Report the number of significant figures in each of the following values​

Report The Number Of Significant Figures In Each Of The Following Values

Answers

Answer 1

Answer:

1.

A. 3 significant figures

B. 4 significant figures

C. 3 significant figures

D. 2 significant figures

E. 2 significant figures

F. 2 significant figures


Related Questions

Solid aluminum has a specific heat capacity of 0.90 J/ gxK. How many joules of heat are absorbed to raise the temperature of 24.0 grams of aluminum from 300. K to 350. K?
1. 22 J
2. 45 J
3. 1100 J
4. 1200 J

Answers

Answer:: 1100 j

Explanation:

Solid aluminum has a specific heat capacity of 0.90 J/ gK joules of heat are absorbed to raise the temperature of 24.0 grams of aluminum from 300. K to 350. K is 11.080 J

Heat is the transfer of kinetic energy from one medium or object to another from an energy source to a medium or object

Here given data is

Specific heat capacity = 0.90 J/gK

Temperature = 300. K to 350. K = 350 - 300 = 50 K

Mass =  24.0 grams

We have to calculate the heat = ?

Q =mCΔT

Q =  24.0 grams× 0.90×50 K

Q = 11.080 J

11.080 J  heat are absorbed to raise the temperature

Know more about heat

https://brainly.com/question/22406880

#SPJ1

1.5 moles of Al is how many
atoms?

Answers

Answer:

9.03 × 10²³ atoms

Explanation:

The number of atoms of Al can be found by using the formula

N = n × L

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 1.5 × 6.02 × 10²³

We have the final answer as

9.03 × 10²³ atoms

Hope this helps you

How does fear affect your body?

Answers

Answer:

Fear weakens our immune system and can cause cardiovascular damage. Fear can cause damage to some parts of our brains. Fear can interrupt processes in our brains that allow us to regulate emotions.

Explanation:

Hope this helps:)........if not then sorry for wasting your time and may God bless you:)

Having energy in the reactant lead to an exothermic reaction.
true
false​

Answers

Answer:

false

Explanation:

first of all;-energy lead to an indotermic reaction.

indotermic is a reaction that absorbs energy \

*it has positive enthalpy of reaction

*Heat content of product is greater than that of reactant

*Heat is added to reactant side

example;- CO^2+2H^2+891kj --------- CH4 +2O2

What is the molecular geometry of PBr3? A. trigonal pyramidal B. trigonal planar C. linear D....

Answers

The correct answer is:

TRIGONAL PYRAMIDAL

The geometry of PBr₃ is trigonal pyramidal. Therefore, option A is correct.

Trigonal pyramidal geometry refers to the molecular geometry around a central atom in a molecule or ion where there are three bonded atoms and one lone pair of electrons. This geometry is commonly found in molecules with a central atom surrounded by three bonding pairs and one non-bonding pair of electrons.

The term "trigonal" refers to the arrangement of the three bonding pairs, which are positioned in a flat, triangular shape around the central atom. The term "pyramidal" indicates that the lone pair of electrons occupies the fourth position, giving the molecule a three-dimensional pyramid-like shape.

Learn more about trigonal pyramidal geometry, here:

https://brainly.com/question/29753855

#SPJ6

Fatty acid groups are referred to as ________ groups.

A) Acetyl
B) Acyl
C) Prenyl
D) Isoprenoid
E) Isopentenyl

Answers

Fatty acid groups are referred to as B) acyl groups.

Fatty acids are organic compounds that consist of a long hydrocarbon chain with a carboxyl group (-COOH) at one end. The hydrocarbon chain is composed of carbon and hydrogen atoms, and its length can vary. Fatty acids play essential roles in various biological processes and are major components of lipids, including triglycerides and phospholipids.

When a fatty acid is involved in chemical reactions or is attached to other molecules, it typically undergoes a process called activation, where it is converted into an acyl group. An acyl group is formed by replacing the -OH (hydroxyl) group of the carboxyl group with an -OR (alkoxy) group. The -OR group can be derived from various molecules, such as coenzyme A (CoA) or other acyl carrier proteins.

