Red flowers (R) are dominant to white flowers (r). Parent 1 has white flowers. Parent 2 is heterozygous.

Answer: (This only works with the Detergent, Water, and Penny experiment on Odyssey-ware)

I observed that after I used the detergent in my experiment, the average droplets I was able to get on the penny decreased drastically. My results seemed to be better before when I was just using the water. This is an example of Capillary action.

The hypothesis becomes the basics of the experiment.

It is common that before we can be able to go forward to carry out the experiment that we must first have a guess that would guide the process of the experiment that we want to perform.

This framework that is going to guide the assumptions that would lead us to a logical conclusion in the experiment that we want to perform is what we call the hypothesis.

It would lead us to be able to answer the questions that have been posed in the study.

Learn more about hypothesis:https://brainly.com/question/29519577

#SPJ1

Which statement best describes how Watson and Crick's model used other scientists' work to create a model of DNA? They used Chargaff's rule to determine that it contains ribose sugar. They used Franklin's photo to determine that DNA was a double helix. They used Levene's work to determine the number of base pairs in each strand. They used Nirenberg and Matthei's studies to determine that DNA is made of nucleotide

The  statement best describes how Watson and Crick's model used other scientists' work to create a model of DNA.

A) They used Chargaff's rule to determine that it contains ribose sugar.

B)They used Franklin's photo to determine that DNA was a double helix.

Watson and Crick used pieces of information available from different researchers such as Chargaff's rules and Franklin.

Chargaff had explained that the four kinds of nucleotides are present in a DNA molecule in such a manner that 2 types of nucleotides were always present in the same amounts and the other 2 types of nucleotides were also always present in the same amounts.

The first X-ray picture of DNA, created by Rosalind Franklin using a technique known as X-ray crystallography, which led to Watson and Crick's model of DNA. It explained the helical shape of the DNA molecule.

Thus, The correct statement is-They used Chargaff's rule to determine that it contains ribose sugar. They used Franklin's photo to determine that DNA was a double helix.

To learn more about  Chargaff's rule click here:

https://brainly.com/question/14702890

#SPJ1

Answer: D not change significantly

Explanation: If you double the amount of enzyme present, the delta G of a reaction will not change. Enzymes are specialized types of proteins used to catalyze or speed up chemical reactions. Although they increase the overall rate of the reaction, they do not affect the net energy change.

Answer:

A. Selective pressure in the form of a new predator

Explanation:

A. Selective pressure in the form of a new predator

A. Selective pressure in the form of a new predator is the most likely factor that caused the noncroaking male population to increase after 2004.

Noncroaking males refer to male bullfrogs that do not produce croaking sounds as a form of communication or mating behavior.

The migration of a bat species that preyed on male frogs likely created a selective pressure on the population, favoring those males that did not croak and thereby avoiding detection by the predator. This would result in a higher proportion of noncroaking males in the population over time as they have a higher likelihood of survival and reproduction.

The increase in the noncroaking male population after the arrival of the bat predator in 2005 could be due to adaptation of the male frogs to the new selective pressure in the form of the predator.

It is possible that the noncroaking males were able to avoid detection by the bat predator better than the croaking males, leading to a higher survival rate and ultimately a higher population.

Additionally, it is possible that the croaking males were more likely to be predated upon, leading to a decrease in their population and an increase in the noncroaking male population.

However, it is also possible that other factors, such as changes in the environment or competition with other species, could have contributed to the observed changes in the bullfrog population over time.

Learn more about bullfrog at:

https://brainly.com/question/28916299

#SPJ5

Answer:

hypothesis is A hypothesis (plural hypotheses) is a precise, testable statement of what the researcher(s) predict will be the outcome of the study.

Explanation:

independent variable is what u can change

dependent variable is the one u can measure

control variable is one u keep the same

control treatment In the design of experiments, treatments are applied to experimental units in a treatment group. In comparative experiments, members of a control group receive a standard treatment, a placebo, or no treatment at all. There may be more than one treatment group, more than one control group, or both

experimental treatment in research, the conditions applied to one or more groups that are expected to cause change in some outcome or dependent variable.

