________ regulation occurs within a cell when the newly formed protein is modified.

Answers

Answer 1

Post-translational regulation occurs within a cell when the newly formed protein is modified.

What is Post-translational regulation?

After being synthesized, folded, and put together, proteins can undergo post-translational modification. It has been shown that a variety of post-translational changes take place inside cells. Any alteration that can be made to a protein can also be undone. A post-translational alteration can take many distinct forms.

The process generally entails the formation of a covalent bond connecting a particular chemical group to a particular set of amino acid side chains on the protein. These groups can include phosphate groups (phosphorylation), acetate groups (acetylation), the attachment of lipid/hydrophobic groups (lipid modification), or carbohydrates (glycosylation). The majority of these post-translational changes are reversible; one enzyme adds the modifying group, and another enzyme can take it away.

For example, protein kinases phosphorylate proteins, while protein phosphatases remove such phosphate groups. Similar to allosteric effectors, post-translational changes alter the structure of the polypeptide to which they are bound, which therefore affects the polypeptide's activity. Additionally, they can alter a protein's stability, localization within the cell, and interactions with other proteins.

Learn more about post-translational here:

https://brainly.com/question/27225315

#SPJ4


Related Questions

A student examines two bacterical cells, Cell I and cell II. He finds that cell I produces CO₂ and ethyl alcohol during cellular respiration while cell II produces carbon dioxide and water. What conclusions can you draw from his observation?​

Answers

If a student examines two bacterial cells, Cell I and Cell II, and he finds that cell I produce CO₂ and ethyl alcohol during cellular respiration while cell II produces carbon dioxide and water, then the conclusions are that cell I produce energy by Fermentation, while cell II produce energy by cell respiration.

What is cell respiration?

Cell respiration is a process that aerobic organisms use to produce energy, which releases carbon dioxide and water as byproducts of such chemical reactions in the organism.

Therefore, with this data, we can see that cell respiration produces energy and carbon dioxide, whereas fermentation does not produce carbon dioxide.

Learn more about cell respiration here:

https://brainly.com/question/14158795

#SPJ1

The bonds or interactions between stacked nucleotide units that help hold the dna molecule together are:.

Answers

Answer:

van der waals interaction

The chemical signals that travel from one neuron to another, enabling them to communicate with one another, are called:

Answers

Answer:

The chemical signal is called a neurotransmitter. Neurotransmitters allow the billions of neurons in the nervous system to communicate with one another.

Explanation:

A child dies following a series of chronic bacterial infections At the autopsy, the physicians are startled to see that the child's white blood cells are loaded with vacuoles containing intact bacteria. Which of the following explanations could account for this finding?

Answers

White blood cells' defective lysosomes prohibited them from killing engulfed bacteria.

What do white blood cells do?

The body's immune system includes white blood cells. They aid the body in the battle against illness and infection. The three different types of white blood cells are lymphocytes, monocytes, and granulocytes (neutrophils, eosinophils, and basophils) (T cells and B cells).

What causes chronic bacterial infections?

Most often, bacterial "persisters"—a small subpopulation of bacteria that manages to survive an antibiotic onslaught by effectively shutting down and "sleeping" through it, even as their counterparts, who are awake, are killed off—are the source of chronic and recurrent infections.

To know more about White blood cells visit:

https://brainly.com/question/10736124

#SPJ9

Explain the role of both biotic and abiotic factors within a nutrient cycle.

Answers

Answer:

Answer. Biotic factors are the living things in an ecosystem so they do not recycle. Abiotic factors are the different physical and chemical components available like temperature, air, water, minerals, rocks,and PH. Not ll of them are recycled.

The role of both factors within a nutrient cycle is very important  because nutrients cycling through biotic and abiotic systems constantly.

Explain the role of both biotic and abiotic factors within a nutrient cycle?

Plants, animals, microorganism and organic matter are the biotic locations of nutrients while on the other hand, the atmosphere, water, and soil represent the abiotic locations. Nutrients are constantly moving or cycling through biotic and abiotic systems.

So we can conclude that the role of both factors within a nutrient cycle is very important  because nutrients cycling through biotic and abiotic systems constantly.

Learn more about cycle here: https://brainly.com/question/7196669

#SPJ2

this group have a brain with a nerve cord,a sac-like or branched gut and lack a circulatory system.

Answers

This group refers to organisms that have a brain with a nerve cord, a sac-like or branched gut, and lack a circulatory system.

