Answer:
The answer is the top one, C
Explanation:
"Land degradation is a process in which the value of the biophysical environment is affected by a combination of human-induced processes acting upon the land. It is viewed as any change or disturbance to the land perceived to be deleterious or undesirable."
Answer:
Land Degradation
Explanation:
because the specific defenition is "Land degradation is a process in which the value of the biophysical environment is affected by a combination of human-induced processes acting upon the land" and it is more relevant than the other defenitions.
What are some examples of pathogens that can make us sick? What is hematopoiesis? What are the two primary lymphoid organs? What are the two secondary lymphoid organs? Name the three divisions of the immune system that protect us from invading pathogens.
Examples of pathogens that can make us sick include bacteria such as Escherichia coli, Staphylococcus aureus, and Salmonella enterica.
Hematopoiesis is the process of blood cell formation that occurs in the bone marrow. It involves the production and development of various types of blood cells, including red blood cells (erythrocytes), white blood cells (leukocytes), and platelets (thrombocytes). Hematopoiesis ensures a continuous supply of functional blood cells necessary for oxygen transport, immune responses, and blood clotting.
The two primary lymphoid organs are the thymus and the bone marrow. The thymus is responsible for the development and maturation of T cells, a type of white blood cell involved in cell-mediated immune responses. The bone marrow, in addition to its role in hematopoiesis, is also a site where B cells, another type of white blood cell, develop and mature.
The two secondary lymphoid organs are the spleen and the lymph nodes. The spleen acts as a filter for blood, removing old or damaged red blood cells, as well as serving as a site for immune responses against blood-borne pathogens. Lymph nodes are small, bean-shaped structures distributed throughout the body, and they play a vital role in filtering lymph fluid, trapping pathogens, and initiating immune responses.
The three divisions of the immune system that protect us from invading pathogens are innate immunity, adaptive immunity, and passive immunity. Innate immunity is the first line of defense and provides immediate, non-specific protection against a wide range of pathogens. Adaptive immunity, involving B cells and T cells, provides specific and long-lasting protection through the recognition and memory of specific pathogens. Passive immunity, which can be acquired naturally or artificially, provides immediate but temporary protection by receiving pre-formed antibodies or immune cells from another individual.
To know more about Hematopoiesis
brainly.com/question/32108592
#SPJ11
What waste products are formed by the two main types of fermentation?
1. glucose and carbon dioxide
2. ATP and Water
3. lactic acid and ethanol
4. carbon dioxide and water
Answer:
Option-3Hope it helps youIf you only wanted to increase the particle motion of a gas without increasing any of it's other properties, which would the most correct situation?
a
Keep the gas at a constant pressure and keep the temperature constant, but increase the volume of the gas
b
Keep the gas in a fixed container at constant pressure and increase the temperature
c
Keep the gas in a fixed container at constant pressure and decrease the temperature
d
Keep the gas at a constant volume and keep the temperature constant, but decrease the pressure of the gas
If we keep the gas in a fixed container at constant pressure and increase the temperature which leads to the increase in its motion.
With an increase in temperature, the particles move faster because they gain kinetic energy which them power to move more faster. If the temperature is decreases again than the motion of gas particles slower down.
The particles of gas again moves slowly due to loss of kinetic energy so we can conclude that increasing the temperature causes in the increase of motion of the gas particles if pressure is constant.
Learn more: https://brainly.com/question/24814070
what is the substrate molecule that initiates this metabolic pathway? b. what is the inhibitor molecule c. what type of inhibitor is it? d. when does it have the most significant regulatory effect? e. what is this type of metabolic control called?
The substrate molecule that starts this metabolic pathway is threonine. The molecule of inhibition is isoleucine. It comes under non-competitive inhibition
When does it have significant regulatory effect?when it connects to an allosteric site, it has the most substantial regulatory impact. The non-active site of an enzyme is in which the allosteric inhibitor interacts. The active site's architecture is altered to prevent the enzyme from binding to its substrate.
What is the name of this kind of metabolic regulation?Through feedback inhibition, isoleucine inhibits threonine deaminase from working. Noncompetitive inhibitors are used in a common biochemical process called feedback inhibition to modulate some enzyme activity. In this process, the finished item blocks the enzyme that catalyses the initial reaction in a chain of reactions.
