Pollutant
Toxic metals and
heat released
during coal
burning
Primary or
secondary?
Physical, chemical, biological,
radiological, or thermal?
I

Answer:

Adverbial Phrases: A group of words that together, function as an adverb.

Proteins. The term "biological machines" refers to nanoscale devices (molecular proteins) in a living system that convert various sources of energy to mechanical work in order to drive critical biological processes.

Such intracellular transport, muscle contractions, ATP production, and cell division. Motor proteins like myosin, which contracts muscles, kinesin, which moves cargo inside cells away from the nucleus along microtubules, and dynein, which moves cargo inside cells towards the nucleus and causes the axonemal beating of motile cilia and flagella, are important examples of biological machines.

Other biological machines, like the ATP synthase, which uses the energy from proton gradients across membranes to power a turbine-like motion to synthesise ATP, the currency of a cell, are also in charge of producing energy.

Learn more about Proteins here:

https://brainly.com/question/29776206

#SPJ4

Answer:

The properties like conductivity or resistivity are come under category of electrical properties. These properties are observed to change at nanoscale level like optical properties. The examples of the change in electrical properties in nanomaterials are: 1

Explanation:

The radial notch is the name of the area on the radius that receives the head of the ulna.

The length of your forearm's two bones is called the ulna. It facilitates arm, wrist, and hand movement. Numerous significant muscles, tendons, ligaments, and blood arteries are also supported by your ulna.

The radius and ulna, two bones that make up the forearm, are found on the thumb and pinky sides, respectively.

In summary, one of the two long bones of the forearm that make up the antebrachium, together with the radius, is the ulna. When in anatomical position, the bone extends down the medial side of the forearm from the elbow to the wrist. The ulna is described as being larger and longer than the radius.

Learn more about the ulna here:

https://brainly.com/question/13047292

#SPJ4

The most appropriate metric units for expressing the size of macroscopic organisms are meters (m) and its decimal multiples, such as kilometers (km) or centimeters (cm).

When it comes to measuring the size of macroscopic organisms, metric units provide a convenient and standardized system. The fundamental unit of length in the metric system is the meter (m). Meters are typically used to express the size of larger organisms, such as trees, animals, or geological features.

For organisms that are extremely large, such as mountains or continents, it is more practical to use decimal multiples of the meter, such as kilometers (km) or even megameters (Mm). Kilometers are commonly used to measure distances between different geographic locations or the extent of large habitats.

Learn more about habitats here:

https://brainly.com/question/32179234

#SPJ11

Answer:

disposable

Explanation:

Biodegradable products do not really present any problems because they can decompose on their own, thus they do not create any pollution. Aluminum is not as dangerous to the environment as plastics, for example.

Understanding gas and vapours in a work setting is incredibly important for workplace safety. Gas and vapours can contain noxious substances that, if exposed to, can lead to serious injury or health implications.

In order to prevent such accidents, employers must perform risk assessments in order to assess and identify any areas of risk and put in place control measures to limit them. If gas and vapours are used onsite, then suitable ventilation and extraction systems should be in place.

Employers should also ensure that their staff are aware of the potential risks associated with such substances and provide adequate training and instruction in how to work safely. Finally, employers should also check that any necessary personal protective equipment is provided and communications are in place to be able to notify relevant emergancy responders in case of an accident.

know more about vapours here

https://brainly.com/question/29640317#

#SPJ11

Answer:

Toxoplasmosis

Explanation:

Answer:

.

Explanation:

Biodiversity is important to humans for many reasons. ... Ecological life support— biodiversity provides functioning ecosystems that supply oxygen, clean air and water, pollination of plants, pest control, wastewater treatment and many ecosystem services

Transcription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed into RNA molecules that can encode proteins are said to produce messenger RNA. - wiki.

basically, copies of the DNA sequence are made and turned into RNA molecules (messenger RNA or mRNA), which can be taken outside the nucleus

Answer:

31°

0%

Explanation: simple just look it

up

Answer:

Mostly Sunny - Sunny

Explanation:

Pittsburghs weather will be mostly sunny to relatively sunny wihtin the next 24-48 hours. the most it ca n change to is somewhat gloomy or super sunny.

