Research on trait heritability has revealed which of the following? Please select the best answer from the choices provided Both differences and similarities regarding personalities have been found in families. The influence of heredity on personality is about 20 percent. There are more differences in personality characteristics among family members than there are similarities. There are more similarities in personality characteristics among family members than there are differences.

Answers

Answer 1

Answer:

i’m pretty sure it’s A. Both differences and similarities regarding personalities have been found in families.

Explanation:

Answer 2

The correct response is Option C Both differences and similarities regarding personalities have been found in families.

What is a Family?

A family is a group of two or more people who are connected by blood, marriage, or adoption and who live together; all of these people are regarded as belonging to the same family.

So a family comprises an adult and his or her progeny at its most fundamental level. It typically comprises two married people, often a man and a woman, who are virtually always from distinct families and are not blood relatives. They typically reside in separate homes with their children. The nuclear family, which is this form of the unit more explicitly, is said to be the oldest family structure still in existence.

An extended family is a situation in which there are other members living with the parents and their unmarried children in addition to the married children, their wives, and children, and maybe elderly dependents as well.

To read more about Family, refer to - https://brainly.com/question/14321064

#SPJ6


Related Questions

Question 1(Multiple Choice Worth 3 points)
(04.03 MC)
In high school Jeannie took two years of French. During her freshman year of college, Jeannie took a semester of Spanish. During a Spanish test on verb conjugation, Jeannie
confused the Spanish version of conjugation and wrote down the French version. This memory error is best explained by

Answers

It's a combination of interference and lack of recent practice in French, Jeannie's brain was trying to recall the correct conjugation rule but due to the interference of Spanish, it made an error and wrote down the French version.

What is memory error?Interference: The learning of one language (Spanish) interferes with the memory of another language (French) already learnedRetroactive Interference: The new learning (Spanish) affects the retention of previously learned information (French).Proactive Interference: previously learned information (French) affects the ability to learn new information (Spanish).Over generalization: Jeannie may have overgeneralized the conjugation rules from French to Spanish, leading to confusion during the test.Language Transfer: Jeannie transferred the knowledge and rules of French to Spanish, leading to confusion during the test.Lack of recent practice: Jeannie has not used French in a while, which might have led to forgetting some of the rules and confusing it with Spanish.

To learn more about memory error refer:

brainly.com/question/30227324

#SPJ1

MULTIPLE CHOICE QUESTION
What does Mr. Kiaga's response to the complaint
about osu converts reveal about him (156-157)?
[RL.3]
He thinks the osu converts will make his church less

Answers

The answer from Mr. Kiagra shows that he possesses great religious tolerance and strong empathy for converts to use. He thinks osu converts will make the church less homogenous.

Who are the converts to Osu?They are a group of people considered the social outcasts of the village.They are people unfit to serve the needs of the village.They are people who follow one way of life and even another religion.

Converts to Osu are viewed negatively and are despised by village society. This is because village members believe that they do not represent the village's moral and ethical values ​​and undermine social advancement.

However, Mr. Kiaga has a different view. He has strong empathy and religious tolerance for all people and for that reason, accepts Osu converts without judgment and helps them change their lives.

He believes that this brings diversity to his church and makes socializing among people more enjoyable.

This question is about the book "Things fall apart" and you can learn more about it at the link:

https://brainly.com/question/4216663

#SPJ1

Read this sentence from paragraph 3.
She was not struck by any thing remarkably clever in Miss
Smith's conversation, but she found her altogether very engaging
-not inconveniently shy, not unwilling to talk-
What is the meaning of the word engaging as it is used in the sentence?
A-likeable
B-considerate
C-helpful
D-forgiving

Read this sentence from paragraph 3.She was not struck by any thing remarkably clever in MissSmith's

Answers

Answer:

mkkkkkkkkjjjj..................

Answer:

A Likable

Explanation:

As we see she was not showing very interest in Miss Smith's conversation but she like the conversation.

e
9
Which quotation from the excerpt shows a cultural
aspect of the setting?
O "What is his name?"
"Is he married or single?"
"How so? How can it affect them?"
O "You must know that I am thinking of his marrying
one of them."

Answers

The quotation from the excerpt that shows a cultural setting is: You must know that I am thinking of his marrying one of them. The correct option is D.

