Read the scenario. Then determine whether the person should use library or
internet research, and why.
Finn has to write a paper about the changes in the average American
diet over the past century. He needs to find at least six trustworthy
sources and is supposed to review studies found in academic journals.
O A. Finn should use the internet because articles from many sources
are available online for free.
B. Finn should use the library so that he can access information
about diets in other countries.
C. Finn should use the internet because the library is unlikely to have
enough sources
D. Finn should use the library because he needs to access journals
and other trustworthy sources.

Answers

Answer 1
I would say O A maybe
Answer 2

Answer:

D. Finn should use the library because he needs to access journalsand other trustworthy sources.

Explanation:

as the man in the comments stated


Related Questions

write as many adjectives and descriptive phrases as you can about crusty in chapter 17 in Lightning Theif

Answers

Answer

i think it is about 56 to 94

Explanation:

Answer:

Explanation:

Here are some adjectives and descriptive phrases that describe Crusty from chapter 17 in Lightning Thief:

- Bristly eyebrows

- Wiry hair

- Gruff voice

- Crooked nose

- Scraggly beard

- Rough hands

- Scratched arms

- Tattered clothing

- Dingy coat

- Pungent aroma

- Weathered skin

- Squinty eyes

- Shaggy mane

- Unkempt appearance

- Dirty fingernails

First Read: Commencement Address to the Santa Fe Indian School

Instructions

Match each vocabulary word with its corresponding synonym:

First Read: Commencement Address to the Santa Fe Indian SchoolInstructionsMatch each vocabulary word

Answers

Answer:

fill- infuse

on purpose- deliberate

carryout- implement

determination- perseverance

mortality- integrity

businessperson- entrepreneur

I attached a file. I'm pretty sure that's the right answer, but correct me if I am wrong.

Also, please put me as most brainliest...

Thank you very much!!!!

First Read: Commencement Address to the Santa Fe Indian SchoolInstructionsMatch each vocabulary word

With what emotion does Brian struggle most in this chapter?

self-pity

loneliness

fear

impatience

Answers

Answer: He goes back and forth from struggling with negative thoughts and self-pity to getting motivated and staying positive.

Explanation:

Plz mark me as Brainiest

Answer is - Self - Pity

Read "The Debt” by Paul Laurence Dunbar.

This is the debt I pay
Just for one riotous day,
Years of regret and grief,
Sorrow without relief.

Pay it I will to the end —
Until the grave, my friend,
Gives me a true release —
Gives me the clasp of peace.

Slight was the thing I bought,
Small was the debt I thought,
Poor was the loan at best —
God! but the interest!

What does the stress on the words at the beginning and end of lines 9 and 10 help show about the speaker?

He purchased something without knowing how much it would cost.
He thought for a while before purchasing the small thing he wanted.
He did not know that he would eventually have to pay back the loan.
He did not realize that a thing so small could affect his life so greatly.

Answers

The stress on the words at the beginning and end of lines 9 and 10, "Poor" and "interest," respectively, helps to show that the speaker had not fully realized the cost of the small thing he had bought.

Answer: The stress on the words at the beginning and end of lines 9 and 10 in the poem "The Debt" by Paul Laurence Dunbar helps to emphasize the determination and resolve of the speaker

Explanation:

By placing stress on the words "Pay" and "will" at the beginning of line 9 and "end" and "grave" at the end of line 10, the speaker emphasizes their unwavering commitment to fulfilling the debt they owe. These words draw attention to the speaker's resolute decision to continue paying the debt until their life's end, even if it means carrying the burden until they find release in death.

This stress creates a sense of determination and persistence in the speaker's tone. The emphasis on these words highlights the speaker's steadfastness and unwavering commitment to settling their obligations, even though the debt may have initially seemed insignificant or small.

Overall, the stressed words in lines 9 and 10 help to portray the speaker as someone who is steadfast, resolved, and willing to face the consequences of their actions, acknowledging the weight of their debt and the commitment they have made to repay it.

To learn more about how stress on specific words show about the speaker:

https://brainly.com/question/32654235

Your friend Rahul studies in Kendriya School, Moti Nagar, New Delhi, he appeared in the annual examination of class VII.He came first and got the prize." Write a letter to your friend

Answers

                                                                                                       14 June 2023

Dear Suresh,

How are you? I have been doing good and I have been busy with exams at school that is why I could not reply to you earlier. Hope you and your family are doing well too. It has been a long time since we met.