Learn more about metabolic pathway here:
brainly.com/question/17486892
#SPJ4
help me please
Read the paragraph from the section "Biological Oceanography."
Biological oceanographers study how each of the sub-disciplines of oceanography work to influence the distribution and abundance of marine plants and animals. They also research how marine organisms behave and develop in relation to their environment. Marine biologists and scientists who work in fisheries are examples of biological oceanographers.
Which two words could BEST replace "distribution" and "abundance" in this paragraph?
A
placement; wealth
B
division; bundles
C
sequence; health
D
location; quantities
Placement and Wealth best replaces "distribution" and "abundance" in the paragraph "Biological oceanographers study how each of the sub-disciplines of oceanography work to influence the distribution and abundance of marine plants and animals." The answer is option A
What are the synonyms for abundance and distribution?There are exhaustive lists for synonyms of abundance which includes:
wealth, volume, mass, heap, chunk, loads, mountain, plenty quantity, richness etc. according to Miriam WebsterWith distribution, there are words like:
dissemination, scattering, placement, position, grouping, spread, location, arrangement, disposition, allotment etc.For the paragraph from "Biological Oceanography" the best option that replaces the words "distribution" and "abundance" and retains the meaning of the sentence are "Placement and wealth".
Learn more on Synonyms here: https://brainly.com/question/869158
#SPJ1
Which of the following is an example of a detritivore? a. Mushroom b. Bacteria c. Squirrel d. Buzzard e. Ladybug
Answer:
c. a squirrel
Explanation:
A detritivore is also called a decomposer and they derive the nutrients from the dead and decaying matter and release them into the environment.
The mushroom acts as a detritivore as it uses the nutrients from the old dead and decaying bark of tree and releases the same to the soil on getting destroyed. They altos help in the recycling of the nutrients back to the environment.Hence the option A is correct.
Learn more about the following is an example of a detritivore
brainly.com/question/18781683.
explain the adaptation in plants using cactus as an example
Answer: Cactus plant has succulent stem that conserves water.
Cactus plants posseses thorns which prevents/reduces transpiration
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
What is peristalsis?
fingerlike projections in the small intestine that are used to absorb nutrients
a wavelike motion used to move food through the digestive tract
a part of the large intestine that does not have a function in humans
the tube that connects the throat to the stomach
Answer:
Explanation:
Peristalsis is a series of wave-like muscle contractions that move food through the digestive tract. It starts in the esophagus where strong wave-like motions of the smooth muscle move balls of swallowed food to the stomach.
Answer:
Explanation:The other two parts of the small intestine, the jejunum and ileum, work to absorb the nutrients from your food to support the health and energy needs of your body. The lining of your small intestine is filled with closely packed, finger-like projections, called villi.
droplets or small particles contain infectious agents that remain effective over time and distance in the air. is the menaing of ___
Infectious aerosols are the droplets or small particles contain infectious agents that remain effective over time and distance in the air.
Which infectious illness spreads by droplets?Many common illnesses, such as the common cold, diphtheria, fifth disease (erythema infectiosum), influenza, meningitis, mycoplasma, mumps, pertussis (whooping cough), plague, rubella, and strep, can spread through droplet transmission in various circumstances (strep throat, scarlet fever, pneumonia).
How does the term "airborne virus" apply?Through coughing, sneezing, laughing, and close physical contact, airborne infections can be shared. Contact When a person with a sickness comes into touch with another person directly and the germ is conveyed from here to there, the disease is spread.
To know more about infectious diseases visit
brainly.com/question/19580009
#SPJ4
All of the following are characteristics of all
living things except the ability to
A. grow and develop.
B. maintain a stable internal environment.
C. change over time.
D. ability to move.
Answer:
i hope this helps
Explanation:
the process of maintaining a stable internal environment, and breakdown of it ... how groups of organisms change over time (generations, longer periods of time) ... ability to maintain balance, grow, reproduce, and carry out other life functions.
Characteristics of all living things includes grow and develop, change over time and ability to move.
Living things shares similar characteristic and behavior.