Thus, this quotation from the excerpt indicates that the setting is in a culture where arranged marriages are based on social status or wealth. Someone marrying for love is not prevalent in this cultural setting.

The characters in the excerpt are concerned with the marital status and social standing of a husband rather than his compatibility with their friend. This cultural setting suggests that a traditional or conservative society where societal norms and expectations are of great importance in personal decision-making.

Thus, the ideal selection is option D.

Learn more about the cultural setting here:

https://brainly.com/question/7151663

#SPJ1

HELP I WILL GIVE BRANLIST

HELP I WILL GIVE BRANLIST

Answers

Answer:

C

Explanation:

It’s C cause all the answers are wrong and this has to be the only answer

and the rest of the answers are mostly stated in it already and it says to add, hopefully this is it!

Dieting is a form of cognitive control. A. True B. False

Answers

A) True
Is the answer

Answer:

A. True

Explanation:

Which sentence contains the best example of paradox?
A the chair spun in gleeful abandon when he got up
B to all the law-abiding criminals out there, thanks
C yesterday, I met the most amazing person ever
D don’t tell the coach he’s as hot tempered as a kettle

Answers

Answer:

In my opinion, b.

Explanation:

A paradox is a self contradicting sentence, in which a sentence appears to contradict itself .

Example - "All animals are equal, but some animals are more equal than others."

Otherwise saying --

The sentence below me is true.

The sentence above me is false.

Read the excerpt from Ovid’s "Pyramus and Thisbe".

And when he had found
the bloodstained shawl, he cried: "Now this same night
will see two lovers lose their lives: she was
the one more worthy of long life: it's I
who bear the guilt for this. O my poor girl,
it's I who led you to your death; I said
you were to reach this fearful place by night;
I let you be the first who would arrive.
O all you lions with your lairs beneath
this cliff, come now, and with your fierce jaws feast
upon my wretched guts!

Which statement best describes how the pace of the excerpt creates tension?

Pyramus’s quick action hurries the plot to his tragic death.
Pyramus’s quick action hurries the plot to reveal his crime.
Pyramus’s long speech slows the pace to prolong suspense.
Pyramus’s long speech slows the pace to taunt the lioness

Answers

The inference is that the statement that best describes how the pace of the excerpt creates tension is C. Pyramus’s long speech slows the pace to prolong suspense.

What is an inference?

It should be noted that an inference is the conclusion that can be deduced based on the information given on the story.

In this case, the pace of the excerpt creates tension as Pyramus’s long speech slows the pace to prolong suspense.

Learn more about inference on:

brainly.com/question/25280941

#SPJ1

A(n)_________ pronoun relates to what you are writing about; example:

SHE lambasted herself for failing to complete the art project.

^(the example is She)

A. Comparative
B. Transitive
C. Demonstrative
D. Superlative

Answers

A transitive pronoun relates to what you are writing about. Hence, option B is correct.

What is a pronoun?

When your reader or listener already understands the nouns you're referring to, you can replace them with pronouns.

The personal pronoun, the demonstrative pronoun, the interrogative pronoun, the relative pronoun, the indefinite pronoun, the reflexive pronoun, and the intensive pronoun are among the seven types of pronouns that authors in English and English as a second language must be aware of.

Comparative, transitive, demonstrative, personal, and superlative are some types of pronouns. A transitive pronoun relates to what you are writing about. Hence, option B is correct.

Learn more about pronouns, here:

https://brainly.com/question/7942658

#SPJ1

Write an essay about Henrietta lacks from the doctors point of view

Answers

Henrietta Lacks was a patient at Johns Hopkins Hospital in the early 1950s. During her treatment, a sample of her cancer cells was taken without her knowledge or consent. These cells were found to be unique in that they could be kept alive outside of the body, which made them ideal for research. The cells, known as HeLa cells, have been used in countless experiments since then, and have helped to advance scientific knowledge in many fields.

From the doctor's point of view, the use of Henrietta Lacks' cells was a major breakthrough. Prior to the discovery of HeLa cells, scientists were unable to keep cells alive outside of the body for more than a few days. This severely limited the types of experiments that could be conducted. The discovery of HeLa cells opened up a whole new range of possibilities, and allowed doctors and researchers to study cells in ways that were previously impossible.