Fragmentation is a form of asexual reproduction and is seen in annelids, fungi, cyanobacteria, sponges, and flatworms.

In Fragmentation, an organism divides itself into a number of fragments. It occurs when an organism completely breaks down independently irrespective of the other parts. Each one of these fragments matures into fully grown adults that are clones of the original organism.

Asexual reproduction usually involves the participation of a single parent alone can produce new offspring. The newly produced individual is genetically identical to one another and its parent. Both multicellular and unicellular organisms divide by fragmentation which is asexual reproduction.

Fragmentation is the most common method of reproduction in lower invertebrates. It is seen in many organisms including filamentous cyanobacteria, algae, lichens, molds, many plants, and animals such as flatworms,  annelid worms, sponges, and sea stars.

Learn more about the fragmentation from the given link.

https://brainly.com/question/29633695

The organisms that can reproduce by fragmentation are Option d Sponges and Sea anemones.

Fragmentation is a form of asexual reproduction in which an organism breaks into two or more fragments, and each fragment develops into a new individual. Both sponges and sea anemones are examples of organisms that exhibit this mode of reproduction.

Sponges are simple multicellular animals that lack true tissues and organs. They possess a porous body structure, and when a sponge is fragmented, each fragment has the potential to develop into a new sponge through regeneration. These fragments contain specialized cells called archaeocytes that can differentiate into various cell types required for the formation of a new sponge.

Sea anemones, on the other hand, are marine animals belonging to the phylum Cnidaria. They have a cylindrical body with tentacles surrounding their mouth. When a sea anemone is fragmented, each piece can regenerate into a complete individual. The process involves the differentiation of cells within the fragments, leading to the development of new tentacles, body parts, and eventually a mature sea anemone.

Both sponges and sea anemones have remarkable regenerative abilities, allowing them to reproduce through fragmentation. This form of asexual reproduction enables them to colonize new areas, expand their population, and adapt to changing environmental conditions. Therefore the correct option is D

Know more about Sea anemones here:

https://brainly.com/question/9933861

#SPJ8

The Question was Incomplete, Find the full content below :

The organisms which can reproduce by fragmentation are:

(a) Corals and Sponges

(b) Corals and Spirogyra

(c) Sea anemone and Spirogyra

(d) Sponges and Sea anemones.

Answer:

Option: cytoplasm

Explanation:

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Vigorous, upward lifting leads to large cloud formations associated with storm systems and consequent severe weather

Large cloud formations connected to storm systems may emerge as a result of vigorous, upward air lifting. Water vapour in the air can condense into water droplets and create clouds when moist air rises and cools. Towering cumulonimbus clouds, which are linked to thunderstorms, torrential downpours, and other severe weather events, can form when lifting is strong and persistent enough.

Fronts, which are the borders of air masses with various characteristics of temperature and humidity, can occasionally cause air to be lifted. Warmer air is quickly lifted as a cold front pushes into a warm air mass, which causes storm development. Similarly, the formation of thunderstorms may result from warm air rising along a dryline—the border between humid and dry air.

Read more about cloud on:

https://brainly.com/question/22339520

#SPJ1

Answer:

The sun should be blocked by the moon.

Answer:

the moon

Explanation:

Some cells in the body have special jobs they are really good at doing. They are called specialized cells.

The human body has lots of tiny cells, and each of them is different and has a special job to do.  This group helps with important things needed to survive.

One type of cells carry oxygen and another type send electrical signals in our body. Specialized cells help the body do important things. Tissues: Groups of similar cells form tissues, such as muscle tissue, connective tissue, and epithelial tissue.

Learn more about   specialized cells from

https://brainly.com/question/7869758

#SPJ1

Answer:

46 chromosomes are present in somatic cell

The answer would be No two people have the same.

It is quite known that there are no two people exists who share the same fingerprint with each other. It is a unique characteristic for each person.

Answer:

I think it is something like 72

Explanation:

i know what you mean

Facilitated diffusion and active transport are two important processes that allow substances to move through a cell membrane. Facilitated diffusion is the movement of substances across a membrane with the help of specific proteins, while active transport is the movement of substances across a membrane requiring energy.

