The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
What is a sense DNA strand?DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
https://brainly.com/question/1048150
Answer:
C
Explanation:
Pls help! This is rlly confusing bc i didn’t learn it last year
Answer:
3) distracations (i think)
4) experiment
5) vulcanized
6) playing with chemicals
7) First four
8) a place to study and conduct experiments
What is a solution's molarity, if its absorbance is 0.4?
The molarity is 0.07 M when the absorbance is 0.4
What is Molarity?Molarity is a unit of concentration that measures the amount of a solute present in a solution in terms of the number of moles of solute per liter of solution. Mathematically, it is defined as the ratio of the number of moles of solute to the volume of the solution in liters:
Molarity (M) = number of moles of solute / volume of solution in liters
In the problem, the plot of absorbance against molarity is attached and the graphed is used to read the molarity when the absorbance is 0.4.
The value from the graph is 0.07 M
complete question is attached
Learn more about molarity at:
https://brainly.com/question/26873446
#SPJ1
If we were to place an animal between the Lizard and the Pigeon, what characteristics MUST that animal have?
What characteristics must it NOT have?
Answer: thr answers are in the second page :)
Explanation:
https://www.isd2135.k12.mn.us/cms/lib2/MN01001544/Centricity/Domain/54/Cladograom%20Practice%20Key.pdf
Answer:
It must have: claws and lay eggs
It must not have: feathers and no eggs
Explanation:
Questlon 2 of 10
Which option best describes electromagnetic waves that have enough energy
to change atoms or molecules into ions?
A. Waves with low frequency
B. Non-ionizing radiation
C. Ionizing radiation
D. Waves with long wavelength
Answer:
I beleive that it is ioniziing radiation
Explanation: ionizing radiation sounds like it turns things into ions hence the word ionizing
A population of moose inhabit Isle Royale, an island in Lake Superior.
Which group of alleles can be considered the gene pool of those moose?
O alleles of all moose
O all alleles of the moose in this population only
Othe dominant alleles of the moose in this population only
Oall alleles of all moose in North America
Answer:
Therefore, the group of alleles that can be considered the gene pool of the moose population on Isle Royale would be all alleles of the moose in this population only.
Explanation:
The group of alleles that can be considered the gene pool of the moose population on Isle Royale would be all alleles of the moose in this population only.
A gene pool is the collection of all the genes (including alleles) found in a population or species that is capable of reproduction.
A big gene pool has a wide range of genetic diversity and is more resilient to environmental stresses. Due to a reduced gene pool caused by inbreeding, populations or species are less able to adapt to and endure environmental challenges.
The term "gene pool" refers to the entire gene pool found in interbreeding populations.
To learn more about Gene pool, refer to the link:
https://brainly.com/question/14505214
#SPJ2
Help plz
HURRY AHHHHHHPP!!!!
This for my grades
11. How can you make sustainable changes to your diet?
O A. Make small changes to your current diet.
O B. Follow the newest fad diet with your friends.
C. Build a new diet from scratch.
D. Aim to have a perfect diet.
what is a community?How is it different from a population?
Answer:
community is a rural area where more than two specie's living together
Explanation:
while population is the total number of specie's
from the above answers you can see how community and population are different
PLZ HELP
Identify the native habitat of the purple loosestrife, ( country & region of origin). (where does it normally come from?)
Answer:
hope it hepled
Explanation:
Purple Loosestrife grows in wet, open, sunny areas. Habitats include wet meadows or fields, stream and river banks, flood plains, ponds, lakes, tidal and non-tidal marshes and human-created habitat such as ditches
Purple loosestrife is a wetland plant native to Europe and Asia that was brought to North America in the early 19th century. This highly invasive plant was likely introduced when its seeds were included in soil used as ballast in European sailing ships and discarded in North America.
How would an asthma attack most like affect oxygen delivery in the body
Answer:
Oxygen delivery would be decreased due to a decrease in the air intake.