The correct answer is "cnidarians", which includes jellyfish, sea anemones, and corals. Here are some additional points of information:

Cnidarians are a group of aquatic invertebrates that are found in both marine and freshwater environments.They have radial symmetry, meaning their bodies are arranged around a central axis.Cnidarians are characterized by their cnidocytes, which are specialized cells that contain stinging structures called nematocysts.They use these stinging cells for self-defense and to capture prey.The sac-like gut of cnidarians has a single opening that functions as both the mouth and anus.Cnidarians are important members of marine ecosystems and play a role in maintaining ecological balance.

These are a diverse group of organisms that can be found in a variety of habitats, including freshwater and marine environments, as well as moist terrestrial environments.

Learn More About circulatory system

https://brainly.com/question/3597250

#SPJ11

Explain why most parasites do not kill their host. Why is it in their own best interest to keep their host alive?

Answers

Answer:

Most parasites do not kill their host because their survival depends on the host's survival. The host provides the parasite with a habitat and a source of nutrients, which the parasite cannot obtain on its own. If the parasite kills the host, it will lose its source of food and shelter, which will ultimately lead to its own death. Therefore, it is in the parasite's own best interest to keep the host alive as long as possible to ensure its own survival.

Additionally, killing the host too quickly may also reduce the chances of transmission of the parasite to other potential hosts. If the host dies too quickly or its behavior changes too dramatically due to infection, other potential hosts may be alerted to the presence of the parasite and take measures to avoid infection. So, by keeping the host alive, the parasite increases the chances of its own transmission to other hosts.

Overall, while parasites may cause harm to their host, it is usually not in their best interest to kill them. They have evolved to coexist with their host in a way that maximizes their own chances of survival and transmission.

How could you use negative reinforcement to stop a dog from biting when it plays?

Answers

Answer:

Simple. You don't.

Explanation:

Not gonna be mean to my dog. No way.

Answer: give him a snack instead

Explanation: just don’t bite him back, your a human being at all

Which of the following organisms would best be identified as a species using the biological species concept?
a. a population of mice living on a mountaintop where the nearest population of mice is 50 miles away
b. a bacteria found living in the human gut with thousands of other bacteria
c. dinosaurs identified by morphologically similar fossil remains located in a single valley in South America
d. a rare plant living in a remote location in Peru that reproduces asexually

Answers

The organism that would best be identified as a species using the biological species concept is B) a bacteria found living in the human gut with thousands of other bacteria.

The biological species concept defines a species as a group of organisms that can interbreed and produce viable offspring. In this case, the bacteria living in the human gut form a population that can exchange genetic material with each other, potentially producing viable offspring.

Option A is not a good example for the biological species concept because even though the two populations of mice are geographically isolated, they could still interbreed if brought together.

Option C is not suitable because it relies on morphological similarity, which is not always a reliable indicator of genetic relatedness. Option D is not ideal because asexually reproducing organisms do not exchange genetic material and therefore do not fit within the biological species concept.

For more questions like Bacteria click the link below:

https://brainly.com/question/2186892

#SPJ11

compare the processes of anaeorbic respiration in muscle and plant cells

Answers

The processes of anaerobic respiration in muscle cells and plant cells differ in terms of the end products produced and the location where they occur. In muscle cells, anaerobic respiration primarily occurs during intense exercise when the demand for energy exceeds the available oxygen supply. The process, known as lactic acid fermentation, converts glucose into lactic acid, generating a small amount of ATP in the absence of oxygen. This process allows muscle cells to continue functioning temporarily without oxygen but can lead to the buildup of lactic acid, causing fatigue and muscle soreness.

On the other hand, plant cells undergo anaerobic respiration in certain circumstances, such as during periods of low oxygen availability in waterlogged soil. Plant cells employ a process called alcoholic fermentation, where glucose is converted into ethanol and carbon dioxide, releasing a small amount of ATP. This process occurs mainly in plant tissues like roots, germinating seeds, and some fruits.

1. Anaerobic respiration in muscle cells: During intense exercise, muscle cells undergo lactic acid fermentation to generate energy in the absence of sufficient oxygen.

2. Glucose breakdown: Glucose, a simple sugar molecule, is broken down into pyruvate through a series of enzymatic reactions in the cytoplasm of the muscle cell.

3. Lactic acid production: Instead of entering the aerobic respiration pathway, pyruvate is converted into lactic acid by the enzyme lactate dehydrogenase.