Both processes are essential for cells to take in and expel different substances. An example of facilitated diffusion is the movement of glucose molecules through the cell membrane with the help of a glucose transporter protein. The protein acts as a bridge between the glucose molecules and the cell membrane, allowing them to pass through.

An example of active transport is the movement of sodium and potassium ions across the cell membrane via the sodium-potassium pump. This process requires energy in the form of ATP to pump the ions across the membrane against the concentration gradient.

Describing facilitated diffusion, we can say that it is a passive process that does not require energy, and it involves the movement of molecules across a membrane with the help of proteins. Describing active transport, we can say that it is an active process that requires energy, and it involves the pumping of molecules across a membrane against the concentration gradient.

Learn more about sodium-potassium pump at :https://brainly.com/question/8507057

#SPJ4

Answer:

d

Explanation:

• Chloroplasts ,are found in ,plant and algal cells, and where photosynthesis takes place. ,Plastids, are a more general name for similar organelles found in ,plant and algal cells,, such as chromoplasts.

• The ,cell membrane, is present in ,all cells, and is an indispensable component.

• The nucleus, is found in ,all eukaryotic cells, including animal and plant cells,, and is where the genetic information is located.

• The cell wall ,is located outside of the cell membrane and provides support and protection. It can be found in, plant ,and fungi ,cells,.

• Mitochondria, is where cellular respiration occurs and is present in ,most eukaryotic cells,, including ,animal and plant cells.

• Centrioles ,are part of the cytoskeleton and are found in ,animal ,and fungi ,cells,.

Answer:

The way a mineral's surface reflects or absorbs light is called streak.

Explanation:

……

Answer:

A streak

Explanation:

The way a mineral's surface reflects or absorbs light is called a streak

Answer:

Both natural selection and genetic drift can impact the evolution of a species in different ways. Here are some examples:

Natural selection can cause the evolution of new adaptations that improve the fitness of a population. For example, if a population of birds lives in an environment with two types of seeds, birds with larger beaks may be better able to crack open the larger seeds and have a higher chance of survival and reproduction. Over time, the frequency of the larger beak trait may increase in the population, leading to the evolution of a new adaptation.

Genetic drift can cause the loss of genetic diversity within a population, which can reduce the ability of a population to adapt to changing environmental conditions. For example, if a population of insects experiences a severe reduction in population size due to a natural disaster, certain alleles may be lost from the population due to chance events. This can reduce the genetic diversity of the population and make it more vulnerable to environmental changes in the future.

Explanation:

A microhabitat is an area within a larger habitat that is smaller in size, has certain environmental characteristics, and supports a particular population of species.

An organism lives in a considerably smaller environment known as a microhabitat. Microhabitats are typically used to describe the environments in which tiny animals, such as worms or beetles, reside.

A small area that differs in some manner from the habitat around it is called a microhabitat. It's possible for unique species to live there that are absent from the surrounding area. Unfortunately, a number of habitats are in jeopardy because of weather extremes, pollution, or deforestation.

To know more about microhabitat visit:-

https://brainly.com/question/31230346

#SPJ1

The digestion of starch carbohydrate is initiated in mouth due to the action of starch digesting enzyme ptyalin or salivary amylase present in saliva secreted by salivary glands. Enzymatic hydrolysis helps in the partial breakdown of starch (polysaccharide) into maltose and isomaltose (disaccharides) and small dextrins called 'limit' dextrins. Nearly 30% of the starch is hydrolysed in the oral cavity because of the shorter time the food is retained here

due to the action of starch the carbohydrate digestion occurs first in mouth

An example that shows an organism that cannot reach homeostasis through internal changes is a lizard that is cold, and it moves to a sunny rock to warm up. The correct option is A.

Homeostasis is a process by which organisms maintain their body temperature and functions according to changes in environmental conditions.

These changes are blood circulation, and heartbeat changes to maintain normal function by changing the body condition, Mammal mostly can do homeostasis.

Thus, the correct option is A. lizard is cold, and it moves to a sunny rock to warm up.