Explanation:
If you wish to use RNAi to reduce the expression of a gene in an organism. What would you inject into the organism
Answer:
double-stranded RNA (dsRNA) homologous to the gene of interest
Explanation:
RNA interference (RNAi) is a naturally occurring mechanism used by eukaryotic cells to suppress gene expression through regulatory non-coding RNAs (e.g., small interfering RNAs, siRNAs) that are complementary to the target gene of interest. These non-coding RNAs can bind to target messenger RNAs (mRNAs) in the cytoplasm in order to trigger mRNA degradation and/or block translation. The RNAi mechanism is widely used in molecular biology laboratories in order to inhibit the expression of target genes and thus understand gene function. The RNAi mechanism can be induced by transfecting into cells long double-stranded RNA (dsRNA) molecules that are complementary to the target mRNA sequence to be degraded. RNAi is initiated by the enzyme Dicer that cleaves dsRNAs into siRNAs (19 to 25 nucleotides), which are then incorporated into an RNA-induced silencing complex (RISC) in order to suppress gene expression at the post-transcriptional level (i.e., the mRNA is degraded after transcription).
In order to use RNA interference (RNAi) to reduce the expression of a gene in an organism, you should inject a double-stranded RNA (dsRNA) hom-ologous to the gene into the organism.
Gene expression can be defined as the transcription of a gene into a messenger ribonucleic acid (mRNA), followed by its subsequent translation into proteins. Thus, gene expression is typically controlled on two (2) main levels and these are:
TranscriptionTranslationRNA interference (RNAi) is also referred to as post-transcriptional gene silencing (PTGS) and it can be defined as a biological process in which the expression of a gene in an organism with respect to in which RNA molecules are sequentially reduced (suppressed) by double-stranded RNA (dsRNA), through transcriptional or translational repression.
This ultimately implies that, you should inject a double-stranded RNA (dsRNA) hom-ologous to the gene into the organism, if you wish to use RNA interference (RNAi) to reduce the expression of a gene in an organism.
Read more: https://brainly.com/question/17973556
An organism has 18 chromosomes in its body cells. Its sex cells have 9 chromosomes.
Which statement correctly explains this?
For an organism that has 18 chromosomes in its body cells and its sex cells have 9 chromosomes, the correct statement is C, Its sex cells are haploid and a result of meiosis.
What are haploids?Haploid cells have half the number of chromosomes as diploid cells. Mitosis is a type of cell division that produces two identical daughter cells. Meiosis is a type of cell division that produces four daughter cells, each with half the number of chromosomes as the parent cell.
In the organism described, the body cells are diploid (18 chromosomes) and the sex cells are haploid (9 chromosomes). This is because the sex cells are produced by meiosis, which is a type of cell division that reduces the number of chromosomes by half. This allows the sex cells to combine with each other to form a new diploid cell, which is the beginning of a new organism.
Find out more on chromosomes here: https://brainly.com/question/11912112
#SPJ1
Complete question:
An organism has 18 chromosomes in its body cells. Its sex cells have 9 chromosomes.
Which statement correctly explains this?
Its body cells are haploid and a result of mitosis.
Its sex cells are diploid and a result of mitosis.
Its sex cells are haploid and a result of meiosis.
Its body cells are diploid and a result of meiosis.
1. Which is NOT an energy type?
a doctor sees a patient who has kidney failure, lack of motor coordination, and a poorly functioning nervous system. after testing the doctor finds that these symptoms are all related to a chronic lack of energy in some of the patients cells. the doctor diagnoses a metabolic disorder known as leigh's disease. Based on evidence a malfunction in what organelle is most likely responsible for leighs disease?
prerenal inflammation im pro
bably wrong i just wanted to answer something
1. Does a scientific theory ever become a law? Explain
the difference between scientific theory and law.
Answer:
a theory cannot become a law
Explanation:
the difference between a scientific theory and a scientific law because a theory is an in depth explanation of an observed phenomenon. a law is a statement about an observed phenomenon or an unifying concept (i.e.: newtons law or gravity - no explanation on how it works or what it is just that it exists.)
Which is one factor that describes a Mediterranean climate?
has many trees
is found in inland areas
has cool and rainy winters
has little to no precipitation
Answer:
C
Explanation:
<3
Mediterranean climate has cool and rainy winters. Therefore, option C is correct.
What is the Mediterranean climate?Mediterranean climate, a major Köppen climatic type with hot, dry summers and cool, wet winters, is found on the western sides of the continents between 30° and 45° latitude north and south of the equator. Seasonal changes occur because of changes in ocean currents.