For example, when a fatty acid is activated for incorporation into a triglyceride molecule, it forms a triglyceride acyl group. Similarly, when a fatty acid is incorporated into a phospholipid molecule, it forms a phospholipid acyl group. The acyl group represents the hydrocarbon chain of the fatty acid, which may vary in length and saturation.

Therefore, the correct answer to the question is B) Acyl.

Learn more about Fatty acids https://brainly.com/question/27960389

#SPJ11

When will the simping end

When will the simping end

Answers

Answer:

Nvr XD

Explanation:

Answer:

the world may never know

Explanation:

How many joules of heat is needed when 5 g of water is heated from 25°C to 75°C?

Answers

Answer:

1045 J

Explanation:

By using the formula Eh= mass×specific heat capacity × change in tempreture

With it being a known fact that the specific heat capacity of water is 4.16g/j/°c

07.
Name ONE piece of apparatus used in each of the following separation techniques?
Filtration:..
Evaporation. Evaporating.disn
Sublimation;.
Distillation; Dustallation flash
Decantation:......
Crystallization;
Chromatography:.

Answers

Filtration is a separation method used to separate out pure substances in mixtures comprised of particles some of which are large enough in size to be captured with a porous material. Particle size can vary considerably, given the type of mixture.

Evaporation is a technique used to separate out homogeneous mixtures that contain one or more dissolved salts. This process drives liquid components out of solid components. This process usually heats the mixture until the liquid is gone.

Distillation is an effective method of separating mixtures of two or more pure liquids. Distillation is a purification process that vaporizes, condenses, and separates the components of a liquid mixture.

Chromatography is the separation of a mixture by passing it in solution or suspension, or as a vapor through a medium in which the components move at different rates. Thin-layer chromatography is a special type of chromatography used for separating and identifying mixtures that are or can be colored especially pigments.

Learn more about Separation techniques here:-https://brainly.com/question/24645716

#SPJ9

Your friend has just started a mining company and has asked you to help and talk to his newly recruited staff about identification of rocks and minerals

Prepare a presentation (not more than 200 words) to be delivered to the staff about rocks and minerals and how they can be identified.

Answers

Answer:

Good day everyone, I am here to talk to you about rocks and minerals and how to identify them.

First, let's define what rocks and minerals are. Rocks are made up of two or more minerals and can be classified into three main types: igneous, sedimentary, and metamorphic. Minerals, on the other hand, are naturally occurring inorganic substances with a definite chemical composition and crystal structure.

Now, when it comes to identifying rocks and minerals, there are a few key things to look out for. One is the color - minerals can come in a wide range of colors, and certain colors can indicate specific types of minerals. Another factor to consider is the texture - does the rock feel smooth or rough, and are there any visible grains or crystals? Additionally, the hardness of a mineral can be a helpful clue, as can its reaction to acid or other chemicals.

There are also various tools and techniques that can be used to aid in the identification process, such as a magnifying glass, streak test, and acid tests. It's important to use caution when handling certain minerals, as some can be toxic or contain harmful substances.

What are the 4 different types of bonds and how are they formed?

Answers

There are four types of chemical bonds essential for life to exist: Ionic Bonds, Covalent Bonds, Hydrogen Bonds, and van der Waals interactions. We need all of these different kinds of bonds to play various roles in biochemical interactions. These bonds vary in their strengths.

To play a variety of roles in biochemical interactions, we require all of these diverse sorts of linkages. The tensile strength of these linkages varies. In chemistry, we consider the range of strengths between ionic and covalent bonds to be overlapping. This indicates that in water, ionic bonds usually dissociate. As a result, we shall consider these bonds from strongest to weakest in the following order:

Covalent is followed by ionic, hydrogen, and van der Waals.

To know more about 4 different types of bonds, visit;

brainly.com/question/17401243

#SPJ4

Write the symbol of atoms as per John Dalton.

please tell fast​

Answers

Answer:

In his 1805 work, "A New System of Chemical Philosophy," Dalton propounded the tenets of his atomic theory: The chemical elements are made of atoms. The atoms of an element are identical in mass. Atoms of different elements have different masses.

Hope it helps.... If yes mark me as brilliants

How many double bonds are in CO2?
O 1
o 2
O 3

How many double bonds are in CO2?O 1o 2O 3

Answers

Explanation:

In CO₂ there's 2 double bonds.

