaris lumbricoides (roundworm), Taenia solium (pork tapeworm), and Schistosoma mansoni (blood fluke). These helminths can cause diseases such as ascariasis, taeniasis/cysticercosis, and schistosomiasis, respectively. They have complex life cycles involving different developmental stages and can infect various organs or systems in the human body.
Learn more about pathogens visit:
brainly.com/question/30591454
#SPJ11
Which statement correctly describes the flow of energy in a food web?
A.All organisms gain their energy from decomposers
B.Producers gain their energy from consumers
C.Energy from producers flows into multiple levels of consumers
D.All organisms receive an even amount of energy
Drag each label to the current location on the table.
Sort the descriptions or examples into inherited or somatic mutations
Exists in all the cells of the body
Skin cancer caused by UV exposure
Not passed onto offspring
Transferred via egg and sperm cells
Found only in a specific cell type.
Help!! This is worth a lot of points!
Sort the descriptions or examples into inherited or somatic mutations. inherited: Exists in all the cells of the body. inherited: Transferred via egg and sperm cells somatic mutations, Found only in a specific cell type. somatic mutations: Skin cancer caused by UV exposure,somatic mutations: Not passed onto offspring.
Somatic mutations are alterations to a person's DNA that take place in any cell that isn't a germ cell after conception (egg or sperm cell). Somatic mutations are not inherited, occur intermittently or randomly, and are not related to a person's family history. Additionally, they cannot be passed on to subsequent generations.
Genetic alterations from the germline can be inherited. The DNA is altered in reproductive cells during this sort of mutation (egg or sperm). The mutation is inherited because sperm and eggs are passed from parents to their offspring.
Somatic mutations cannot be passed on since they happen at random in cells other than sperm or eggs.
Germline mutations happen in a parent's reproductive cells. The genetic material a kid inherits from their parents is altered by these mutations.
To learn more about inherited or somatic mutations Please click on the given link:
https://brainly.com/question/22548509
#SPJ4
A crime scene contains both the blood of the victim and the assailant. Which technique of biotechnology would be most appropriate for analyzing the blood?
A. DNA cloning
B. Light microscopy
C. Electron microscopy
D. Gel electrophoresis
Gel electrophoresis is the most appropriate technique of biotechnology for analyzing the blood at a crime scene.
Here, correct option is D.
This technique involves running the blood samples through a gel matrix and applying an electric current to it. The charged molecules, such as the DNA, will move through the gel toward the positive or negative pole depending on their charge.
By doing this, the DNA strands in the blood samples can be separated and analyzed, allowing for the identification of both the victim and the assailant. Gel electrophoresis is a powerful technique that can provide reliable and accurate results, making it an invaluable tool in forensic investigations.
Therefore, correct option is D.
know more about Gel electrophoresis here
https://brainly.com/question/2960312#
#SPJ11
The brown skin trait is dominant over the black skin trait in cows. If two heterozygous brown skin cows are crossed, what is the brown-skinned offspring?
B = Brown Skin
b = black skin
B b
B BB Bb
b Bb bb
Hope this helped :D
The chances of a homozygous brown skin cow is 25%
The chances of a heterozygous brown skin cow is 50%
The chances of a homozygous black skin cow is 25%
The chances of a heterozygous black skin cow is 0%
Brown et al. and Morwood et al. reported in 2004 that they had found skeletal remains of a previously unknown type of hominin, now dubbed Homo floresiensis, on the Indonesian island of Flores. These hominins were small (approximately 1 meter tall) with small braincases (approximately 380 cubic centimeters) as compared with other hominins. The remains of H. floresiensis were found alongside handmade stone tools and the remains of dwarf elephants that also inhabited the island, suggesting that H. floresiensis was able both to make tools and to coordinate the hunting of animals much larger than itself. H. floresiensis is estimated to have lived at the site where the remains were found from at least 38,000 years ago to 18,000 years ago.
A large brain is not necessarily required for toolmaking.
What is toolmaking?
Making tools is done to manufacture equipment that aids in producing parts or goods. A toolmaker who has a thorough understanding of the product design develops components or tools that are employed in the production of the designs. To create, hold, or test parts or products throughout their production phase, it requires high accuracy and machine equipment. Additionally, because a toolmaker's work is unique, they frequently have to develop the unique tools or alter existing tools.
As it entails developing and the engineering tools needed for producing parts or components, the tool-making process is a crucial step in the manufacturing process.
Learn more about the toolmaking with the help of the given link:-
https://brainly.com/question/2466113
#SPJ4
the ends of linear chromosomes have what are called:
Telomeres are protective structures at chromosome ends, protecting genetic information, regulating cellular aging, and ensuring long-term cell survival. They are crucial in genetics, molecular biology, and biotechnology research.
The ends of linear chromosomes have what are called telomeres. Telomeres are protective structures found at the ends of eukaryotic chromosomes. These structures are composed of repetitive DNA sequences and specialized proteins that protect the ends of the chromosomes from degradation or fusion with neighboring chromosomes.There are a number of reasons why telomeres are important. For one thing, they help to ensure that genetic information is preserved during cell division.
Telomeres act as a buffer zone that protects the rest of the chromosome from being degraded during replication, preventing the loss of important genetic information. In addition, telomeres help to regulate cellular aging and prevent the development of diseases such as cancer.
the ends of linear chromosomes have what are called telomeres. Telomeres are made up of repetitive DNA sequences and associated proteins that protect the chromosome's ends from damage. In most organisms, telomeres are essential for the long-term survival of cells, but they also play a role in aging, cancer, and other diseases. Telomeres are also an active area of research in fields such as genetics, molecular biology, and biotechnology.
To know more about Telomeres Visit:
https://brainly.com/question/33441010
#SPJ11