*pls help asap* There are several theories of emotion. Which one says that the frontal lobes interpret the body's reaction to stimuli? O A. James-Lange B. Top-up processing C. Schachter-Singer D. Cannon-Bard​

Answers

Answer 1

Answer:

Explanation:

d i think that right


Related Questions

A fatal central nervous system disorder caused by a dominant inheritance, or one copy of this gene will result in _____.

Answers

A fatal central nervous system disorder caused by a dominant inheritance, where having just one copy of the gene will result in Huntington's disease (HD).

Huntington's disease is a progressive neurodegenerative disorder characterized by the degeneration of certain neurons in the brain. It is caused by a mutation in the huntingtin gene (HTT) located on chromosome 4. The mutation involves an expansion of a CAG trinucleotide repeat in the gene, resulting in an abnormal form of the huntingtin protein.

In the case of Huntington's disease, the inheritance pattern is autosomal dominant. This means that an affected individual has a 50% chance of passing the mutated gene to each of their children. If an individual inherits one copy of the mutated gene, they will eventually develop Huntington's disease. The age of onset and progression of the disease can vary among individuals but typically leads to motor, cognitive, and psychiatric symptoms.

Since the inheritance of a single copy of the mutated gene is sufficient to cause the disorder, Huntington's disease is known as a fully penetrant dominant genetic disorder. Genetic testing can identify the presence of the mutation, enabling individuals at risk to make informed decisions about genetic counseling and family planning.

To know more about Huntington's disease click on below link :

https://brainly.com/question/29480803#

#SPJ11

1. This is taken up by plant roots from soil after it has been processed into soluble form by microorganism,
a. Magnesium
b. Potassium
c. Sulfur
d. Nitrogen
2. It is essential for root health, growth of new roots and root hairs and the development of leaves.
a. Nitrogen
b. Calcium
phosphorus d. Sulfur
3. It is the key to ensuring all the physiological process in a plant function normally. It helps activate enzymes, form
sugar, and synthesize proteins.
a. Magnesium
b. Potassium
C. Sulfur
d. Nitrogen
4. It is a constituent of amino acid in plant proteins and is involved in energy producing processes in plants. It is
also responsible for many flavor and odor compounds in plants such as the aroma of onions and cabbage.
a. Magnesium
b. Potassium
C. Sulfur
d. Nitrogen
5. It is the key component of chlorophyll and is vital for photosynthesis.
a. Magnesium
b. Potassium
C. Sulfur
d. Nitrogen
6. It is used by the plant to move energy and nutrients around itself, so that all parts of the plant remain healthy
a. Nitrogen
b. Calcium
c. Phosphorus d. Sulfur
7. It is the green coloring in the leaves of the plants.
. A. Stomata
b. Chlorophyll
c. Photosynthesis d. Enzymes​

Answers

Nitrogen is taken up by plant roots from soil after it has been processed into soluble form by microorganism.

The correct option is D .

In general , nitrogen is essential for plant growth and development, it must be converted into a usable form, such as ammonium or nitrate, before it can be taken up by plant roots. Nitrogen fixation is the process by which atmospheric nitrogen is converted into a usable form, and this process is often carried out by microorganisms in the soil.

Also, Nitrogen fixation is the process by which nitrogen gas (N2) from the atmosphere is converted into a form that plants can use. This process is carried out by certain bacteria, such as Rhizobium, which form a symbiotic relationship with leguminous plants such as soybeans, peas, and alfalfa.

Hence , D is the correct option

To learn more about Nitrogen fixation , here

brainly.com/question/19938608

#SPJ4

how is a laceration treated

Answers

Explanation:

Apply antibiotic ointment, and then cover the wound area with a sterile gauze bandage and first-aid tape. Clean the wound area daily with soap and water and apply a fresh sterile bandage. For a minor laceration, remove the bandage after a couple of days to promote healing

Answer:

with pain medication

with apply pressure

with stitches

Explanation:

Edge


Tony frequently stumbles when he walks. He observes that his father
never stumbles. Which explanation can account for the different in how
father and son walk?