These characteristics includes the following:
• All living things moves in one way or another
• Living things respirate (breath)
• Nutrition are what makes living things stay alive and grows
• Irritation occurs to all living things.
• All living things grows.
• All living things excretes waste product.
• Reproduction makes living things multiply in number
• The end of a living thing is death.
Learn more about characteristics of living things here brainly.com/question/280237
These plants have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. There is one type of spore, and the gametophyte generation grows outside of the spore wall. Which plant or plants am I describing? (SELECT ALL THAT APPLY) 000000000 Ferns Cycads Selaginella Lycopodium Conifers Ginkgo Hornworts Mosses Angiosperms 3 pts Liverworts
The correct answers are: Ferns, Hornworts, Mosses, and Liverworts.
The plants that fit the given description are:
Ferns: Ferns have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. Ferns produce one type of spore, and the gametophyte generation grows outside of the spore wall.Horworts: Hornworts also have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. Hornworts produce one type of spore, and the gametophyte generation grows outside of the spore wall.Mosses: Mosses have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. Mosses produce one type of spore, and the gametophyte generation grows outside of the spore wall.Liverworts: Liverworts also have free-living gametophytes and free-living sporophytes. The sporophyte generation is dominant and larger than the gametophyte generation. Liverworts produce one type of spore, and the gametophyte generation grows outside of the spore wall.Therefore, the correct answers are: Ferns, Hornworts, Mosses, and Liverworts.
Learn more about Gametophytes at
brainly.com/question/26464709
#SPJ4
Which of these substances stores the most energy?
A. one gram of protein
B. one gram of alcohol
C. one gram of fat
D. One gram of carbohydrates
The substance that stores the most energy is one gram of fat (Option C).
A gram of fat contains approximately 9 calories.
Moreover, a gram of carbohydrate provides 4 calories, whereas a gram of protein also contains approximately 4 calories.
Finally, a gram of alcohol contains approximately 7 calories (almost as many as one gram of fats).
In conclusion, the substance that stores the most energy is one gram of fat (Option C).
Learn more in:
https://brainly.com/question/17844167?referrer=searchResults
what is the correct sequence of path that light follows before reaching our eyes on the microscope we are using in lab?
The correct sequence of path that the light follows before reaching our eyes on the microscope is Light source → Condenser and Mirror → Specimen → Objective lens → Intermediate image → Eyepiece lens → Human eye.
Hence, the correct option is option a.
We use microscopes in labs in order to observe microscopic elements. In the microscope, the light comes from a particular light source. The light then falls into the mirror and this is done with the help of a condenser .
The light then moves in the upward direction and gets reflected to fall on the specimen and then from the specimen this light passes upward in the objective lens. The objective lens receives the light and forms an image. The observer will then be able to see the image through the eyepiece lens.
--The given question is incomplete, the complete question is
"What is the correct sequence of path that light follows before reaching our eyes on the microscope we are using in lab?
A. Light source → Condenser and Mirror → Specimen → Objective lens → Intermediate image → Eyepiece lens → Human eye
B. Light source → Specimen → Condenser and Mirror → Intermediate image → Objective lens → Eyepiece lens → Human eye
C. Light source → Specimen → Intermediate image → Objective lens → Eyepiece lens → Human eye → Condenser and Mirror
D. Human eye → Specimen → Condenser and Mirror → intermediate Image → Objective lens → Eyepiece lens → Light source"--
To know more about microscope here
https://brainly.com/question/29726640
#SPJ4
What could a human living now and a horse living thousands of years ago
have in common?
A. They need the same amount of energy to survive.
ООО
B. They have the exact same DNA
C. They are made of some of the same matter.
D. They both get their energy directly from the sun
Answer:
they both get their energy directly from the sun
Plsss helpppp!!!
What is being “selected” for during natural selection?
A. The fastest organisms
B. The strongest organisms
C. Advantageous alleles
D. Acquired traits
Answer:
C.
Explanation:
Adventageous traits help organisms to survive.
Answer:
c .......................