To learn more about homeostasis, refer to the link:

https://brainly.com/question/2826402

#SPJ1

Answer:

A decreasing line

Explanation:

The graph of carbon dioxide absorption look like a decreasing line for the forested area. Thus, the correct option will be C.

The absorption of carbon dioxide gas is an important process in many of the practical applications such as the reduction of greenhouse gases, separation as well as the purification processes in the chemical and the petroleum industries, and it also involve capturing of the radioactive isotopes in the nuclear fuel cycle and environment.

The carbon dioxide gas is captured and it can be put to the productive use in enhanced oil recovery as well as the manufacture of fossil fuels, building materials, and more, or it can be stored in the underground geologic formations in the environment.

Therefore, the correct option will be C.

Learn more about Carbon dioxide here:

https://brainly.com/question/3049557

#SPJ7

Answer:

Ecosystem and biome only.

Explanation:

This is because the communities and population are the counts of how many and what species of animals live in the specific community or population.  The abiotic factors are things that aren't living, so animals wouldn't be counted.

General category: Biology.

Sub-category: Scientific method

Topic: Independent and dependent variables

Introduction:

A dependent variable represents a quantity whose value depends on how the independent variable is changed.

According to the statement of the problem, we have that

the hypothesis would be:

Eating breakfast improves grades.

This means that the notes vary with respect to eating breakfast or not (breakfast consumption). Therefore, the notes depend on whether the individual had breakfast or not. This means that grades are the dependent variable and the independent variable is breakfast consumption.

Notice that the variable breakfast consumption has as possible values: the individual had breakfast or the individual did not have breakfast.

We can conclude that the correct answer is:

The independent variable is:

breakfast consumption

where this variable has the possible values:

- the individual had breakfast or

- the individual did not have breakfast.

Contaminated water is a type of water that is harmful to human beings due to the presence of harmful substances, pollutants, or impurities that make the water unsafe for drinking or other household uses. The characteristics of contaminated water can be identified through various indicators, which can either be physical, biological or chemical.

Physical indicators are visible and may include color, taste, and odor, while biological indicators are not visible and may include bacteria, viruses, and protozoa. Chemical indicators may include heavy metals, pesticides, and organic compounds, among others.

Physical Characteristics: Physical characteristics of contaminated water include cloudy or turbid appearance, unusual taste or odor, or discoloration of the water. The color may range from yellow to brown, blue to green, or even black.

Biological Characteristics: Biological characteristics of contaminated water include the presence of bacteria, viruses, or protozoa. These microorganisms can cause diseases such as diarrhea, typhoid, cholera, and dysentery.

Chemical Characteristics: Chemical characteristics of contaminated water include the presence of heavy metals such as lead, arsenic, or cadmium. Pesticides and fertilizers can also contaminate water and affect human health. Organic compounds like benzene and toluene can also be present in contaminated water, which can lead to health problems such as cancer and nerve damage.

Therefore, it is important to test water sources regularly to identify and monitor any contaminants that may be present. This can help prevent health problems associated with the use of contaminated water.

Know more about Contaminated water here :

brainly.com/question/16943782

#SPJ8

The enzyme concentration and reaction rate relationship in enzyme kinetics is defined as follows: According to the Michaelis -Menten equation, the reaction rate is proportional to the enzyme concentration up to a limit that is referred to as Vmax, the maximum rate of an enzyme-catalyzed reaction.

The graph below illustrates the relationship between enzyme concentration and reaction rate: Graph illustrating the relationship between enzyme concentration and reaction rate . As you can see in the graph, increasing the enzyme concentration increases the reaction rate, but only up to a certain point.

After this point, the reaction rate will plateau, indicating that the reaction has reached its maximum rate. Therefore, the maximum rate of an enzyme-catalyzed reaction is determined by the enzyme concentration, and it is independent of the substrate concentration.

For more such questions on enzyme

https://brainly.com/question/1596855

#SPJ8

Answer:

C.

Explanation:

c. sun- grass-rabbit-wolf

Answer:

C

Explanation:

sun- grass-rabbit-wolf

Sun makes grass grow, rabbits eat grass, and finally wolves eat rabbits.