I have a good news to share with you, as I already mentioned I was busy with my annual exams, I also received my results and I have come first in the school and also received a prize for by the principle in front of the whole school. I was very delighted to have acquired the prize but also missed your presence there, I really hoped to have your presence. Anyway I wish for us to meet soon and share all that we have missed doing together. Hope to hear back from you soon.

Yours lovingly,

Rahul

Dear Rahul,

I hope this letter finds you in good health and high spirits. I am writing this letter to congratulate you on your exceptional performance in your class VII annual examination. I was thrilled to hear that you came first in the exam and received the well-deserved prize.

Your achievement is a testament to your hard work, dedication, and perseverance. I am proud of you for setting such a high standard for yourself and achieving it with flying colors. Your success has inspired me to work harder and strive for excellence in my academic pursuits.

I am sure your parents, teachers, and schoolmates are also proud of you and your achievement. Keep up the good work and continue to excel in your studies.

Once again, congratulations on your outstanding performance. Wishing you all the best for your future endeavors.

Best regards,

[Your Name]

A FLAG THAT HONORS WAR VETERANS Commonlit

PART A: Which statement identifies the central idea of the text?
Help I give brain

Answers

Answer:

In this informational text, Shawn E. Hanscom discusses how the first Service Flag was created and how it honors soldiers in war.

As you read, take notes on what the Service Flag represents to those who display it.

PLEASE HELPP, NO LINKS AND DONT ANSWER JUST FOR POINTS OR YOU WILL BE REPORTED! WILL GIVE BRAINIEST!

P.S: I think it is trial 4 but I don’t know the answer to the part B. Please help.

PLEASE HELPP, NO LINKS AND DONT ANSWER JUST FOR POINTS OR YOU WILL BE REPORTED! WILL GIVE BRAINIEST!P.S:

Answers

Answer:B and c

Explanation:hope it help

Answer:

Part A:

B.

Part B:

C.

Explanation:

Enjoy, I hope you pass.

Which choice describes part of the drafting process when writing an argumentative essay?

revising for clarity
selecting evidence
developing a research plan
creating a research question

Answers

i believe it's developing a research plan.
Marching out with good points

please help I really need it

please help I really need it

Answers

Answer:

Explanation:

1. Mauna Loa Advisory Level = WARNING Aviation Color Code = ORANGE. As of 2022-12-05 19:04:46 UTC, HVO Mauna Loa ORANGE/WARNING - Mauna Loa Northeast Rift Zone eruption continues. Lava flows 2.5 miles from Saddle Road. Change to current status on 2022-12-04 18:10:15 UTC from Alert Level WARNING and Aviation Color Code RED

2. Pavlof Advisory Level = WATCH Aviation Color Code = ORANGE. As of 2022-12-04 20:47:12 UTC, AVO Pavlof ORANGE/WATCH - Eruptive activity continues. Change to current status on 2021-08-05 17:55:02 UTC from Alert Level ADVISORY and Aviation Color Code YELLOW

3. Kilauea Advisory Level = WATCH Aviation Color Code = ORANGE. As of 2022-12-04 17:47:52 UTC, HVO Kilauea ORANGE/WATCH -  Kīlauea Volcano is erupting within Halemaʻumaʻu crater. The current situations are stable at the summit and rift zones. No threats are apparent. Change to current status on 2021-10-05 02:52:01 UTC from Alert Level WARNING and Aviation Color Code RED

Answer:

Explanation:

1. AHYI SEAMOUNT VOLCANO (VNUM #284141)

20°25'12" N 145°1'48" E, Summit Elevation -449 ft (-137 m)

Current Volcano Alert Level: ADVISORY

Current Aviation Color Code: YELLOW

2. PAVLOF VOLCANO (VNUM #312030)

55°25'2" N 161°53'37" W, Summit Elevation 8261 ft (2518 m)

Current Volcano Alert Level: WATCH

Current Aviation Color Code: ORANGE

3. KILAUEA VOLCANO (VNUM #332010)

19°25'16" N 155°17'13" W, Summit Elevation 4091 ft (1247 m)

Current Volcano Alert Level: WATCH

Current Aviation Color Code: ORANGE

Refer to the Newsela article "A Critical History of 'Lord of the Flies.'"