Answer:

The word adapt means to get adjusted to a change.

yes, survival in a certain environment is similar to evolution. Both must use adaptation in order for life to keep living through changes in the environment. Each help life sustain itself in a very unique way.

Explanation:

The word adapt means to get adjusted to a change.

Learn more:

brainly.com/question/20938537

5. If you lose an object or its focus when changing to higher magnifications, there are a few steps you can take:

6. When the magnification is increased, the size of the field of view typically decreases.

7. Increasing the magnification doesn't directly affect the amount of light necessary to view the object.

When the magnification is increased, the size of the field of view typically decreases. Higher magnifications allow you to see smaller details but with a narrower field of view. This means that you can observe a smaller portion of the specimen at higher magnifications compared to lower magnifications.

As for the amount of light necessary to view the object:

Increasing the magnification doesn't directly affect the amount of light necessary to view the object. However, higher magnifications can make the image appear dimmer due to the reduced amount of light passing through the narrower field of view.

To compensate for this, you may need to adjust the lighting conditions, such as increasing the intensity of the light source or adjusting the diaphragm or iris control on the microscope to allow more light to pass through. Proper lighting is important for obtaining a clear and well-illuminated image at higher magnifications.

Learn more about magnifications:

https://brainly.com/question/131206

#SPJ11

Answer:

albinism is the answer.

Answer:

0 to around 35 shows that as the temperature increases the rate of enzyme activity also increases until a peak enzyme activity that occurs after 40 degrees this is enzymes optimum temperature. after this temperature enzyme activity decreases as the enzyme becomes denatured.

Answer:

Explanation:

3. diffusion

4. facilitated diffusion

Hand sanitizers kill germs mystery science by dissolving their fat membranes.

Sanitizing can be accomplished with bleach solutions that are less concentrated or sanitizing sprays. Before you sterilize surfaces, make sure they are clean. The majority of the bacteria that are on surfaces and objects can be eliminated via disinfection. When something needs to be disinfected, harsher bleach solutions or chemicals are typically used.

Hand sanitizers that contain alcohol are effective against many different viruses because they break down the lipid membranes that surround the viruses. It does this by causing damage to the cell membranes of the bacteria. Additionally, the product typically contains hydrogen peroxide, which is effective in eliminating bacterial spores.

You can also learn about fat membranes from the following question:

https://brainly.com/question/18381959

#SPJ4

Precipitation that can carry pollutants into aquatic ecosystems is called runoff.

Aquatic ecosystems are ecological communities that exist within bodies of water such as oceans, lakes, rivers, and wetlands. They are complex systems that are shaped by a variety of physical, chemical, and biological factors. These factors include water temperature, dissolved oxygen levels, nutrient availability, water currents, and the interactions between different species of plants and animals.

Aquatic ecosystems can be divided into two main types: marine and freshwater. Marine ecosystems are found in saltwater bodies such as oceans and estuaries, while freshwater ecosystems exist in bodies of freshwater such as rivers, lakes, and wetlands. These ecosystems are home to a diverse range of aquatic plants and animals, including algae, plankton, fish, and mammals.

To learn more about Aquatic ecosystems visit here:

brainly.com/question/31092061

#SPJ4

c

its just simple and makes sense.

Explanation:

In complete dominance, the effect of one allele in a heterozygous genotype completely masks the effect of the other. The allele that masks the other is said to be dominant to the latter, and the allele that is masked is said to be recessive to the former.

Answer:

Explanation:

i tack test

To determine how many parts of dissolved minerals will be produced when 5000 ml of seawater evaporates, we need to calculate the amount of dissolved minerals in that volume. When 5000 ml of seawater evaporates, it will produce 175 parts per thousand (ppt) of dissolved minerals.

The average salinity of the ocean is 35 parts per thousand (ppt), which means that for every 1000 grams of seawater, there are 35 grams of dissolved minerals. To determine how many parts of dissolved minerals will be produced when 5000 ml of seawater evaporates, we need to calculate the amount of dissolved minerals in that volume.