However, the use of Henrietta Lacks' cells was also controversial. Some people felt that it was unethical to take cells from a patient without their knowledge or consent. Others felt that the use of these cells was exploitative, and that Henrietta Lacks and her family should have been compensated for their use.

Despite these concerns, it is clear that the use of Henrietta Lacks' cells has had a profound impact on medical research. The development of vaccines for diseases such as polio and HPV would not have been possible without the use of HeLa cells. These cells have also been used to study cancer, AIDS, and many other diseases.

In conclusion, from the doctor's point of view, the use of Henrietta Lacks' cells was a major breakthrough that has had a profound impact on medical research. While there are certainly ethical concerns that should be addressed, it is clear that the use of these cells has led to many important discoveries and advancements in the field of medicine.

What are TWO reasons that some members of
the congregation do not like Reverend Parris?

Answers

Answer: He whines about his salary and strives to gain ownership of the meetinghouse where the church and his residence is.

How would you describe America’s ideal culture when it comes to healthy eating? Why might people say that there is a gap between the ideal culture and the real culture in this matter? How does that gap show that people assign different meanings to food?

Please, make it make sense...

Answers

Answer:

download this for the answer

Explanation:

America's ideal culture regarding healthy eating revolves around balanced, nutrient-rich diets, promoting well-being and preventing health issues. It emphasizes fresh, whole foods and portion control.

However, the gap between this ideal and real culture stems from factors like convenience, marketing of unhealthy foods, and busy lifestyles.

This disparity indicates that people assign diverse meanings to food: sustenance, pleasure, comfort, or convenience. Economic disparities also contribute, as access to healthier options varies.

The gap underscores the complex interplay of personal choices, societal influences, and economic realities, highlighting that food symbolizes not just nourishment, but also identity, pleasure, convenience, and socioeconomic status in American society.

Know more about unhealthy foods:

https://brainly.com/question/13710428

#SPJ3

Ruthina is writing an essay arguing that schools should provide vegetarian food options. Read her introductory sentence.

The choice of what to eat at lunch is the most important choice a student makes all day.

How could this sentence be revised to eliminate a logical fallacy?

Eating vegetarian options will not only make students healthier, but it could help to save the world.
When students eat meat at lunch, it proves that they do not think about nutrition.
Vegetarian options would completely change the way schools prepare lunch for their students.
By expanding the options for lunches, schools could allow students to choose a vegetarian option.

Answers

Answer:

the answer is C. By expanding the options for lunches, schools could allow students to choose a vegetarian option.

Explanation:

CCCCCCCCCCCCCCCCCCCCCCCC

car is to gas as bicycle is to​

Answers

Answer:

The answer would most likely be a person, since a car needs gas to operate, the same way a bicycle needs a person to operate.

This could be wrong.

______ is a circular and dynamic process in which people interpret and make sense of the information they exchange.

Answers

Answer:

COMMUNICATION

Explanation:

Communication is the “exchange of information between a sender and a receiver, and the inference (perception) of meaning between the individuals involved.” It is a circular and dynamic process in which people interpret and make sense of the information they exchange.

i hope this helps

Do you think that how you act/present yourself on social media/online is different than in person? Why do you think that is? ( In Paragraph Form )

Answers

Answer:

Yes, how I act on social media is not how I am in person. Even though I try as much as possible to present the true picture of who I am on social media, I sometimes realize that only the good and glamorous part of me is presented to the world. I hide my faults from my friends and post nothing about them. This is deceptive as there is no person whose life is all glamorous. People who are easily carried away by all the show off can become depressed as a result of that.

Explanation:

This question requires that the reader should examine his activities on social media to find out if these activities are true representations of their offline activities.

A close examination of my activities on social media shows a presentation of only the good and exciting aspects of my life. My imperfections are hidden from the world. This is not a balanced representation of my personality and it is somewhat deceptive.

Why does the narrator believe that the old man groaned ?

Answers

Answer: because the old man sensed deadly company in the room

Explanation:

I guessed and got it right no explanation

Read an excerpt from "Television and the Public Interest" and answer the question. The speech was delivered by Newton N. Minow, chairman of the Federal Communications Commission, to the nation’s television executives in 1961.