Structure:

O=C=O (linear) (180°)

Therefore,

Option C is correct✔

Write an expression for the solubility product constant (ksp) of magansese (ii) hydroxide, mn(oh)2

Answers

The expression for the solubility product constant (ksp) of manganese (II) hydroxide, Mn(OH)2, is: ksp = [Mn2+][OH-]^2
where [Mn2+] represents the concentration of manganese ions and [OH-] represents the concentration of hydroxide ions in a saturated solution of Mn(OH)2.


An expression for the solubility product constant (Ksp) of manganese (II) hydroxide, Mn(OH)₂.

Step 1: Write the balanced chemical equation for the dissolution of Mn(OH)₂:
Mn(OH)₂ (s) ⇌ Mn²⁺ (aq) + 2OH⁻ (aq)

Step 2: Write the expression for Ksp:
Ksp = [Mn²⁺][OH⁻]²

In this expression, [Mn²⁺] represents the concentration of Mn²⁺ ions and [OH⁻] represents the concentration of OH⁻ ions in the solution at equilibrium. The solubility product constant, Ksp, is the product of these concentrations raised to their respective stoichiometric coefficients from the balanced chemical equation.

To know about solubility visit:

https://brainly.com/question/29661360

#SPJ11

A molecule of ethanol has two carbon atoms, six hydrogen atoms, and one oxygen atom. A ball-and-stick model of a molecule of ethanol is made from the following components: one red ball two black balls six white balls eight sticks What do the black balls in the model represent? (1 point) oxygen atoms carbon atoms bonds between atoms hydrogen atoms

Answers

what are the answers

Explanation:

got this and dont know what it is

The correct answer is- The black balls represent carbon atoms.

Molecular models are three dimensional representations of a a molecule that enables us to visualize the molecule.

Molecules are represented by three dimensional models. These models help us to really have a firm grasp of what the molecule should look like.

In this particular question, we are told that ethanol has two carbon atoms, six hydrogen atoms, and one oxygen atom.

Also, we have; one red ball two black balls six white balls eight sticks What do the black balls in the model.

This implies that the two black balls must represent carbon atoms from the information provided.

https://brainly.com/question/1389682

A molecule of ethanol has two carbon atoms, six hydrogen atoms, and one oxygen atom. A ball-and-stick

11. Apply Concepts You weigh a spoonful of baking soda and 10 mL of vinegar. Then you mix them together. You see that there is quite a bit of fizzing. You weigh the products after the reaction and find there is mass missing. Does the loss of mass disprove the law of conservation of mass? If not, how could you prove it? Please help I have to turn this in before midnight on canvas before its locked.​

Answers

Answer:

The loss of mass does not disprove the law of conservation of mass because the evaporated fizz goes into the air. Same with lakes when there is a big body of water, but it slowly starts to look like a smaller body of water. This is because the water evaporates, but the mass is not destroyed it is just being coverted into gas.

Explanation:

Help with # 29 pleaseUsing Bohr's equation for the energy levels of the electron in they Hydrogen atom, determine the energy in J of an electron in the n=4 level.

Help with # 29 pleaseUsing Bohr's equation for the energy levels of the electron in they Hydrogen atom,

Answers

Using Bohr's equation for the energy levels of the electron in the Hydrogen atom, determine the energy in J of an electron in the n=4 level.

According to Boh'rs equation we can calculate the energy using this equation:

En = - 2.18 * 10⁻¹⁸ J / (n²)

So if we want to find the energy we only have to replace n by 4 and solve that calculation:

since n = 4

En = - 2.18 * 10⁻¹⁸ J / 4²

En = - 2.18 * 10⁻¹⁸ J / 16

En = -1.36 * 10⁻¹⁹ J

So the answer is option D

What is the purpose of adding sodium carbonate to the brewed tea prior to extraction?.

Answers

Sodium carbonate is added to the brewed tea before extraction, as it raises the pH of the tea from acidic to slightly alkaline. This increase in pH helps to change the structure of the tannins in the tea, which improves the extraction of caffeine and other compounds from the tea leaves. This process of adding sodium carbonate to tea before extraction is called alkalization.