Strong wind systems, severe precipitation, Mediterranean cyclones, and a significant seasonal difference in temperature and rainfall are some of the distinctive regional characteristics of the Mediterranean climate. This climate has only two seasons and that is summer and winter. Winters are shorter than summer.
Thus, the Mediterranean climate has cool and rainy winters. Therefore, option C is correct.
Learn more about the Mediterranean climate, here:
https://brainly.com/question/9231311
#SPJ6
Why might it be an issue to cut the trees down to build a home/shelter? How would that impact the respiration/photosynthesis cycle?
Answer:
Trees are one of the most important things lives
Because the trees take our carbon dioxide and gives us oxygen in return. It will also low the rate of oxygen provided by trees leading to may be increase in the global warming rate, and also production of heat and suffocation in crowded rooms
Which of the following models shows the flow of energy in a woodland ecosystem? Select the two correct answers A.sun → tree → caterpillar → bird
B.sun → caterpillar → bird → hawk
C.sun → tree → grass → mouse
D.sun → grass → mouse → owl
E.sun → hawk → bird → caterpillar
Answer:
C and D
Explanation:
Energy flow is the transference of energy through all the links composing the trophic web. The correct options areA and D. A) sun → tree → caterpillar → bird /// D) sun → grass → mouse → owl.
What is the flow of energy in trophic webs?Is the transference of energy through a series of organisms involved in the trophic web.
During energy flow, every link in the trophic web takes energy by feeding on the preceding one and provides energy when becomes food for the next link.
Autotroph organisms take energy from the sun to synthesize organic matter from inorganic matter. Primary consumers take energy from producers.Secondary consumers take energy from primary consumers.And so on, until finally, decomposers take energy decomposing matter.Accordig to this information, the two correct answers are options A and D.
Producer Primary consumer Secondary consumer
A. sun → tree → caterpillar → bird
D. sun → grass → mouse → owl
You can learn more about energy flow in trophic webs at
https://brainly.com/question/24909395
https://brainly.com/question/7152008
Put the steps of non specific immune response in order.
1. Fluid and clotting elements flush the area.
II. Anti-inflammatory
proteins are released.
III. Macrophages ingest and destroy bacteria.
IV. Cells release inflammatory proteins
A. I, III, II, IV
B. IV, I, III, II
C. II, I, III, IV
D. III, I, IV, II
BAnswer:
Explanation:
The correct order of the steps in the non-specific immune response is: C:- (II.) Anti-inflammatory proteins are released; (I.) Fluid and clotting elements flush the area; (III.) Macrophages ingest and destroy bacteria; (IV.) Cells release inflammatory proteins.
The non-specific immune response, also known as innate immunity, is the first line of defense against pathogens that enter the body. It provides immediate and general protection without requiring prior exposure to the specific pathogen. The non-specific immune response is present from birth and acts as a crucial early defense mechanism.
Macrophages are a type of white blood cell that plays a vital role in the immune system's non-specific immune response. They are a part of the innate immune system and are found throughout the body.
To know more about macrophages, here
brainly.com/question/28496020
#SPJ2
Drag and drop the steps of replication to place them in the correct order.
Replication is the process by which DNA makes copies of itself.
First, the DNA needs to unzip and unwind, so the enzymes can access the DNA and begin the process.
Then, RNA primers are added, so the DNA polymerase can attach to them.
After that, new nucleotides are added to build new DNA strands.
After the replication, RNA primers are replaced with DNA nucleotides.
In the lagging strand, replication occurs discontinuously, and there are Okazaki fragments that need to be joined together to make the strand continuous.
Which two statement explain how a cell’s parts help it get or break down nutrients?
Cell membrane: The cell membrane is essential for controlling how nutrients enter and leave the cell. The digestive enzymes found in lysosomes are utilised to break down nutrients into smaller molecules.
How can a cell component aid in a cell's nutrition uptake?Recently, new information on endocytosis was made public by an international team of experts. This process, when it goes wrong, can result in illnesses including leukaemia, muscular dystrophy, and Alzheimer's.
What area of the cell absorbs and digests nutrients?The heart of a cell's strength is its mitochondria. These are organelles that function similarly to a digestive system by ingesting nutrients, digesting them, and producing chemicals that are rich in energy for the cell.