[1] … But when television is bad, nothing is worse. I invite each of you to sit down in front of your television set when your station goes on the air and stay there, for a day, without a book, without a magazine, without a newspaper, without a profit and loss sheet or a rating book to distract you. Keep your eyes glued to that set until the station signs off. I can assure you that what you will observe is a vast wasteland.

[2] You will see a procession of game shows, formula comedies about totally unbelievable families, blood and thunder, mayhem, violence, sadism, murder, western bad men, western good men, private eyes, gangsters, more violence, and cartoons. And endlessly, commercials—many screaming, cajoling, and offending. And most of all, boredom. True, you'll see a few things you will enjoy. But they will be very, very few. And if you think I exaggerate, I only ask you to try it.

[3] Is there one person in this room who claims that broadcasting can't do better? Well a glance at next season's proposed programming can give us little heart. Of 73 and 1/2 hours of prime evening time, the networks have tentatively scheduled 59 hours of categories of action-adventure, situation comedy, variety, quiz, and movies. Is there one network president in this room who claims he can't do better?

[4] The best estimates indicate that during the hours of 5 to 6 P.M. sixty percent of your audience is composed of children under twelve. And most young children today, believe it or not, spend as much time watching television as they do in the schoolroom. I repeat—let that sink in, ladies and gentlemen—most young children today spend as much time watching television as they do in the schoolroom. It used to be said that there were three great influences on a child: home, school, and church. Today, there is a fourth great influence, and you ladies and gentlemen in this room control it.

[5] If parents, teachers, and ministers conducted their responsibilities by following the ratings, children would have a steady diet of ice cream, school holidays, and no Sunday school. What about your responsibilities? Is there no room on television to teach, to inform, to uplift, to stretch, to enlarge the capacities of our children? Is there no room for programs deepening their understanding of children in other lands? There are some fine children's shows, but they are drowned out in the massive doses of cartoons, violence, and more violence. Must these be your trademarks? Search your consciences and see if you cannot offer more to your young beneficiaries whose future you guide so many hours each and every day …

[6] You must provide a wider range of choices, more diversity, more alternatives. It is not enough to cater to the nation's whims; you must also serve the nation's needs. And I would add this: that if some of you persist in a relentless search for the highest rating and the lowest common denominator, you may very well lose your audience. Because … the people are wise, wiser than some of the broadcasters—and politicians—think.

What is the claim of Minow's argument?

People are wise to the tactics television stations use to get higher ratings.
Programming on television should not only entertain but also educate and inspire.
Teachers and parents must work to counteract the damage done by television.
There is nothing worse than boring television game shows and superficial sitcoms.

Answers

In the given excerpt the claim of Minow's argument is programming on television should not only offer entertainment but also educate and inspire, hence option B is correct.

What is Minow's argument?

In the speech, Minow states about television programming talks about the various entertaining movies and shows offering only content which is not useful for people it must provide some knowledge.

Television is not always bad to watch, it provides some knowledge about the world and educational content, which helps the students.

Therefore, Minow's argument claims television also educates and inspires not to entertain only.

Learn more about Minow, here:

https://brainly.com/question/15014887

#SPJ1

I almost got nothing done yesterday; I did one small chore, but other than that I just sat around and watched movies all day.​

Answers

What should we do knowing this???

Directions:

Let’s take the big picture of a topic and narrow it down to one word. Why did you choose that word and how does it encompass your ideas? Use specific details to support your choice. Once you have completed your post, comment on a classmate’s post to build on his or her ideas, pose questions, or politely agree or disagree and explain why.

Prompt:

Daphne du Maurier uses powerful descriptions to capture natural beauty and to convey emotional turmoil in Rebecca. Choose one adjective to describe the setting of Manderley portrayed in Chapter 1 of Rebecca. In a brief paragraph, explain your word choice. Use examples and evidence from the text to support your word choice.

Answers

Answer:

Eerie

My word choice to describe the setting of Manderley portrayed in Chapter 1 of Rebecca is "eerie." This is because du Maurier's descriptions of Manderley create a sense of unease and mystery, which adds to the overall atmosphere of the novel.