Which sentence from the article best supports its author's assertion that Golding's novel was influenced by real-world events?

A. "The book forced readers to think about the dark sides of human nature that may tear civilization apart."

B. "It is worth reading, or re-reading, for its entertainment value alone."

C. "The book was written by William Golding and published in 1954."

D."The book was written shortly after World War II , which had taken millions of lives."

Answers

Answer: The sentence that best supports the author's assertion is option D.

Explanation:

Lord of the Flies was authored by William Golding in 1954, exploring themes like morality, rationality, and a general look at the defects of society that seep into human nature at the individual level.

It was written after World War 2, having numerous references that testify to the war. His wartime services and experiences certainly influenced him to write this thought-provoking piece, raising awareness of the more pressing conditions of human nature.

Hence, the best sentence which supports the article is "The book was written by William Golding and published in 1954."

Answer:

a

Explanation:

Mrs. Van Daan (Rising ,nervous, excited). Something's happened to them! I know... What is the mood in this passage from the play? What do you learn here that you cannot learn from the diary? What is different in the content between the play and the diary?

Answers

Answer:

he van Daan were just a lot louder when they were unhappy with their situation, with Peter, or with one another. They argued more and were very outspoken. This was probably why Peter was so quiet and shy. The Franks were much more reserved. When they were unhappy, they let it be known quietly or kept it to themselves.

Explanation:

Answer:

1. Pankicked

2. How people talk when Anne is not there

3.Wich family arrives first

Read the excerpt from Homecoming.

"Listen, I’m going to go to a phone and see where the bus station is and call them up to find out how much tickets cost. You lay low.”

"Why?”

Dicey decided to tell him the truth. "Just in case. I mean, three kids in a car in a parking lot at night . . . See, James, I think we’ve got to get to Bridgeport and I just don’t know what would happen if a policeman saw us. Foster homes or something, I dunno. I don’t want to risk it. But one kid . . . and I’m pretty old so it doesn’t look funny.”

Based on the dialogue in this excerpt, which best describes Dicey?

She is smart and resourceful.
She is scared and confused.
She is uncertain and unaware.
She is happy and comfortable.

Answers

Answer: she is smart and resourceful

In this story, we learn of an old woman who was planning an escape. Based on the dialogue in this excerpt, the sentence that best describes Dicey is;

She is smart and resourceful.

The old woman in this text is a smart person because she thought ahead of what could happen if the police saw her and James taking three children along with them in a car.

She is also resourceful because she made efforts to provide means to escape the glaring possible effects.

Thus, sentence A is right.

Learn more here:

https://brainly.com/question/9723682

Write a speech on the topic of an unjust situation you are passionate about. This may be an issue on the community level, or a current national issue.

Remember to use the following elements:

a claim
supporting facts, statistics, and reasons
possible objections to your claim (counterclaims)
a summary and call to action
three transitional words or phrases and one instance of effective keyword repetition
proper documentation of sources using MLA citation style
Your speech should be a minimum of 200 words.

Answers

Answer:

Explanation:

The Great Compromise solved issues between states with small populations and states with large populations.

The Great Compromise was developed at the Constitutional Convention and helped in creating the modern day structure of Congress. In this deal, both states with small populations and large populations got something they wanted. For example, the Senate would be composed of 2 Senators from each state, regardless of their states population. This helped to ensure that smaller states had a voice in the creation of federal laws.

On the other hand, the House of Representatives would have the number of representatives based on a states population. The greater the population, the more representatives. This made larger states happy, as they felt this accurately represented the power they should have in Congress

Spanish

El Gran Compromiso resolvió problemas entre estados con poblaciones pequeñas y estados con poblaciones grandes.

El Gran Compromiso se desarrolló en la Convención Constitucional y ayudó a crear la estructura moderna del Congreso. En este acuerdo, ambos estados con poblaciones pequeñas y grandes obtuvieron algo que querían. Por ejemplo, el Senado estaría compuesto por 2 senadores de cada estado, independientemente de la población de su estado. Esto ayudó a asegurar que los estados más pequeños tuvieran voz en la creación de leyes federales.

Por otro lado, la Cámara de Representantes tendría el número de representantes basado en la población de un estado. Cuanto mayor sea la población, más representantes. Esto hizo felices a los estados más grandes, ya que sentían que esto representaba con precisión el poder que deberían tener en el Congreso.