To know more about cell membrane visit:-
https://brainly.com/question/25273964
#SPJ1
If an experimental drug inhibits the production of a spike protein that should be embedded in the envelope, is it considered broad or narrow spectrum?
If an experimental drug inhibits the production of a spike protein that should be embedded in the envelope, then it is considered a narrow spectrum because only inhibits one pathogenic agent (i.e. the target virus).
What is a narrow-spectrum drug?A narrow-spectrum drug is any medication that acts to block a specific molecule or structure in the target pathogenic agent, conversely to broad spectra drugs that inhibit several agents of the same or related groups
Therefore, with this data, we can see that a narrow-spectrum drug is associated with the inhibition of only one agent such as a virus.
Learn more about narrow-spectrum drugs here:
https://brainly.com/question/17011130
#SPJ1
A postsynaptic neuron has an RMP of -70mV and a typical threshold of -55mV. It has three presynaptic inputs-from neurons X, Y, and Z. Stimulation of
neuron X causes the postsynaptic neuron to depolarize by 0.5 mV. When X and Y are stimulated simultaneously, the postsynaptic neuron depolarizes by
1 mV, If X fires 10 times and Y fires 10 times the result will be …
Multiple Choice
a subthreshold summation.
presynaptic inhibition.
threshold is reached and an AP is fired.
many APs are fired.
the membrane depolarizes.
When X fires 10 times and Y fires 10 times, the result will be a subthreshold summation.
Subthreshold summation happens when two or more presynaptic inputs that are sub-threshold (i.e., they cannot create an action potential) combine their effects on the postsynaptic neuron.
Here, the postsynaptic neuron has an RMP of -70mV and a typical threshold of -55mV. When neuron X is stimulated, it depolarizes by 0.5 mV.
When X and Y are stimulated simultaneously, the postsynaptic neuron depolarizes by 1 mV, which is sub-threshold (below -55mV).
Therefore, when X fires 10 times and Y fires 10 times, the postsynaptic neuron will experience subthreshold summation and no action potential will be fired.
For more answers on subthreshold summation
https://brainly.com/question/31626182
#SPJ8
Most animals produce offspring through mating, but some organisms reproduce by cloning. What is cloning?
o The energy requirement of two different parents
o The growth and development of bacteria
o The process of producing an organism that is genetically identical to the organism from which it was produced.
o The process that allows an organism to maintain a stable internal environment changing external conditions.
Please help!!!
Answer:
The answer is C.
Explanation:
What has to be present in order for metamorphic rocks to form?
Factors such as high heat and high pressure have to be present in order for metamorphic rocks to form.
What is a Rock?This is referred to as a solid collection of mineral grains that grow or become cemented together and are formed through various types of techniques.
Metamorphic rocks in the other hand is referred to as any of a class of rocks that result from the alteration of preexisting rocks in response to changing environmental conditions and the process it undergoes is metamorphism hence the name given to it.
Metamorphic rocks form when rocks are subjected to high heat, high pressure, hot mineral-rich fluids etc or combination of the factors mentioned above which are usually present in the deep region within the Earth or where tectonic plates meet.
Read more about Metamorphic rocks here https://brainly.com/question/1176274
#SPJ1
Needing help with number 1 , using Punnett squares please
The mother's dominant trait is short t gene + the father's short t genes will produce the ratio of offsrings as shown above.
Jenna took an open bowl of leftover mashed potatoes from the refrigerator and noticed a difference in smell. She determined that chemical changes occurred since the potatoes were first placed there. Which observations most likely led to Jenna’s conclusion? a change of odor a decrease in temperature a change in moisture content a decrease in mass
Answer:
its a on ed
Explanation:
The observation that most likely led to Jenna’s conclusion is a change of odor. Thus, the correct option is A.
What are Chemical changes?Chemical changes may be defined as those changes through which one chemical substance gets transformed into another chemical substance. This occurs in a variety of steps and types.
A difference in the smell of leftover mashed potatoes indicates the change in odor which is observed by Jenna.
A decrease in temperature, a change in moisture, and a decrease in mass do not make any sense with respect to difference in smell.