4. The nearest organ to which the heart supplies oxygenated
blood is
Explanation:
Nearest organ to which heart supplies oxygenated blood is HEART ITSELF. It is supplied through CORONARY ARTERIES.
if you help me ill mark you brainliest
I had to take a screenshot of my response since it was getting flagged for being inappropriate for some reason.
occurs when tissue_______, such as part of an internal organ, protrudes through a weak area in the muscle normally containing it______
A hernia occurs when a portion of your internal parts swells via a door or flaw in the muscle or tissue snag that contains it. Most hernias include one of your gut organs going via one of the walls of your stomach pit.
An inguinal hernia occurs when tissue, like a piece of the digestive system, projects through a point of weakness in muscular strength. The subsequent lump can be excruciating, particularly when you hack, twist around, or lift a weighty item. Be that as it may, numerous hernias don't cause torment.
A hernia (articulated: HUR-nee-uh) is when part of an organ or tissue in the body (like a circle of the digestive system) pushes through an opening or point of weakness in a muscle wall. It can drive into a space where it doesn't have a place. This causes a lump or protuberance.
To learn more about hernia occurs here
https://brainly.com/question/8872267
#SPJ4
Which process occurs when liquid water becomes water vapor
Jim made this incorrect diagram to represent the order in which four events took place on earth. 1. Primitive reptile 2. Giant insect 3. Primitive fish 4. Primitive horse The flaw in Jim's diagram can be corrected by interchanging the positions of
A giant insect and primitive fish
B giant insect and primitive horse
C primitive reptile and giant insect
D primitive reptiles and primitive fish
Explain why cyanobacteria are so important to other types of freshwater and marine organisms that rely on oxygen, nitrogen, and organic compounds for their survival. Cyanobacteria produce oxygen as a by-product of photosynthesis, produce useful nitrogen compounds by nitrogen fixation, and synthesize many organic compounds usable by other organisms when they decompose. Cyanobacteria use methane (CH4) as their carbon source, and they also use CH4 as an electron donor in cellular respiration. Therefore, they do not compete with other organisms that use oxygen and nitrogen. They also process CH4 into more complex organic compounds useful to other organisms when they decompose. Some species of cyanobacteria live in association with a water fern that grows in rice paddies and help fertilize the rice plants. Cyanobacteria are competitors to other organisms because they use oxygen for aerobic respiration, absorb various nitrogen compounds, and accumulate organic compounds
Cyanobacteria play a crucial role in freshwater and marine ecosystems by providing essential resources to other organisms that rely on oxygen, nitrogen, and organic compounds for their survival. They are capable of producing oxygen through photosynthesis, which is vital for the survival of aerobic organisms in these environments. The oxygen released as a by-product of cyanobacterial photosynthesis contributes to maintaining oxygen-rich conditions in the water.
In addition to oxygen production, cyanobacteria are important nitrogen fixers. They have the ability to convert atmospheric nitrogen gas into useful nitrogen compounds, such as ammonia and nitrates, through a process called nitrogen fixation. These nitrogen compounds are essential nutrients for other organisms, including plants and algae, that require them for growth and metabolism.
Furthermore, cyanobacteria synthesize various organic compounds that can be utilized by other organisms when they decompose. As cyanobacteria break down, they release organic matter into the environment, providing a source of nutrients for other organisms. This decomposition process contributes to the cycling of nutrients in the ecosystem.
Interestingly, cyanobacteria have the ability to use methane as a carbon source and electron donor in cellular respiration. This unique characteristic allows them to coexist with other organisms that rely on oxygen and nitrogen, as they do not directly compete for these resources.
In specific cases, cyanobacteria form symbiotic associations with other organisms. For example, certain species of cyanobacteria live in a mutualistic relationship with water ferns in rice paddies. These cyanobacteria provide nitrogen to the rice plants, acting as natural fertilizers and enhancing their growth.
Overall, cyanobacteria play a vital role in supporting the ecological balance of freshwater and marine ecosystems by producing oxygen, fixing nitrogen, synthesizing organic compounds, and forming beneficial associations with other organisms. Their activities contribute to the availability of essential resources and the overall productivity and sustainability of these environments.
Know more about Complex Organic Compounds here:
https://brainly.com/question/14658388
#SPJ11
When the energy needs of the body cannot be met in any other way, the last resort of the body is to ______________________.
Answer:
Catabolysis
Explanation:
Catabolysis is the last metabolic resort for the body to keep itself — particularly the nervous system—functional. Protein stores, especially in muscle tissue, provide the amino acids needed for the process.