Answer:

This speech would be really easy if you did it yourself.

If you pick a topic you are really passionate about you should be able to write the speech in under an hour

The Giver-List and explain the five qualities the Receiver must possess.

Answers

Answer: Intelligence, Integrity, Courage, and Wisdom. The "Capacity To See Beyond" may also count.

Explanation: Look at the book or use a search engine.

Answer:

Receivers need 4 qualities to succeed, Intelligence, Integrity, Courage, and Wisdom. The 5th quality is the “Capacity to See Beyond” which refers to his ability to see changes in the apple and in the audience. Jonas was given a ritualistic chant of his name while standing on the stage alone.

Hope this helps!

(05.02 MC)
Which of the following lines of poetry most clearly reflects a tone of mystery?
O "But when the trees bow down their heads, the wind is passing by."
O "He who kisses the joy as it flies lives in Eternity's sunrise."
O "The wind steals in and twirls the candle, the branches heave and brush the wall."
O "We wrote for the milk and the honey of kindness, and not for a name."

Answers

Your answer would be B

The line of poetry that most clearly reflects a tone of mystery is: "The wind steals in and twirls the candle, the branches heave and brush the wall."

The option (C) is correct.

This line evokes a sense of intrigue and uncertainty. The mention of the wind stealing in and twirling the candle suggests an unseen presence or force, adding an element of mystery to the scene. The image of branches heaving and brushing the wall further enhances the mysterious atmosphere, creating a sense of movement and unknown activity.

The combination of these details engages the reader's curiosity and sets a tone of an enigma, inviting them to delve deeper into the mysterious elements at play within the poem.

Learn more about poetry:

https://brainly.com/question/31280925

#SPJ2

This question is not complete, Here I am attaching the complete question:

Which of the following lines of poetry most clearly reflects a tone of mystery?

(A) "But when the trees bow down their heads, the wind is passing by."

(B) "He who kisses the joy as it flies lives in Eternity's sunrise."

(C) "The wind steals in and twirls the candle, the branches heave and brush the wall."

(D) "We wrote for the milk and the honey of kindness, and not for a name."

Refer to your Who Is Sonia Soyomayor? book for a complete version of the text.

Which statement provides an accurate analysis of Who is Sonia Sotomayor? and “Background on Judge Sonia Sotomayor”?

Drag the correct response into the box.

Refer to your Who Is Sonia Soyomayor? book for a complete version of the text.Which statement provides

Answers

The correct answer is The two sources suggest that Sonia Sotomayor  was nominated to serve as a Supreme Court judge in part because she would be the first Latina woman to do so, which is the second option.

Before her appointment to the Supreme Court, Sotomayor had a distinguished legal career. She worked as an assistant district attorney in New York County, served as a litigator in private practice, and later became a federal judge. In 1992, she was appointed to the U.S. District Court for the Southern District of New York by President George H.W. Bush. In 1998, she was elevated to the U.S. Court of Appeals for the Second Circuit by President Bill Clinton.

Learn more about Sotomayor here.

https://brainly.com/question/30554625

#SPJ1

Summary: Sonia Sotomayor's life accomplishments are highlighted all throughout the book. It begins with her childhood and what she endured growing up to her getting accepted into Princeton. After Princeton, she takes on more law school in order to fulfill her lifelong dream of becoming a Judge

People who experience the same event often have very different perceptions of it. In a well-written PARAGRAPH (A.P.E.P.E.C), analyze two contrasting experiences of the people in this passage and how they differ.

Answers

Answer:

i need points srry jn

Explanation:

Many people experience the same memory together, but often remember the memory differently. There are many things that make this true. Such as, if two people go to the zoo, they may remember it completely differently. If person number 1 liked the lions and person number 2 likes the monkeys, they will remember their emotions differently about the animals they were around.

i need help fast
i have to present a game project later today and i need help like.. now please
i’ll give you my idea and the details so you can give tips and help me ty
Nintendo wants you to make a a game for them
you need good characters, bad characters, story plot, and a literal game + game name.

i thought of a game where you have to try and beat certain people (all around the world) in a trivia, challenges, and games type thing. you roll a die and whatever it lands on (challenge, trivia, or game) a wheel decides what you do for that thing. i have 1 character named Vix and they’re a good character. i need like 2 bad characters and 1 more good. i need a game name too or a new idea (anything would help me out a lot) just don’t reply with (that’s good) cause i need help.