4. ATP production: This conversion of pyruvate to lactic acid yields a small amount of ATP, which can be used as an energy source by the muscle cell.

5. Accumulation of lactic acid: The buildup of lactic acid can cause muscle fatigue, soreness, and a burning sensation during intense exercise.

6. Anaerobic respiration in plant cells: Plant cells undergo alcoholic fermentation in specific conditions where oxygen is limited, such as waterlogged soil.

7. Glucose breakdown: Similar to muscle cells, glucose is broken down into pyruvate through glycolysis in the cytoplasm of the plant cell.

8. Ethanol and carbon dioxide production: In plant cells, pyruvate is further converted into ethanol and carbon dioxide by enzymes like pyruvate decarboxylase and alcohol dehydrogenase.

9. ATP production: This conversion process also yields a small amount of ATP, providing energy for the plant cell in the absence of oxygen.

10. Occurrence in specific tissues: Alcoholic fermentation occurs in plant tissues like roots, germinating seeds, and some fruits when oxygen availability is limited.

11. Release of ethanol and carbon dioxide: Unlike lactic acid, the end products of alcoholic fermentation, ethanol, and carbon dioxide, are released from the plant cell.

In summary, while both muscle and plant cells undergo anaerobic respiration, the specific processes differ in terms of the end products produced (lactic acid vs. ethanol and carbon dioxide) and the conditions in which they occur.

For more such questions on respiration, click on:

https://brainly.com/question/22673336

#SPJ8

8 h2o molecules to 2 h2o molecules

Answers

The conversion of 8 H₂O molecules to 2 H₂O molecules is a chemical change that occurs through a dehydration or condensation reaction. This process involves the removal of water molecules to form a larger molecule and requires energy to occur.

This is a reaction that occurs between two molecules, and results in the formation of a single, larger molecule, while releasing a small molecule, usually water. In this case, the small molecule is water (H₂O), hence the name dehydration or condensation reaction.
During this reaction, the 8 H₂O molecules combine to form 4 H₂O molecules. This reaction is often used in the laboratory to create polymers from monomers. It can also be used to produce certain biomolecules such as carbohydrates, proteins, and nucleic acids, as well as other chemical compounds.
In order to carry out this reaction, energy is required. The reaction occurs in several steps and involves the removal of water molecules from the original 8 H₂O molecules, forming a new, larger molecule. The reaction is reversible, which means that it can be carried out in both directions, depending on the conditions and reactants involved. Thus, the conversion of 8 H₂O molecules to 2 H₂O molecules is a chemical change that can occur through a process known as dehydration or condensation reaction.


For more such questions on chemical change , visit:

https://brainly.com/question/1222323

#SPJ8

A small child managed to eat a bit of dirt while playing outside. Which of the following would prevent the child from getting sick from the bacteria ingested?

If there were not a pathogenic bacteria in the dirt
If the child had previously taken antibiotics for that type of bacteria
If the child did not have the vaccination to fight the bacteria
If the child’s cells had complementary receptor molecules that bind to the bacteria

Answers

Answer: option 2

Explanation:.....

Answer: If the child had previously taken antibiotics for that type of bacteria.

3 interesting facts about strokes

Answers

Answer:

Stroke Facts

In 2018, 1 in every 6 deaths from cardiovascular disease was due to stroke.

Someone in the United States has a stroke every 40 seconds. ...

Every year, more than 795,000 people in the United States have a stroke. ...

About 185,000 strokes—nearly 1 of 4—are in people who have had a previous stroke.

 I gave you more than three just in case you don't think of one

tại sao lại có sấm sét

Answers

Khi hai đám mây tích điện trái dấu lại gần nhau, hiệu điện thế giữa chúng có thể lên tới hàng triệu vôn. Giữa hai đám mây có hiện tượng phóng tia lửa điện và ta trông thấy một tia chớp. Vài giây sau ta mới nghe thấy tiếng nổ, đó là sấm (do vận tốc ánh sáng nhanh hơn vận tốc của tiếng động nên ta trông thấy tia chớp trước). Khi đám mây dông tích điện đi gần mặt đất tới những khu vực trống trải, gặp một vật có độ cao như cây cối, người cầm cuốc xẻng… thì sẽ có hiện tượng phóng tia lửa điện giữa đám mây và mặt đất. Đó là hiện tượng sấm sét.

what relatively recent fossil discovery has helped us understand the transition between the lobe-finned fishes and the tetrapods?