Sodium carbonate, which is commonly known as washing soda or soda ash, is a white, odorless, and water-soluble powder. It is frequently used in the food and beverage industry as a buffering agent to maintain the pH of acidic foods. Sodium carbonate is added to the brewed tea before extraction, as it raises the pH of the tea from acidic to slightly alkaline. The increase in pH changes the structure of the tannins in the tea, which results in an improvement in the extraction of caffeine and other compounds from the tea leaves. This process of adding sodium carbonate to tea before extraction is called alkalization.

The chemical structure of tannins is responsible for the bitterness and astringency of tea. The higher the pH of tea, the more water-soluble are the tannins. Alkalization increases the water solubility of tannins, which helps in the extraction of caffeine, catechins, and other compounds from tea leaves. The addition of sodium carbonate also results in the conversion of some of the tannins to a more stable form, which helps to reduce the bitterness and astringency of the tea.

The purpose of adding sodium carbonate to the brewed tea before extraction is to increase the pH of the tea from acidic to slightly alkaline, which changes the structure of the tannins in the tea. This leads to an improvement in the extraction of caffeine and other compounds from the tea leaves, and also reduces the bitterness and astringency of the tea.

To know more about caffeine visit:

brainly.com/question/11435274

#SPJ11

c) Can two electrons have same set of all four quantum numbers? Justify.​

Answers

It is not possible for two electrons to have the same set of all four quantum numbers in an atom, as it would violate the Pauli exclusion principle.

According to the Pauli exclusion principle, no two electrons in an atom can have the same set of all four quantum numbers. The four quantum numbers used to describe an electron's state are the principal quantum number (n), the azimuthal quantum number (l), the magnetic quantum number (m), and the spin quantum number (s).

The principal quantum number (n) determines the energy level of an electron and can have integer values starting from 1. The azimuthal quantum number (l) determines the shape of the electron's orbital and can have values from 0 to (n-1). The magnetic quantum number (m) determines the orientation of the orbital and can range from -l to +l. The spin quantum number (s) describes the spin of the electron and can have two possible values, +1/2 or -1/2.

Since each electron in an atom must occupy a unique set of quantum numbers, they must differ in at least one of the four quantum numbers. This ensures that no two electrons have the exact same quantum state.

For such more questions on atom

https://brainly.com/question/6258301

#SPJ8

give the approximate bond angle for a molecule with t-shape molecular geometry. a. 90° b.<90° c.120° d. 109.5°

Answers

The approximate bond angle for a molecule with a t-shape molecular geometry is d. 109.5°. This is because the three bonded atoms in this geometry are arranged in a trigonal bipyramidal arrangement, with bond angles of 120° between them.

However, the presence of the two lone pairs of electrons pushes the bonded atoms closer together, reducing the bond angle to 109.5°. This is known as the distorted tetrahedral angle.

The t-shape molecular geometry is a type of molecular shape where there are three bonded atoms and two lone pairs of electrons. This geometry is typically found in molecules such as ClF3. In this geometry, the bond angles between the atoms are not all the same. The two lone pairs of electrons occupy two of the equatorial positions, while the three bonded atoms occupy one equatorial and two axial positions.
It is important to note that the bond angles in a molecule with t-shape molecular geometry may not be exactly 109.5° due to various factors such as lone pair-bonded atom repulsion and bond-bond repulsion. Nonetheless, this value serves as a good approximation for the bond angle in this molecular geometry.

To learn more about t-shape molecular geometry, refer:-

https://brainly.com/question/31162132

#SPJ11

Why is it necessary to know the temperature of the reactants and the products of a reaction in order to determine change in the Gibbs free energy of the reaction

Answers

Answer:

Free Energy (G) can either increase or decrease for a reaction when the temperature increases. It depends on the entropy (S) change. The change in a quantity is represented by the Greek letter delta. ... Hence, when the temperature increases the numeric value of the free energy becomes larger.

Explanation:

The change in Gibbs free energy (ΔG) of a chemical reaction depends on the initial and final states of the reactants and products, as well as on the temperature and pressure conditions of the reaction.

What is Gibb's free energy?

The Gibbs free energy of a reaction tells us whether a reaction is spontaneous or not under given conditions, with negative ΔG values indicating a spontaneous reaction and positive ΔG values indicating a non-spontaneous reaction.