The diagram below represents a process taking place in a cell. The type of organic molecule that is being synthesized is
A) DNA
B) Starch
C) Protein
D) Fat
The process that is taking place in the diagram shown is the process of translation.
The type of organic molecule that is being synthesized is protein.
The diagram shown depicts the process of translation that is taking place in the ribosome. The process of translation involves the reading of the mRNA transcript by the ribosomes and production of the strings of amino acids which is complemented by several other elements including the tRNA. The tRNA brings in the anti-codon of the codon read on the mRNA and from here the chains of amino acids are produced. This makes up the proteins.Learn more about the process of translation: https://brainly.com/question/2449073
Answer:
c) Protien
Protine is must needed
what is the relationship between structure and function of molecules
Answer:
PS:Can I be brainliest.
Have a nice day
Explanation:
Each molecule has a characteristic size and shape that determines its function in the living cell. The shapes of molecules are determined by the positions of the atoms' orbitals. When an atom forms covalent bonds, the orbitals in its valence shell are rearranged.
Each molecule has a characteristic size and shape that determines its function in the living cell. The shapes of molecules are determined by the positions of the atoms' orbitals.
What is molecules?
The smallest component of a substance that possesses both its chemical and physical characteristics. One or more atoms make up molecules.
They may have the same atoms (for example, an oxygen molecule has two oxygen atoms) or different atoms if they have more than one (a water molecule has two hydrogen atoms and one oxygen atom).
Biological molecules like DNA and proteins can include thousands of atoms. When an atom forms covalent bonds, the orbitals in its valence shell are rearranged.
Therefore, Each molecule has a characteristic size and shape that determines its function in the living cell. The shapes of molecules are determined by the positions of the atoms' orbitals.
To learn more about molecules, refer to the link:
https://brainly.com/question/19556990
#SPJ2
pls solve this is urgent
Answer:
Explanation:
(g) read 0.56 arbitary units on the y axis, follow this across to the x axis to find starch % concentration.
the characteristic of any receptor which allows it to respond to a specific or predetermined stimulus is called
The characteristic of any receptor which allows it to respond to a specific or predetermined stimulus is called specificity.
Receptors are specialized cells or proteins that detect and respond to specific stimuli, such as light, sound, or chemicals. The specificity of a receptor is what enables it to detect and respond to a particular type of stimulus, while ignoring others that are not relevant to its function.
Receptors are specialized proteins located on the surface or inside the cells of the body that bind with specific signaling molecules called ligands. The binding of a ligand to its receptor initiates a chain of chemical reactions that ultimately leads to a physiological response in the body. The specificity of a receptor is determined by the shape of its binding site, which is complementary to the shape of the ligand.
Each receptor is specialized to recognize and respond to a specific ligand or a group of structurally related ligands, and this specificity is critical for maintaining the appropriate physiological response in the body. For example, the beta-adrenergic receptor responds to the neurotransmitter adrenaline and related molecules, while the insulin receptor responds to the hormone insulin.
In summary, the ability of a receptor to respond to a specific or predetermined stimulus is due to its selectivity or specificity, which is determined by the shape of its binding site.
To know more about receptors visit: https://brainly.com/question/21347989
#SPJ11
WHAT IS GOING ON ??????
In horses, most digestive disturbances result from? A. Underfeeding. B. Overfeeding grains. C. Too much water. D. Over chewing hay
In horses, most of the digestive disturbances result from option B. Overfeeding grains.
A domesticated, one-toed, hoofed mammal is the horse. Horse feed enters the small intestine after being expelled from the stomach. The majority of non-structural carbohydrates (starch), protein, and fat are broken down and absorbed in the small intestine by enzymes. Amylase enzymes break down starch, lipase enzymes break down fat, and protease enzymes break down protein.
Grain overfeeding contributes to digestive issues like colic and ulcers. Weight gain that is unhealthy might result in metabolic disorders like laminitis. Additionally, horses with excitability problems and undesirable behaviour tend to be overweight.
To learn more about horse here
brainly.com/question/15247728
#SPJ4
PLease help I dont want any links
Answer:
recorded on a water bottle