Answers

Tiktaalik's recent fossil discovery has helped us understand the transition between the lobe-finned fishes and the tetrapods.

Early lobe-finned fishes are hard fish with plump, lobed, matched blades, which are joined to the body by a solitary bone.

The discovery of well-preserved pelves and a portion of the pelvic fin from Tiktaalik roseae, a 375 million-year-old transitional species between fish and the first animals with legs, indicates that improved hind fins were the actual starting point for the evolution of hind legs.

The non-tetrapod Osteichthyes (bony fish) Tiktaalik was discovered in the Arctic of Canada. It has scales and gills, but it has a triangular, flattened head and unusual, cleaver-shaped fins.

know more about Tiktaalik roseae here: https://brainly.com/question/23433591

#SPJ4

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Which of the following examples would an animal welfare activist find acceptable?



a. dogs used for fighting rings

b. free-range pigs killed for their meat

c. cats housed in breeding mills

d. cows kept in crowded pens

Answers

The correct answer is option B, free-range pigs killed for their meat, acceptable. This is because free-range practices allow animals to live in more natural and comfortable conditions before being humanely slaughtered for consumption.


It is illegal and widely condemned by animal welfare advocates and organizations. Dogs are forced to fight each other, resulting in serious injuries and often death. This is not a practice that any animal welfare activist would condone.

Moving on to option b, free-range pigs killed for their meat, this is a more complicated issue. While many animal welfare activists advocate for a plant-based diet and oppose the killing of animals for meat, others may support the ethical treatment of animals raised for food.

Option c, cats housed in breeding mills, is another example of animal cruelty and abuse. Breeding mills are often overcrowded and unsanitary, and the cats are subjected to constant breeding and separation from their offspring. Animal welfare activists would oppose this practice and advocate for the adoption of cats instead of supporting breeding mills.
Option b is more complicated, as some animal welfare activists may support the ethical treatment of animals raised for food, while others advocate for a plant-based diet.

To know more about natural visit:-

https://brainly.com/question/31054297

#SPJ11

List the 3 Parts of the Modern Cell Theory

Answers

Answer:

1. All organisms are made of cells

Cells are the smallest unit of life. Each cell is a membrane of semi-permeable phospholipids wrapped around cytosol or a solution of water and dissolved solutes. All cells rely on DNA to hold the information necessary to produce the molecules they use to obtain energy. Although the methods for obtaining energy vary widely, all organism obtain energy to grow and reproduce. This first tenet of the cell theory is mostly true, but the discovery of viruses lead to complications. Viruses, while they use DNA or RNA to reproduce, do not have cells or cellular membranes. Viruses typically use a host cell to replicate. In this case, the virus appears to be living, but does not create its own cell. Some scientist argue that viruses are not living, thus cell theory is not violated.

2. Cells are the most fundamental unit of life

Organisms can be single cells, which hold all of the components necessary for a metabolism, or they can be more complex. More complex organisms divide the various metabolic tasks into different groups of cells, called tissues. These tissues are arranged in compartments with membranes that separate them from other tissues. These groups of tissues are called organs. A group of organs functioning together is an organism, or an individual creature. Each cell is distinct from the cells next to it, and each functions independently, while contributing to the output of the organism as a whole. Again, modern cell theory is a bit more complicated because advances in science have revealed many different organelles within cells. These organelles are bound in membranes themselves, and serve different functions for eukaryotic cells. Some scientists argue that these are more fundamental units, but other scientists argue that like an organ outside of an organism, they could not function without the cell.

3. Cells come from other cells

As far as we know, no cell on Earth currently has arisen spontaneously. All cells are the result of cell division. When a cell is large enough, it replicates its DNA and important components. These components can then be divided into two daughter cells, which are copies of each other. Variations in the DNA in each cell can lead to changes in how they function, which can result in them dividing at different rates. The cell that reproduces more than the other cell will pass on more of its DNA. The purpose of every cell or organism is to reproduce the DNA in cells.

This third tenet of the cell theory has yet to be disproven. No scientist has ever created a functioning cell without replicating another cell, although some scientists are trying. If they were successful, it would give proof to how life could have evolved. It is thought that a self-replicating molecule mutated, developed the ability to produce a membrane, and thus the first cell was born. The cell was such a successful form of life that all life since has used the same basic template.

The parts of the modern cell theory are:

All living things are made up of at least one cellCell is the basic and fundamental unit of lifeAll cells arise from pre-existing cells

CELL THEORY:

Cell theory is a universally accepted theory that explains the features of life in three statements.