The temperature of the reactants and products is important in determining the Gibbs free energy change because the Gibbs free energy change is related to the enthalpy change (ΔH) and the entropy change (ΔS) of the reaction through the equation:

ΔG = ΔH - TΔS

where T is the temperature in Kelvin.

Thus, the temperature of the reactants and products must be known in order to calculate the Gibbs free energy change of a reaction accurately.

To learn more about the Gibb's free energy, follow the link:

https://brainly.com/question/20358734

#SPJ3

what effect will increasing the volume of the reaction mixture have on the system? 2h2s 3 o2 = 2h2o 2so2

Answers

Increasing the volume of the reaction mixture will have an effect on the system according to Le Chatelier's principle.

In this particular reaction, which represents the combustion of hydrogen sulfide (H2S) with oxygen (O2) to form water (H2O) and sulfur dioxide (SO2), there are a few factors to consider.

By increasing the volume, the pressure in the system decreases. In response to this change, the system will attempt to counteract the decrease in pressure by favoring the side of the reaction with a higher number of moles of gas.

In the given reaction, the reactants (H2S and O2) have a total of 5 moles of gas, while the products (H2O and SO2) have a total of 4 moles of gas. Therefore, the reaction will shift towards the side of the reaction with a higher number of moles of gas, which is the reactant side.

As a result, increasing the volume will shift the equilibrium towards the reactant side, promoting the formation of more H2S and O2, and thus favoring the production of more water and sulfur dioxide.

To know more about  refer Le Chatelier's here

brainly.com/question/29009512#

#SPJ11

Make a suggestion on how you will deal with the problem..

Make a suggestion on how you will deal with the problem..

Answers

Answer:

and the last name then select a City the solution if they are getting elimination method if I can tell u that is telling you about me to this email and delete this email and any attachments may contain confidential information and rupees hundred years ago the pair in the solution if I can tell you my story of my teacher not respond please ask me to this email and any attachments is intended only for the independence of Bangladesh and what is the correct answer is yes we have to come at your earliest convenience and what is the correct answer

Answer:

If you are asking to suggest a method to preserve the extinction of this species of pigeon then

1. Governments should derive a law that will prevent hunting of these pigeons.

2. These pigeons should be given a place in sanctuaries with hospitable habitat made available.

3. If someone sees a bird of this kind care should be taken not to harm it intentionally or accidentally.

4. Breeding this type of Birds should be Promoted to increase their number

What is the volume of 3.00 m sulfuric acid that contains 9.809 g of H2SO4 solute (98.09 g/mol)?

Answers

Volume = 33.3 mL=0.0333L ,of 3.00 m sulfuric acid that contains 9.809 g of H2SO4 solute (98.09 g/mol).

In this case, according to the given information,

it is necessary for us remember that the molarity is calculated by dividing the moles by the volume of the solution in litres so the volume is calculated by dividing moles by the given molarity.

However,

               we first need to calculate the mole given the mass and molar mass of the solute, H2SO4:

  n=9.809 g /98.09g/mol  = 0.1 mol

Thus the volume turns out :

V=0.1mol/3.00mol/L

V=0.0333L

V=33.3mL,

Volume = 33.3 mL=0.0333L ,of 3.00 m sulfuric acid that contains 9.809 g of H2SO4 solute (98.09 g/mol).

Learn more about H2SO4 here:

https://brainly.com/question/12004196

#SPJ4

what is CLF full form

Answers

Answer:

compact fluorescent light

How many moles are in 1.78 x 1050 atoms of Mg?

Answers

Answer:

0.296×10²⁷ moles of Mg atoms.

Explanation:

Given data:

Number of moles of Mg = ?

Number of atoms = 1.78 ×10⁵⁰ atom

Solution:

Avogadro number:

It is the number of atoms , ions and molecules in one gram atom of element, one gram molecules of compound and one gram ions of a substance.  The number 6.022 × 10²³ is called Avogadro number.

For example,

18 g of water = 1 mole = 6.022 × 10²³ molecules of water

1.008 g of hydrogen = 1 mole = 6.022 × 10²³ atoms of hydrogen

Number of moles of Mg atoms:

1.78 ×10⁵⁰ atom × 1 mol  /6.022 × 10²³ atoms

0.296×10²⁷ moles of Mg atoms.