Since 1 ml of seawater is equivalent to 1 gram, we have 5000 grams of seawater. To find the amount of dissolved minerals, we multiply the mass of seawater (5000 grams) by the salinity (35 ppt):

Dissolved minerals = 5000 grams * 35 ppt = 175,000 parts of dissolved minerals.

Therefore, when 5000 ml of seawater evaporates, it will produce 175 parts per thousand (ppt) of dissolved minerals.

Learn more about minerals here:

https://brainly.com/question/29983937

#SPJ11

Increased groundwater nitrate levels are caused by the practice you mentioned in the usage of fertilizers raises the levels of nitrate in groundwater because the fertilizers filter into the groundwater, which raises the nitrate levels.

Excessive nitrate concentrations in water can be caused by runoff or leakage from fertilized soil, wastewater, landfills, livestock feedlots, septic systems, or urban drainage. Due to the wide range of potential sources, it can be challenging to identify where the nitrate in drinking water originates.

Nitrate levels in groundwater rise as a result of excessive irrigation because it causes more nitrate to be lost through leaching, which lowers the effectiveness of nitrogen fertilization.

Learn more about nitrate levels Visit: brainly.com/question/11255041

#SPJ4

Correct Question:

Describe how the practice you identified in leads to elevated nitrate levels in groundwater.

The valve that is most commonly affected by rheumatic fever is the mitral valve.

The mitral valve is placed between the left atrium and the left ventricle of the heart and controls blood flow from the atrial to the ventricle.

The immune system incorrectly targets the heart tissue during rheumatic fever, causing scarring and thickening of the valve leaflets, as well as fusion of the valve cusps.

This can lead to mitral stenosis, a narrowing of the valve opening that impairs blood flow from the atrium to the ventricle.

The most prevalent type of valve injury found in rheumatic fever is mitral valve involvement. Other heart valves, such as the aortic or tricuspid valves, may also be impacted in some circumstances.

For such more question on rheumatic:

https://brainly.com/question/29031370

#SPJ11

Answer:

"Igneous rocks contain randomly arranged interlocking crystals. The size of the crystals depends on how quickly the molten magma solidified: magma that cools slowly will form an igneous rock with large crystals. lava that cools quickly will form an igneous rock with small crystals.

Nitrogen forms NUCLEOTIDES that are part of DNA, as well as amino acids, which help build proteins. Nucleotides are building blocks of DNA.

Deoxyribonucleic acid (DNA) is a double helix molecule composed of two long strands of building blocks called nucleotides.

In DNA, there are four types of nucleotides that contain different nitrogenous bases: Adenine, Cytosine, Guanine and Thymine.

The nitrogenous bases are composed of nitrogen and they are fundamental to form nucleotides (nucleotides consist of one nitrogenous base, one sugar and one phosphate group).

Learn more about nucleotides here:

https://brainly.com/question/1569358

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer:

A - The fact that the bone structures are similar supports the concept that the animals shared a common ancestor.

Explanation:

Homologous structures refer organs which are similar in structure which are derived from ancestors of similar species.

Answer:During sexual reproduction, two haploid cells, called gametes, fuse to form a diploid cell called a zygote. In animals, the gametes are sperm and eggs, and the process by which they fuse is called fertilization. In plants, the gametes are produced by the male and female reproductive cells, called the microgametes and the megagametes, respectively, and the process is called syngamy.

During fertilization in animals, the sperm penetrates the egg, and the nuclei of the sperm and egg fuse, combining their genetic material. This forms the diploid zygote, which then undergoes cell division to form a multicellular organism.

In plants, the fusion of the microgametes and megagametes occurs at the tip of the pollen tube and the egg cell. This process is called double fertilization, which leads to the formation of a diploid zygote and a triploid cell called the endosperm, which provides nourishment for the developing seed.

In both case, sperm and egg or micro and mega gametes are the structure fusing to form diploid zygote during sexual reproduction.