The cell theory was composed in 1890's by three scientists namely: Rudolf Virchow, Mathias Scleiden and Theodor Schwann.

The three parts of the cell theory include the following:

All living things are made up of at least one cellCell is the basic and fundamental unit of lifeAll cells arise from pre-existing cells

Learn more at: https://brainly.com/question/1468725?referrer=searchResults

apply what you know about cooling rates to explain differences in crystal sizes

Answers

The rate of cooling is inversely proportional to the crystal size. The faster the cooling rate, the smaller is the crystal size and the slower the cooling rate, the larger is the crystal.

Rate of cooling can be defined as the elimination or removal of the high temperature from any object. This removal and be slow and gradual, therefore slow rate of cooling; or it cab quick and instant, therefore, fast rate of cooling.

Crystals are the solid components whose molecules are arranges in a regular fashion, giving it an ideal 3 dimensional pattern. They are symmetrical in nature. The examples of crystals are sugars, salt, etc.

To know more about crystals, here

brainly.com/question/1212769

#SPJ1

Krebs , digestive and respiratory system 40 points!!!!!

Krebs , digestive and respiratory system 40 points!!!!!

Answers

Is glycolysis sorry if is wrong

Mitosis is a type of cell division that occurs
I. to make more cells so organisms can grow.
II. so organisms can replace old or damaged cells.
III. when organisms make sex cells for reproduction.
IV. only during fetal stages of development.

Answer Choices:
A. I, II, and III only
B. II, III, and IV only
C. I and II only
D. I and IV only ....​

Answers

Answer:

The correct option is A.

1, 11 and 111 only.

Explanation:

This is because mitosis is a type of cell division in which a single parent cell divide into daughter cells that are genetically identical to the parent cell or have the same number of chromosomes with the parent. This type of cell division occur during growth in the body and when there is need for cell replacement from old or damaged cells. It produce sex cell which are use for sexual reproduction.

Answer:

The correct answer is C. 1 and 11 only

Explanation:

The total stratum area is 803.7 km2. Using the mean elephant density for the stratum that you calculated, calculate an estimated # of elephants that could be found in this stratum.

Answers

I apologize, but I don't have enough information to answer your question. Could you please provide me with more context or details about the stratum you are referring to and the mean elephant density?

Warner is trying hard to complete a biology lab, but it is very difficult. He is more likely to conform to others in this setting because the task seems:

Answers

Answer: difficult

Explanation:

The options to the question are:

difficult.

dispositional.

emotional.

elementary.

Following the information in the question regarding the difficulty in the biology lab that Warner wants to compete, if he doesn't complete, then he'll likely conform to others in this setting because the task seems difficult.

Scientists often work together in teams to solve problems. In 2009, an influenza virus emerged from pigs that went on to infect an estimated 24 percent of the world human population. How could biologists from a variety of fields contribute to studying this widespread disease and developing a treatment, prevention, or cure?

Answers

Answer:

- Professionals in computational modeling and epidemiologists work together to predict how the virus is spreading around the world

- Geneticists and virologists may help to understand the molecular mechanisms involved in virus replication and infection, thereby developing effective therapeutic treatments  

- Professionals in communication sciences and publicists help people to advertise the importance of social distancing and to stay home.

Explanation:

The interdisciplinary cooperation between professionals from different research fields may increase the effectiveness in the fight against pandemic diseases that represent global health concerns. In the first place, global research efforts can be aimed at creating effective therapeutic therapies, including the development of vaccines. Moreover, professionals in computational modeling and epidemiologists work together to predict how a virus is spreading across a country, and these data can be used to flatten the curve of new infections. Furthermore, it is imperative to alert the people how they can avoid infecting themselves and others.

Question 6 An atom has six protons. What is the maximum number of double covalent bonds it can form? OAZ O 8.1 Осо OD.4

Answers

Answer:  the maximum number of double covalent bonds it can form is 2

Explanation:

An atom with six protons is a carbon atom (C). Carbon has four valence electrons, so it can form a maximum of four covalent bonds. Therefore, the maximum number of double covalent bonds it can form is 2.

The atoms or molecules that combine in a chemical reaction are called

Answers

Answer:

In a chemical reaction, the atoms and molecules that interact with each other are called reactants. In a chemical reaction, the atoms and molecules produced by the reaction are called products.

Explanation:

What caused the oxygen levels in Earth’s atmosphere to increase during the Precambrian time? Choose the correct answer.