There are 2.96 x \(10^{26}\) moles in 1.78 x \(10^{50}\) atoms of Mg. Avogadro's number is the number of particles.

Moles are a fundamental term in chemistry that is used to quantify the amount of a material. A mole is the amount of a substance that has the same number of particles (atoms, molecules, ions, and so on) as there are atoms in exactly 12 grammes of carbon-12. Understanding the idea of moles is necessary for many chemistry calculations, including as stoichiometry, empirical formulae, percent composition, and molar concentration.

Number of moles = Number of atoms / Avogadro's number

Number of moles = (1.78 x \(10^{50}\)atoms) / (6.022 x \(10^{23}\) atoms/mol)

Number of moles ≈ 2.96 x \(10^{26}\) mol

To know more about mole, here:

https://brainly.com/question/34260877

#SPJ6

an alpha particle interacts with an oxygen-16 nucleus to form a neon-20 nucleus. what type of nuclear reaction does this exemplify? justify your answer.

Answers

The interaction described, where an alpha particle (helium-4 nucleus) interacts with an oxygen-16 nucleus to form a neon-20 nucleus, exemplifies a nuclear reaction known as nuclear fusion.

Nuclear fusion is the process in which two or more atomic nuclei come together to form a heavier nucleus. In this case, the alpha particle (helium-4 nucleus) is fusing with the oxygen-16 nucleus to produce a neon-20 nucleus. Nuclear fusion reactions involve the release of a significant amount of energy due to the conversion of mass into energy, as described by Einstein's famous equation E = mc^2. This energy release is the driving force behind processes like the sun's energy production and the development of hydrogen bombs.

The fusion of light elements, such as the fusion of hydrogen isotopes in stars, is responsible for the immense energy output and is a fundamental process in the universe. In this specific reaction, the fusion of an alpha particle with an oxygen-16 nucleus leads to the formation of a heavier nucleus, neon-20, and is an example of a nuclear fusion reaction.

To learn more about Nuclear fusion click here

https://brainly.com/question/12701636

#SPJ11

Here is a single-strand of DNA:
3’ – ACCTAGGACAAAGGTTTCACGCG – 5’
either above or below this strand, write the complementary strand of DNA. Include which end is the 5’ end and which is the 3’ end.
if the original strand is the template for the leading strand, draw an arrow indicating which direction DNA synthesis will proceed
If the original strand is the template strand of a gene being transcribed, draw and arrow indicating which direction RNA synthesis will proceed
Write the sequence of the RNA molecule that would be transcribed from the original strand of DNA. Label the 5’ and 3’ ends

Answers

The complementary DNA strand of the given single-stranded DNA is as follows:5' -  3'The 5' end of the DNA strand has the phosphate group attached to it, whereas the 3' end has a hydroxyl group attached to it.

Therefore, in the given DNA strand, the 3' end is on the right-hand side and the 5' end is on the left-hand side.If the original strand is a template for the leading strand, DNA synthesis will proceed in the 3' to 5' direction. The arrow will point from left to right.If the original strand is a template strand of a gene being transcribed, RNA synthesis will proceed in the 5' to 3' direction. The arrow will point from right to left.

The sequence of the RNA molecule that would be transcribed from the original strand of DNA is:5' -  3'The 5' end of the RNA strand has the phosphate group attached to it, whereas the 3' end has a hydroxyl group attached to it. Therefore, in the given RNA strand, the 3' end is on the right-hand side and the 5' end is on the left-hand side.\

To know more about phosphate group visit :

https://brainly.com/question/911397

#SPJ11

When moving across a row in the Periodic Table, which of the following increases?

Answers

I believe it’s atomic number if I remember correctly

Explain how a common housecat gets “worms.”

No google or else i report you.