the game can’t have much violence , and i still need help with a background story. please help me and i’ll give you brainliest if you have the best help

Answers

Answer:

Explanation:

Character Ideas

Helen: Villian

Venessa: Helen's sidekick

John: a Hero

Answer:

Abyss (female antagonists)

Brutus (male antagonist)

Amethyst (female protagonist)

It's taken place in Brazil

Brazil : Brazil's jungles are home to most of its animal life, but many unique species also live in the pampas and semi-desert regions. Challenge, trivia, or game: you are trying to make it across The Amazon Forest, challenges include walking away without alarming a dangerous animal, trying to walk by a sleeping animal without waling them up, and trying to survive overnight with natural resources. Trivia's include answering questions about animals and natural resources that the protagonist have come across on their way across The Amazon Forest. Games include trying to save endangered animals from the antagonists. Characters: Abyss, her and her brother, Brutus, come from a a very non-friendly family and they try to make a living by trying to traffic endangered animals to rich people, scientist and people who try making clothes of the animals. Vix and her friend, Amethyst, parents were always trying to save animals and preserve the Earth, but due to an accident Vix lost her parents in a car crash which is why she is now pursuing her parents dream. Amethyst parents decided to fly Amethyst and Vix to Brazil so they can pursue Vix's parents dream.

Explanation:

Read this excerpt from the Preamble to the United States Constitution:

United States. Preamble and First Amendment to the United States Constitution. (1787, 1791) Preamble

We, the People of the United States, in Order to form a more perfect Union, establish Justice, insure domestic Tranquility, provide for the common defence, promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity, do ordain and establish this Constitution of the United States of America.

How did the voting rights acts of 1869, 1920, and 1971 expand the "Blessings of Liberty" to more of the United States' population? Write a short essay to explain your answer.

Answers

The blessings of liberty basically means that everyone is equal and free to have power in the government. People have power in the government by voting. When the constitution was written, females and slaves could not vote. The voting right act of 1869 gave malformed male slaves the ability to vote. The 1920 act gave women the right to act. 1971 act gave people 18 years and older the right to act. Each of these acts gives more people the right to vote, which means that they have more liberty or freedom in their government. It has been a slow process in America because we are far from the reforms in Europe during the 1800s and 1900s.

I hope this helps you. If it does, please please please mark brainliest. I’m trying to help as many people as possible.

which adjective best describes Mr. White's character?

Answers

Answer: I would say reckless

Explanation: he acts without thinking of the consequences or dangers.

Some good adjectives could be impulsive, spontaneous, impetuous

All stories contain at least one archetype. In a well-written paragraph of 5–7 sentences:


identify the narrative you are reading for this module

White Fang

identify one narrative, conflict, or plot archetype that is present
explain the archetype
include specific details from the text to support your response

Answers

White Fang is a novel by American author Jack London, published in 1906. It tells the story of a wolf-dog hybrid named White Fang, who is born in the wilds of Canada and eventually becomes domesticated.

What is the novel about?

The novel follows White Fang's life as he navigates the harsh realities of survival in the wilderness, where he faces both natural and human dangers. As the story progresses, White Fang develops into a loyal and loving companion, thanks to the kindness of his human owners.

Along the way, the novel explores themes such as nature versus nurture, the importance of socialization, and the capacity for animals to feel emotions such as love and loyalty.

Learn more about archetype on:

https://brainly.com/question/1855370

#SPJ1

In the space provided, enter the three discussion question stems you selected, and the answers you wrote as you reread the speech. Even though this was a note-taking exercise, the answers should still be complete sentences, with correct spelling and punctuation.

i think its about Franklin Delano Roosevelt’s 1933 Inaugural Address. ToT

Answers

Answer:

show to speech

Explanation:

It is about delanlo Roosevelt a great adventure in 1922-1933 you should know this bc it provides it to you

Judy Blume's career as an American writer spans four decades and includes many literary awards. She is most famous for her novels geared toward pre-teens. One notable example is Tales of a Fourth-Grade Nothing. However, Blume also has had success writing for an adult audience. Three of her novels for adults reached the New York Times best-seller list. In a 2008 interview Blume remarked, "I have so many stories left to tell!" By that time she had written nearly 30 novels. Judy Blume an exceptionally talented and productive American author.