Land plants evolved and released oxygen as they grew.

The chemical weathering of granite released large quantities of oxygen.

Oxygen dissolved in the ocean was released by osmosis into the atmosphere.

Cyanobacteria consumed carbon dioxide and released oxygen as a waste product.

Answers

The Precambrian era is said to have taken place during the early years of our planet. During this time, the levels of oxygen in the atmosphere were much greater than they are today.

This level of increased oxygen in the atmosphere is a direct result of the biological processes and the sheer number of certain organisms present in Precambrian-era oceans.

Though the options stated all depict ways in which oxygen entered the atmosphere during the Precambrian era, the increase of oxygen levels is credited to the cyanobacteria.

The cyanobacteria were among the few living organisms present on the Earth during this time. They are small algae that use photosynthesis to sustain themselves.

Photosynthesis is known to produce and release oxygen as a waste product. This and the vast number of cyanobacteria present at the time account for the increase in oxygen levels during this era.

To learn more visit:

https://brainly.com/question/474828?referrer=searchResults

What caused the oxygen levels in Earths atmosphere to increase during the Precambrian time? Choose the

Question 10 of 25
Which structure is used by the organism for motion

Question 10 of 25Which structure is used by the organism for motion

Answers

Answer:

I think option A is right answer

because fishes fins are helps in motion

Answer:

The answer is A

Explanation:

Would it be small ( your community, apartment complex, school, etc.), medium ( cities in Mississippi), or large (different communities across many states)?

Answers

Answer:

?????

Explanation:

Someone plz help me!!!

Someone plz help me!!!

Answers

Answer:

either a or c

Explanation:

because

Other Questions
Although HOME scores correlate with IQ scores, the authors of this textbook note that HOME assessments have typically focused on children being raised by biological parents. This may mean that _____ influence(s) both the intellectual quality of the home and children's IQ scores, and thus the home environment itself may not cause children to have higher or lower IQ scores. Two shorter sides of a right-angled triangle are 5 cm and 9 cm. Which is closest to the length of the longest side? Please Show the work. in the vijayanagara sacred center, what was not included in the architectural complex? Jim Crow laws- what they are and how did they affect society? Two stages of a butterfly's life cyles are described below.Stage 1: The caterpillar sheds its skin as it grows.Stage 2: The butterfly breaks out of the chrysalis.Which statement is true about the stages? answer choices) Stage 1 is the adult stage and Stage 2 is the larva stage. Stage 1 is the egg stage and Stage 2 is the larva stage. Stage 1 is the larva stage and Stage 2 is the adult stage. Stage 1 is the pupa stage and Stage 2 is the adult stage. At one time, high school only went up to the 11th grade. Should we go back to this option? Why or Why not? An air conditioner uses 10543 J of energy to run, but only 5818 J of energy is used to heat or cool the air of a home. What is its energy efficiency? helppppp plssssssss.......... ________ is art in which the computer is employed as a primary tool, medium, or creative partner. Largest Province in Canada is____________A.OttawaB.Quebec 1. At what temperature dose water freeze2. at what temperature dose ice melt 3. At what temperature dose water boil what is the area of a circle with a radius of 4 inches? Write a program that asks the user to input a vector of integers of arbitrary length. Then, using a for-end loop the program eliminates all the negative elements. The program displays the vector that was entered and the modi- fied vector, and a message that says how many elements were eliminated Execute the program and when the program ask the user to input a vector type randi (I-15 20],1,25). This creates a 25-ele random integers between-15 and 20. of the following which is the largest body?a. the moonb. Plutoc. Mercury d. Ganymede HELLLLLPPPPPPPPPPPPPPPp ASPAPppp plzzz The Henneman size principal states that the order of fiber recruitment when applying large rapid force isA.type I to type IIa to type IIxB.type IIa to type I to type IIxC.the recruitment of fibers is random (unordered)D.type IIx to type IIa to type I Use the inner productf,g=f(1)g(1)+f(0)g(0)+f(3)g(3) in P2 to find the orthogonal projection of f(x)=3x2+5x6 onto the line L spanned by g(x)=3x25x+5 Which Florida state government department is responsible for the care of children deemed wards of the court?Select one:A.Department of HealthB.Department of Children and FamiliesC.Department of Community Affairs and Economic OpportunityD.Department of Education PLEASE HELP ME I NEED HELP EASY CIRCLES Select the correct answer.