Choices:

Tony's stumbling may be the result of a genetic mutation.

Tony inherited his style of walking from his mother's side of the family.

The way Tony walks may be the result of an environmental cause.

Though some of the above are more likely than others, all of the above are possible explanations.

ASAP

Answers

Tommy can go stumble down i dont even know

What are some ways we can stop global warming in the arctic?


Help!

Answers

Answer:

Reducing your carbon emissions and dependence on fossil fuels can help save the Arctic.

Discover practical ways you can make a difference, from joining our campaigns to shopping greener at the supermarket and making your home energy efficient.

Answer:

Reducing your carbon emissions and dependence on fossil fuels can help save the Arctic.Discover practical ways you can make a difference, from joining our campaigns to shopping greener at the supermarket and making your home energy efficient.Tell your government you want them to back green energy – to fight climate change and stop the rush to exploit Arctic energy resources.Reduce Water Heating Requirements.

That's it...

Hope it was Helpful

Mark me as Brainliest please!

An organism in its niche within an ecosystem is similar to?

A: a baseball player in his position on the baseball team.
B: the umpire not on a team.
C: the audience in the stands of a game.
D: the opposing team at a baseball game.

Answers

An organism in its niche within an ecosystem is similar to a baseball player in his position on the baseball team.

NICHE:

Niche in biology refers to the specific role or position of an organism in its ecosystem or habitat.

The niche of an organism is specific or particular to that organism and this enables it to adapt and survive in its environment.

This explanation shows that niche can be likened to a baseball player in his specific position on the baseball team.

Learn more about niche at: https://brainly.com/question/814740

Answer: A: a baseball player in his position on the baseball team.

While hiking in the Andes Mountain in South America, Darwin found a glyptodon fossil that resembled the modern armadillo. This evidence was used by Darwin to support his theory of natural selection by showing how species have
A.gone extinct.
B.slowly changed over time.
C.blended genetic material.
D.never changed.

Answers

I believe the answer is D if not B

Answer:

D

Explanation:

PLS HELP I REALLY NEED THIS

PLS HELP I REALLY NEED THIS

Answers

Don’t click answers that have links

what substances make up the steps of the dna ladder

Answers

The substances of the DNA ladder are made up of nitrogenous bases. The nitrogenous bases consist of adenine (A), cytosine (C), guanine (G), and thymine (T).

DNA (Deoxyribonucleic acid) is a nucleic acid containing the genetic instructions for the development and function of all living things. The genetic information in DNA is determined by the order of its four nucleotide bases.

Each nucleotide in DNA is composed of a phosphate group, a sugar molecule (deoxyribose), and a nitrogenous base. DNA is made up of two strands of nucleotides that are paired together to form a double helix structure. The nitrogenous bases of each strand are connected by hydrogen bonds, which link the two strands together and form the steps of the DNA ladder.

There are four different nitrogenous bases that make up the steps of the DNA ladder. Adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). The base pairing rules state that A can only pair with T, and G can only pair with C. The sequence of these base pairs is what determines the genetic information that is encoded in DNA.

learn more about DNA:

https://brainly.com/question/2131506

#SPJ11

please help me please help me please help me please help me please help me please help me please help me please help me please help me please help me please help me please help me please help me please help me ​

please help me please help me please help me please help me please help me please help me please help

Answers

Answer:

1. endothermic

2. exothermic

3. endothermic

4. exothermic

5. exothermic

Explanation:

a child who is blood type a has a mother who is blood type b. in a paternity suit a man is accused of being the father. he has blood type ab. is he the father?

Answers

As the father, he cannot be neglected. The childs blood type can be inherited from father or from mother.

Children with A, B, AB, or O blood types can be born when one parent has blood type A and the other has blood type B If one parent has blood type A and the other has blood type AB, the kid will either have the blood type A, B, or AB. If one parent has blood type A and the other has blood type O, the kid will either have blood type A or O.

learn more about blood type here:

https://brainly.com/question/275815

#SPJ4

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

A frogs skin cell contains 8 chromosomes. It undergoes mitosis and divides to form two skin cells. How many chromosomes are in each cell?