How does the third sentence ("However, Blume also has. ...") support the main idea of the paragraph?

It tells you that the author once wrote for children but has changed her focus and preference to adults.
It tells you that the author has great talent because she writes good stories for children as well as adults.
It points out that the author has written more books for children than she has written, or plans to write, for adults.
It points out that the author only writes stories that she expects will win awards or sell well among adults.

Answers

It’s not a good idea for the kids and they don’t know how to do that and then

Answer:

It tells you that the author has great talent because she writes good stories for children as well as adults.

Explanation:

i need help on my miles davis essay--
rn i have "Miles Davis was a famous jazz musician. He was born May 26, 1926, in Alton, Illinois."

Answers

Great start! Here's an idea to help you continue your essay:

Miles Davis was not only a famous jazz musician but also a pioneer of the genre. His innovative style and unique approach to music have had a profound impact on the world of jazz and beyond. Davis was known for his ability to blend different styles of music, such as classical, rock, and funk, into his performances, which helped to create a new sound that was entirely his own.
You could write about how he affected the genre of music as well as the world

Which one is right! Please Help me out!

Answers

i can’t see your pics
Just screenshot it so then we can see it and help you

What is Kennedy’s purpose in describing the wall in his “Ich bin ein Berliner” speech?
A. to convince his listeners that they should feel fortunate

B. to contrast democracy with communism

C. to provoke anger in his listeners

D. to show the failures of communism

Answers

Answer:

A.

Explanation:

A.





Hope this helps! :)

URGENT:
One point of interest between Kuwait and Morocco. What is interesting about this location?

Answers

Answer:

Morocco is a unique and fascinating country with tons to offer visitors, including the historical Moroccan heritage monuments, interesting food and culture as well as the magnificence urban centers, such as the capital city Rabat.

Explanation:

Answer:

Explanation: The fastest way to get from Kuwait to Morocco is to fly. Taking this option will cost $240 - $700 and takes 9h 10m. How far is it from Kuwait to Morocco? The distance between Kuwait and Morocco is 5218 km.

Morocco is a unique and fascinating country with tons to offer visitors, including the historical Moroccan heritage monuments, interesting food, and culture as well as the magnification urban centers, such as the capital city Rabat

thesis statement for What is the best way to eat an ice cream cone?

Answers

Answer:

I believe the best way to eat an ice cream cone is _______ because ___________ and _____________.

Explanation:

I belive the best way to eat an ice cream cone is to add all of your favorite toppings on it because it brings out the taste in the ice cream and not only that you get to put whatever you want on it.

Compare and contrast greek mythology(Perseus and the hunt for Medusa's head) and
Greek Culture 100!!!!!! POINTS ALSO BRAINLIEST PLEASE HURRY DUE DATE TMRWФωФ

Answers

Answer:

Comparison:

Perseus And Medusa are courageous, submissive, knowledgeable, and powerful. 4. Two Greek mythological archetypes that can either be immortal or mortal are Medusa, a Gorgon, and Perseus, a demigod.

Contrast:

Medusa was both a victim and a monster. God made, cursed to never feel the warmth of men, cursed to never be seen as good. Perseus was both monster and a hero: he killed a woman to save another.

Hopes This Help!!!

Have a great Day!

Pls Mark brainliest!

1. How everything began

Perseus and his mother, Danae, were happily getting on with like on the island of Scriphos. The King, Polydectes, fell in love with Danae and made it clear that he wanted to marry her. However, the jealous, strong half-god Perseus (his father was Zeus), didn’t much like the idea of the King shacking up with his mom! But, having set his sights on Danae, Polydectes was determined to have her, and didn’t intend to give up. We all know what happens when a King and a hero don’t agree on something: battles with monsters, divine encounters, struggles and life-threatening adventures are about to change Perseus’ life.

2. How did Medusa come into it?

The tricksy King Polydectes developed a cunning plan. He pretended that he had proposed to Hippodamia, another mythological figure (it seems no one thought to ask how Hippodamia felt about being used as a pawn in all this). Quite the groom-zilla, Polydectes asked all the citizens to bring a horse to their wedding. Perseus wasn’t wealthy and couldn’t afford to buy a horse (which were REALLY expensive at the time). But, pleased to think that Polydectes’ wedding meant that his mom would be left alone, he asked the King to name any other gift. Clever Polydectes said: “Bring me the head of Medusa, then!”. The King was of course aware that he was sending Perseus straight to death. After all, Medusa could turn people to stone just by looking at them

please give me 5 limerick poems

Answers

Answer:

There was a Young Lady of Ryde.