Therefore, the observation that most likely led to Jenna’s conclusion is a change of odor. Thus, the correct option is A.
To learn more about Chemical changes, refer to the link:
https://brainly.com/question/19794032
#SPJ6
Which two hormones regulate calcium levels in the blood?
Explanation:
Both parathyroid harmone and calcitonin help regulate the level of calcium in your blood.
Calcitonin and parathyroid hormone work together to control blood calcium levels, which are crucial for a number of vital biological processes.
When the blood calcium level is high, calcitonin is released. It subsequently reduces the levels by preventing bones' release of calcium ions. Contrarily, the parathyroid hormone raises the blood calcium level by enhancing intestinal calcium absorption and moving calcium from bones into the blood.
A hormone called calcitonin works to control the amount of calcium in your blood by lowering it. Your thyroid gland's C-cells generate calcitonin. It doesn't seem that having abnormally high amounts of calcitonin in your body has any immediate drawbacks.
Your parathyroid glands produce a hormone called parathyroid hormone (PTH) that regulates the amount of calcium in your blood. It also regulates the amounts of vitamin D and phosphorus. Parathyroid hormone over- or under-production might result in symptoms linked to abnormal blood calcium levels.
Know more about Calcitonin and parathyroid hormone at,
https://brainly.com/question/3275813
Compare and contrast angiosperms and gymnosperms and their outward appearance. How does this affect how they are pollinated?
Answer:
The key difference between angiosperms and gymnosperms is how their seeds are developed. The seeds of angiosperms develop in the ovaries of flowers and are surrounded by a protective fruit. ... Gymnosperm seeds are usually formed in unisexual cones, known as strobili, and the plants lack fruits and flowers.
Starting with a protein that has been inserted into the Endoplasmic reticulum (ER) membrane with the Amino (N) terminal in the ER lumen and the carboxy (C) terminal in the cytoplasm, describe the journey the protein will take until it is placed in the plasma membrane. Include any modifications that occur during the journey and where they occur. Also, always indicate where the N and C terminal are located.
Answer and Explanation:
Ribosomes are the primary structure for protein synthesis. They can be found in the rough endoplasmic reticulum or floating in the cytosol.
Free ribosomes are not attached to any cytoplasmic structure or organelle. They synthesize proteins only for internal cell use. Other ribosomes are attached to the membrane of the endoplasmic reticulum and they are in charge of synthesizing membrane proteins or exportation proteins. Free and attached ribosomes are identical and they can alternate their location. This means that although free ribosomes are floating in the cytosol, eventually, they can get attached to the endoplasmic reticulum membrane.
Synthesis of proteins that are destined to membrane or exportation starts in the cytoplasm with the production of a molecule portion known as a signal aminoacidic sequence. This signal sequence varies between 13 and 36 amino acids, is located in the amino extreme of the synthesizing protein, and when it reaches a certain length, it meets the signal recognizing particle. This particle joins the signal sequence of the protein and leads the synthesizing protein and associated ribosome to a specific region in the Rough endoplasmic reticulum where it continues the protein building. When they reach the membrane of the endoplasmic reticulum, the signal recognizing particle links to a receptor associated with a pore. Meanwhile, the ribosome keeps synthesizing the protein, and the enlarged polypeptidic chain goes forward the reticulum lumen through the pore. While this is happening, another enzyme cuts the signal sequence, an action that requires energy from the ATP hydrolysis. When the new protein synthesis is complete, the polypeptide is released into the reticulum lumen. Here it also happens the protein folding (which is possible by the formation of disulfide bridges of proteins are formed) and the initial stages of glycosylation (the oligosaccharide addition).
Once membrane proteins are folded in the interior of the endoplasmic reticulum, they are packaged into vesicles and sent to the Golgi complex, where it occurs the final association of carbohydrates with proteins. The Golgi complex sends proteins to their different destinies. Proteins destined to a certain place are packaged all together in the same vesicle and sent to the target organelle. In the case of membrane proteins, they are packaged in vesicles and sent to the cell membrane where they get incrusted.
There are certain signal sequences in the carboxy-terminal extreme of the protein that plays an important role during the transport of membrane proteins. A signal as simple as one amino acid in the c-terminal extreme is responsible for the correct transport of the molecule through the whole traject until it reaches the membrane.