Answers

A frogs skin cell contains 8 chromosomes. It undergoes mitosis and divides to form two skin cells and they contain 8 chromosomes in each cell.

Chromosomes are thread-like structures made of DNA and protein that carry genetic information. They are located in the nucleus of eukaryotic cells and contain the cell's genetic material in the form of genes. Chromosomes come in pairs and each parent donates one set of chromosomes to their offspring.

After mitosis, each daughter cell will have the same number of chromosomes as the parent cell. Therefore, each skin cell that is produced from the division of the original frog skin cell will also contain 8 chromosomes, since no chromosome is lost or gained during mitosis. So, there will be 8 chromosomes in each cell.

To know more about mitosis here

https://brainly.com/question/26678449

#SPJ1

Trey and Connie were raising pigs for their 4-H project. The students fed their piglets a variation of two feeds: wheat and corn. After two months, they tabulated the pig’s weight gain. What relationship is apparent from their data?

Answers

Answer:

Trying to use the Scientific Method.

Explanation:

These two students are trying to make a experiment on these pigs they are raising. The reason why it is more like to attract the scientific method is because the steps were doing were based on it. (For example, they both might form a question and try different types of things to raise a pig)

Hope this helps, and have a wonderful day!!!

The energy needed to get a reaction started is the
a
adhesion energy.
b
cohesion energy.
c
activation energy.
d
chemical energy.

Answers

Answer:

C

Activation energy

Explanation:

Activation Energy is the minimum amount of energy needed to start a chemical reaction. All chemical reactions need a certain amount of activation energy to get started.

In his transformation experiments, what phenomenon did griffith observe?.

Answers

Answer:

Mixing a heat-killed pathogenic strain of bacteria with a living nonpathogenic strain can convert some of the living cells into the pathogenic form.

Fifty-five million years ago, the modern horse’s ancestors lived in rainforests; however, a gradual shift in the climate made the planet drier, and some rainforests became open grasslands. The table shows the fossil record of the horse tooth, indicating the changes in tooth structure over time

Answers

The dental formula of the modern horse is 3.0.3.3. There are no upper incisors or canines in the modern horse's mouth. There is a gap between the incisors and the cheek teeth in the modern horse's mouth. The cheek teeth of the modern horse are hypsodont and brachydont for the tooth structure.

Fifty-five million years ago, the modern horse's ancestors lived in rainforests. Over time, a gradual shift in the climate made the planet drier, and some rainforests became open grasslands. This led to a change in the tooth structure of horses over time, which is recorded in the fossil record.

The table given shows how the horse tooth structure changed over time.What is the tooth structure of the modern horse?The tooth structure of the modern horse is suited to grazing. The dental formula of the modern horse is 3.0.3.3. There are no upper incisors or canines in the modern horse's mouth. There is a gap between the incisors and the cheek teeth in the modern horse's mouth. The cheek teeth of the modern horse are hypsodont and brachydont.

The molars and premolars have long, complicated crowns with ridges and valleys that enable them to grind tough grasses. The molars have a crescent-shaped ridge known as the "cementum-enamel junction," which allows them to shear through tough grasses by moving their jaws in a circular motion.What is the significance of the change in tooth structure in horses?The shift in tooth structure in horses is indicative of their evolutionary response to environmental pressures.

As the climate shifted, the vegetation changed from forests to open grasslands. This change in vegetation necessitated changes in the tooth structure of horses so that they could better adapt to their changing diet.

The hypsodont and brachydont teeth of modern horses are more suited to grazing than the teeth of their rainforest-dwelling ancestors, which had more complex, multi-cusped teeth that were suited to a more varied diet.


Learn more about tooth structure here:

https://brainly.com/question/32217418


#SPJ11

What happens during S phase?

O A. Chromosomes are duplicated.

O B. DNA separates into two nuclei.

O C. The cell splits in two.

O D. Cytoplasm is manufactured.

Answers

Answer: A. Chromosomes are duplicated.

Explanation: This is the correct answer on the quiz.