There was a Young Lady whose Bonnet.

There was an Old Man in a Boat.

There was an Old Man in a Tree.

There was an Old Man of Kilkenny.

Answer:

There was a Young Lady of Ryde.

There was a Young Lady whose Bonnet.

There was an Old Man in a Boat.

There was an Old Man in a Tree.

There was an Old Man of Kilkenny.

There was an Old Man of Marseilles.

There was an Old Man of Quebec.

There was an Old Man who supposed.

I gave you 8 limerick poems to choose out of if you want to choose :)

Other Questions
What substances is a liquid at room temperature Simplify the expression: (3 -- 10)2 + 4 : 2 The instructions for mixing cement call for 1 gallon of water to be used with 1 sack of cement. Will 2/7of a partial sack (Sack A) require more or less water than 1/4 of a partial sack (Sack B)? In other words, which sack of cement is the largest, Sack A or Sack B? p [CLO-4] At year-end (December 31), Rashid Company estimates its bad debts as 1 % of its annual credit sales of AED400,000 Rashid records its bad debits expense for that estimate. On the following February 15, Rashid d des that the AED800 account of Ayesha is uncollectible and writes it off as a bad debt On March 31st, Ayesha unexpectedly pays the amount previously written off Required: Part a) Prepare the journal entries of Rashid to record these transactions and events of December 31, February 15, and March 31st. (4 marks) Part b) Ahmed Company's year-end unadjusted trial balance shows accounts receivable of $60,000, and sales of $200,000. Uncollectible are estimated to be 2% of accounts receivable. Required: Prepare the year-end adjusting entry on December 31st for uncollectible if the allowance account had a year-end unadjusted credit balance of $3007 (Note: part (b) is not linked with part (a) (1 mark) Part c) What is matching (expense recognition) principle? Why matching principle can be applied to estimate bad debts at the end of the accounting period? (1 mark) For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac) 2 LX EEA QSF Arial BIVS 10pt Paragraph if individual income tax accounts for more total revenue than the payroll tax in the u.s., why would over half the households in the country pay more in payroll taxes than in income taxes? question 2 options: payroll tax is a progressive tax income tax is a proportional tax income tax is a progressive tax payroll tax is a regressive tax answer the following question. Include the current definite article, el or al, and ensure correct spelling and use of accent marks.what can you hang on the wall to help you know when class is over. The IRR is the discount rate that: ___________a. discounts all cash flows to their present value b. discounts all internal cash flowsc. treats all cash flows as internal d. sets NPV equal to 0 at the end of the project, the total cost of material and labor used for the project was $200,000. the owner paid the contractor $200,000 and in addition to this, the owner paid an amount equal to 10% of $200,000. based on this scenario, what type of contract do you think would the owner and contractor would have entered in at the beginning of the project An archaeologit i roping off a rectangular region of land to dig for artifact. The region mut have a perimeter of 440 feet and an area of at leat 8500 quare feet. Decribe the poible length of the region -5x-35=-2x+31 i needa solve work List 3 characteristics of each of the following microorganisms that make them suitable for industrial use and give an example of eacha. Bacteriab. Fungic. Algaed. Yeasts 8) if f(x) = e to the power 5x. what is the value of f inverse (2e) ?explainn Credit allowed to a customer for the sales price of returned merchandise, resulting in a decrease in the accounts receivable of the merchandising business.a. sales allowanceb. purchases returnc. purchases allowanced. sales return L33. Solve 41x - 7 + 12 = 28Solution(s). Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG Which of the following functions best describes this graph?A. y = x^2 + x - 12B. y = x^2 - 9x + 18C. y = x^2 + 9x + 18D. y = x^2 - 5x + 6 Using the textual clues, what do you think "evacuees" means? a. Evacuating b. People in a vacuum c. People pushed out of their homes d. All of the answers provided 36 students are in math class and 25% are boys how many girls are there which inital intervention would the nurse perform for a client recently admitted with pacing, aloofness, What are some of the main reasons that immigrants left Europe and Russia for the United States in the late nineteenth and early twentieth centuries?