For example, when the narrator first arrives at Manderley, she notes that "the drive wound away in front of me, twisting and turning as it had always done, but as I advanced I was aware that a change had come upon it; it was narrow and unkept, not the drive that we had known." This description sets the tone for the rest of the chapter, as the narrator is confronted with the strange and unfamiliar surroundings of Manderley.

Later, when the narrator is exploring the grounds of the estate, she describes the "long-neglected flower-beds" and "the bushes straggled up anyhow." This imagery creates a sense of neglect and decay, which contributes to the eerie atmosphere of the setting.

Overall, my word choice of "eerie" encapsulates the haunting and unsettling nature of Manderley in Chapter 1 of Rebecca, as du Maurier's descriptions create a sense of unease and foreshadow the emotional turmoil to come in the novel.

Comment on a classmate’s post:

I agree with your choice of "eerie" to describe the setting of Manderley in Chapter 1 of Rebecca. Your examples from the text show how du Maurier's descriptions create a sense of unease and mystery, which adds to the overall atmosphere of the novel. I especially liked how you noted the description of the "long-neglected flower-beds" and "the bushes straggled up anyhow" to create a sense of neglect and decay. This really does contribute to the eerie atmosphere of the setting. Have you thought about how this eerie atmosphere might contribute to the emotional turmoil of the characters in the novel?

Does the gender of the narrator matter?

Answers

Explanation:

Not at all brother.

We should see the content not the gender.

Irregular verbs may take the on the endings of - S, - ed, or - ing.
FALSE
TRUE

Answers

Answer:

true

Explanation:

As irregular verbs do not follow a specific pattern.

Sofa is a comfortable _______for three or two people

Answers

Cushion?

There is no multiple choice so I have no clue if it is apart of a passage you are reading or not..

Answer:

My dear frind the answer is:

Sofa is a comfortable Seat  for three or two people.

Which of the following is an example of imagery?
Consider your sinfulness while there is still time.
Your heart has not changed.
You may have reformed your life in many ways.
You are held as one holds a twittering spider over the fire.

Answers

Answer:You are held as one holds a twittering spider over the fire.

Explanation: This is the answer because it is describing something so the reader can imagine it.

What is Gregor Samsa's attitude toward his chosen work as a traveling salesman? Use evidence from the text to explain his feelings about his job
and his place in society.

Answers

The following refers to Gregor Samsa's attitude toward his work:

Gregor dislikes his work as a traveling salesman. He particularly hates his tyrannical boss, the long hours, and the shallow acquaintances.

The only reason why Gregor does not quit his job is his family. He is helping his parents pay off a debt.

Evidence of his dislike for his job and the reason to keep on doing it is as follows:

"If I didn't hold back for my parents' sake, I would've quit ages ago. I would've gone to the boss and told him just what I think from the bottom of my heart. He would've fallen right off his desk!"

This question refers to the famous novel "The Metamorphosis" by Bohemian author Franz Kafka (1883-1924).The main character is Gregor Samsa, a young man who one day wakes up to find himself transformed into an insect.Gregor's transformation represents how little his life is worth to society. Gregor is not respected as a human being. He is just another cog in the machine, so speak.Gregor is unhappy with his condition. He does not have a job or a lifestyle that he truly loves. All that matters is making money to survive.Even though he hates his job, he does not quit because of his parents' debt.

Learn more about the novel here:

https://brainly.com/question/9198183?referrer=searchResults

The garden party by Katherine

Answers

"The Garden Party" is a short story written by Katherine Mansfield. It is a tale of class differences and their consequences. The Sheridan's, a wealthy family, is planning a garden party at their estate. However, the merriment is brought to a halt when a worker from the nearby slums is killed in an accident.

The story starts by describing the preparations for the garden party, which is a grand affair. The Sheridans are excited about the party, and Laura, the youngest daughter of the family, is particularly thrilled. She feels that she is doing something important by organizing the party and that it is a reflection of her family's status.

However, their excitement is dampened when they learn that a worker from the nearby slums has been killed in an accident. The family is torn between canceling the party and continuing with it. Laura wants to cancel the party out of respect for the worker and his family, but her mother insists that the party must go on.