Answers

By eating half cooked meat

Other Questions
Which lists all the integer solutions of the equation |x| = 7? 7 and 7 7 only 0 and 7 7 only The angle of elevation of the sun is decreasing at a rate of 1/3 radians per hour. How fast is the length of the shadow cast by a 10 m tree changing when the angle of elevation of the sun is /3 radians? Which expression shows the factored form of 16x + 12y - 4 PLZZZZZZZ HELP I WILL LIST YOU BRIANESTanswers:4(4x +3y)4(4x +3y 1)16(x +4y 12)A.14xy Given the Stolper-Samuelson theorem, in a model of North-South trade, we would expect:a.In the South, labor will lose.b.In the North, physical capital will lose.c.In the North, physical capital will gain.d.In the South, both factors will lose.Trade occurs because of _______ in the availability of factor inputs across countries and the differences in the proportions of those factors that are used in producing different goods. Trade causes _______ in the export-oriented sector and _______ in the import-competing sector.a.differences; expansion; contractionb.similarities; contraction; expansionc.differences; contraction; expansiond.similarities; expansion; contractionIn the context of North-South trade,a.the South is considered to have comparative advantage in CIGs.b.the South is considered to have comparative advantage in LIGs.c.the South is considered to have comparative advantage in both CIGs and LIGs.d.the South is considered to do none of the above.The Heckscher-Ohlin theory explains comparative advantage as the result of differences in countries':a.Relative abundance of various resourcesb.Economies of large-scale productionc.Research and developmentd.Relative costs of labor Design an intelligent reinforcement learning based multi-agent system for hospital management. what will be function of different agents in this case? what will be peas for these agents? is it possible to have two different types of agents in multi-agent system? On question 34, the last word is inches:>No links A store manager selects 30 cartons of egggs and finds 4 cartons that have cracked eggs. If the store has 105 cartons of eggs, how many cartons can she expect to have cracked eggs in them. Help~... It's "Science". ^W^Which term is used to describe the variety of inheritable traits in a species? (1 point)A. Ecosystem diversityB. Genetic diversityC. Natural selectionD. Species diversity stark company's most recent balance sheet reported total assets of $2,080,000, total liabilities of $710,000, and total equity of $1,370,000. its debt-to-equity ratio is:a. 0.52b.034c.1.00d 1.93e. 0.66 Question 2: What are the main difficulties of developing large tidal range power schemes? _________would result in a shift the hemoglobin-oxygen dissociation curve to the right. Select the correct statement(s) to fill in the blank. a. An increase in PCO2 b. An increase in temperature c. An increase in pH d. (a) and (b) are correct; (c) is incorrect e. (a), (b), and (c) are all correct Whats the shortest sides in triangle ABC?A) ABB) ACC) BC students with multiple disabilities often have motor impairments that produce the sequence of the referral method of handling objections is important. which of the following illustrates the correct sequence for the method? 13: 3 Simplify the left side of the eq 106. Find a linear differential operator that annihilates the given function. (Use D for the differential operator.) cos 2x The Workingman's Parties would praise what twenty-first-century activity? this mystic branch of islam has a more free and open approach to music, without restrictions that are enforced in stricter branches the most emphatic positions in a message are the . a. body and attachments b. body and closing c. opening and closing d. opening and body Procter & Gamble Company reported impairment losses for the impairment of goodwill and other intangible assets in 2019. Referring to Procter & Gamble 's 2020 annual report, address the following:State the amounts of impairment losses of goodwill and other intangible assets.(3.5 marks)Which cash generating unit suffered an impairment loss related to goodwill and other intangible asset? (1.5 mark)What were the underlying business reasons that required Procter & Gamble to record a goodwill impairment in 2019? (5 marks)How did Procter & Gamble reflect the 2019 goodwill impairment in its income statement and cash flow statement? (3 marks)Which method did Procter & Gamble use in preparing its cash flow statement? Provide a proof for your answer. (2 marks)Almost all businesses have been badly affected by the spread of Covid-19 in 2020. Nevertheless, Procter & Gamble's 2020 annual report shows that net income in 2020 is significantly higher than net income in 2019. Give an explanation for this situation and provide evidence from annual report. (3 marks)Write your answer in the space provided in the following table:AnswerPage(s) in Annual reportAmounts of impairment lossescash generating unit(s) suffered an impairment loss of goodwillthe underlying business reasons that required Procter & Gamble to record a goodwill impairmentHow did Procter & Gamble reflect the 2020 goodwill impairment in its income statement and cash flow statement?Which method did Procter & Gamble use in preparing its cash flow statement? Proof your answer.Give an explanation for this situation and provide evidence from annual report.