The theme of class differences is evident in the story. The Sheridans are wealthy and live a life of luxury, while the workers in the nearby slums are poor and struggle to make ends meet. Laura's compassion for the worker is juxtaposed with her mother's indifference to his death.

In conclusion, "The Garden Party" is a commentary on class differences and their impact on people's lives. The story highlights the importance of empathy and compassion for those who are less fortunate than us.

Know more about The Garden Party here :

brainly.com/question/12791083

#SPJ8

i need help with this ela work please its done in 5 min

i need help with this ela work please its done in 5 min

Answers

The author's choice of the word "herded" has a significant impact on the excerpt and helps to create a vivid image of how the deportees were treated during this process.

The word "herded" implies that the deportees were treated like animals, without any regard for their dignity or humanity. The word creates an image of a large group of people being forcefully and aggressively pushed along, possibly by guards or soldiers.

Furthermore, the use of the word "herded" suggests that the deportees had no choice in the matter and were being controlled by others, making their situation even more tragic and heartbreaking.

Overall, the author's choice of the word "herded" helps to emphasize the cruelty and inhumanity of the deportees' treatment, and creates a powerful image that enhances the emotional impact of the excerpt.

read this sentence from paragraph 2.
When people don’t read and don’t have access to books,
information can’t travel and culture can’t be shared beyond small communities.
What can readers infer about the culture in the 1400s from this sentence?
A People did not travel beyond their own community, so information and culture did not spread.B People who could not read also could not share information or culture.
C People could not access information or culture beyond their own community.
D All people who read also traveled and shared cultural information as they traveled.

Answers

The answer would be C. It says in the sentence that they couldn't share their information beyond their communities so people couldn't access it beyond that.

Describe and analyze Lahiri's cautionary tale surrounding Miranda’s involvement with Dev.

Answers

Perhaps because Dev is so aware of his surroundings, Miranda feels safe in his strangeness. He is always educating her on both the geography of the world and of his own nation.

At the Mapparium, what does Dev recall saying to Miranda?

Rohin remark that she appears seductive when she's finished. In fact, he utters the exact same phrase Dev did that day in the Mapparium: "You're ." Miranda is powerless to assist.

Where do Dev and Miranda initially meet?

Flashback: Miranda and Dev meet as Dev is out purchasing skincare items for his wife when Miranda is out purchasing skin care items. Due of his wife's trip to India, they start dating. She is described as by Dev. Even when his wife returns, the affair continues.

To know more about Miranda visit :-

https://brainly.com/question/12363831

#SPJ1

In The Great Gatsby, how does the setting of the villages of East and West Egg affect the story?
Select the two correct answers.
A)Gatsby lives in West Egg and Daisy lives in East Egg, emphasizing that both social class and physical distance separate
them
B)Nick is ashamed to live in West Egg and spends the majority of his time in East Egg with Daisy or in New York City.
C)As suburbs of New York City, East and West Egg represent an escape from the decadence and excess that is a part of
city life
D)Even though both are wealthy communities, East Egg residents, who inherited their money, look down on West Egg
residents with new money,

Answers

Answer:

Its A) and D)

Explanation:

In The Great Gatsby, the setting of the villages of East and West Egg affect the story by option A)Gatsby lives in West Egg and Daisy lives in East Egg, emphasizing that both social class and physical distance separate them and option D)Even though both are wealthy communities, East Egg residents, who inherited their money, look down on West Egg residents with new money.

What is the story of the novel 'The Great Gatsby'?The Great Gatsby the novel by F. Scott Fitzgerald published in 1925.The story is set in Jazz Age New York, the novel tells the tragic story of Jay Gatsby, a self-made millionaire, and his pursuit of Daisy Buchanan, a wealthy young woman whom he loved in his youth. In a private conversation, Daisy confesses to Nick that she has been unhappy. Returning to his house in West Egg, he catches sight of his neighbor, Jay Gatsby. The lavish culture of West Egg is a reflection of the new prosperity that was possible during Prohibition when illegal schemes involving the black-market selling of liquor abounded. Such criminal enterprises are the source of Gatsby’s income and finance his incredible parties, which are probably based on parties Fitzgerald himself attended when he lived on Long Island in the early 1920s. Even the racial anxieties of the period are evident in the novel.

To learn more about The Great Gatsby novel, refer to: https://brainly.com/question/10681528

#SPJ2

Other Questions
Tranching fueled the housing bubble by:a. granting easy credit.b. allowing mortgage backed securities.c. using pension funds and insurance companies to finance securities.d. following the Glass-Steagall Act.d. rapid growth of a company. student 1 y=-3x+x student 2 y=7x/10 student 3 y=4(2-x) Which students write an equation of a nonlinear function? Soil is considered to be one of the greatest natural resources. true or falsr A small amount of chemical splashes in Franks eye. What should Frank do immediately? Use the Terms & Names list to identify each sentence online or on your own paper.A. OsceolaB. John Quincy AdamsC. John TylerD. Whig PartyE. SequoyaF. Martin Van BurenG. Andrew JacksonH. Tariff of AbominationsI. inflationJ. Panic of 1837K. spoils systemL. doctrine of nullificationM. John C. CalhounPeople accused me of making a deal with Henry Clay in the 1824 presidential election. ______ Please help me metal objects unearthed in the indus valley o have been primarily jewelry and other decorative items. o were mostly weapons. were used only in urban areas. o belonged to the elite and wealthy classes. o have been mostly tools and other useful objects. the market supply curve can be derived by part 2 a. horizontally adding the individual supplies at each price level. b. looking at the capacity utilization in the largest firms in the industry. c. multiplying the price and quantity supplied at each price level. d. vertically adding the individual supplies at each quantity level. -18 (-3) answer explain The sum of ending inventory and cost of goods sold is:_________ a. net purchases. b. beginning inventory. c. cost of goods available (or cost of goods available for sale). d. gross profit. which of the following is true of the ketogenic diet? group of answer choices it increases metabolic rate. it is a high protein diet. it often contains high levels of saturated fat which could increase the risk of heart disease. it is an easy diet to follow, because it offers a lot of variety in food choices. WILL GIVE BRANLIEST !Case #28104Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.Part TwoCopy the DNA sequences for each suspect into a Word document.Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.Repeat step 1 with the DNA samples for Suspects B and C.Suspect ATCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGASuspect BTCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGASuspect CTTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGAProbeAGGTQuestionsAnswer these following questions in the essay box below.1. Which suspect most likely committed the robbery?2. How do you know? What makes the reactants of photosynthesis and the reactants of cellular respiration similar? (1 point) Both involve ATP molecules. Both involve light energy. Both involve combinations of glucose, water, and carbon dioxide. Both involve combinations of carbon, hydrogen, and oxygen. Ryan decided to solve the system by substituting, but when she finished, she was left with 54=45. What does this means for the solution to the problem? Darren designs a basketball court in his backyard. The sketch shows his design which consists of a rectangle and a semicircle. To create the court, he will use tape as an outline for the rectangle and semicircle. What is the approximate length of tape Darren needs to create the outline for his basketball court? Select from the drop-down lists to correctly complete the sentence. Darren needs approximately F is inversely proportional to d 2 . when f = 4 , d = 8 work out f when d = 16f is inversely proportional to d 2 . when f = 4 , d = 8 work out f when d = 16f is inversely proportional to d 2 . when f = 4 , d = 8 work out f when d = 16 long-term use of drugs causes changes in brain chemical systems and circuits, affecting functions that include which of the following? luoa consider the structures of the molecules below. are these molecules polar, nonpolar, or amphiphilic? the nurse is caring for a client who has taken atenolol for 2 years. the healthcare provider recently changed the medication to enalapril to manage the client's blood pressure. which instruction should the nurse provide the client regarding the new medication? Consider the function f(x) = i sin(72) 3z + 5i. (a) (3 pts) Express f(z) in the form f(z) = u(x, y) + iv(x,y) where u, v are real-valued functions of real variables x,y with z= x + iy and 2 = x - iy. (b) (4 pts) Use any method you know to find where f(2) is not differentiable. (c)(3 pts) Indicate where f(2) is differentiable and find the derivative of f(z) where f(z) is differ- entiable. (d) (2 pts) Is f(2) analytic somewhere? (Hint: The knowledge that the function sin z is entire may simplify your work.) what are the two most common injuries caused by penetrating chest trauma?