Chromosomes are duplicated in S phase. Therefore, option (A) is correct.

What do you mean by S phase?

Between G1 phase and G2 phase, DNA replication takes place during S phase of the cell cycle. The processes that take place during S-phase are tightly controlled and highly conserved.

The cell replicates its genetic material entirely during the S phase of DNA synthesis; At the end of S phase, a normal diploid somatic cell with a DNA complement of 2N acquires a DNA complement of 4N.

DNA synthesis or replication occurs during the S phase of the cell cycle, which occurs prior to the interphase. Before entering mitosis or meiosis, the cell's genetic material is replicated in this manner, leaving enough DNA for daughter cells to divide.

Learn more about S phase:

https://brainly.com/question/10386886

#SPJ5

3. A certain mutant bacterial cell cannot produce
substance X. The mutation was most likely the result
of a change in the
A) structure of the cell membrane
B) ability of the DNA to replicate
C) amino acid sequence of DNA
that codes for a specific protein
D) gene

Answers

The mutation was most likely the result of a change in the ability of the  DNA replication.

How mutation occur?

Mutations result either from errors that occurs in DNA replication or caused by the mutagens, such as chemicals and radiation, which react with DNA and change the structures of individual nucleotides so we can conclude that the mutation was most likely the result of a change in the ability of the  DNA replication.

Learn more about mutation here: https://brainly.com/question/17031191

Which plant-cell organelle supports and maintains the cell's shape and protects the cell from damage?
O cell membrane
O cell wall
O chloroplast
O vacuole

Answers

Answer:

The answer is the cell wall

the answer is cell wall

The atmosphere keeps the earth's temperature steady.
A. True
B. False

Answers

true, the atmosphere is like a blanket

The city of Green Valley, Arizona, is trying to determine where to locate a new fire station. The fire station is expected to serve four neighborhoods.
Neighborhood X coordinate Y coordinate Number of homes
Birchwood 0.5 3.5 172
Cactus Circle 2 0.5 42
De La Urraca 3 1.5 223
Kingston 3 1 44
a The X* coordinate of the weighted center of gravity for the new fire station is _____. Enter your response to 2 decimal places.
b. The Y* coordinate of the weighted center of gravity for the new fire station is _____. Enter your response to 2 decimal places.
c. What other factors might come into play when making the final decision?
a. Zoning Considerations
b. Distance from other fire stations
c. Available space
d. All of the above.

Answers

(a) The X* coordinate of weighted center of gravity for new fire station is 1.82. (b) The Y* coordinate of weighted center of gravity for new fire station is 2.06. (c) The factors might come into play when making the final decision is Zoning Considerations, Distance from other fire stations, Available space. Option D is correct.

To determine the location for the new fire station in Green Valley, we need to calculate the weighted center of gravity based on the coordinates and the number of homes in each neighborhood.

The X* coordinate of the weighted center of gravity can be calculated using the formula;

X* = (X₁ × N₁ + X₂ × N₂ + X₃ × N₃ + X₄ × N₄) / (N₁ + N₂ + N + N₄)

where X₁, X₂, X₃, X₄ are the X coordinates of the neighborhoods, and N₁, N₂, N₃, N₄ are the number of homes in each neighborhood.

Using the given data:

X* = (0.5 × 172 + 2 × 42 + 3 × 223 + 3 × 44) / (172 + 42 + 223 + 44)

X* ≈ 1.82

Therefore, the X* coordinate of the weighted center of gravity for the new fire station is approximately 1.82.

The Y* coordinate of the weighted center of gravity can be calculated using the same formula, replacing the X coordinates with Y coordinates:

Y* = (Y₁ × N₁ + Y₂ × N₂ + Y₃ × N₃ + Y₄ × N₄) / (N₁ + N₂ + N₃ + N₄)

Using the given data:

Y* = (3.5 × 172 + 0.5 × 42 + 1.5 × 223 + 1 × 44) / (172 + 42 + 223 + 44)

Y* ≈ 2.06

Therefore, the Y* coordinate of the weighted center of gravity for the new fire station is approximately 2.06.

When making the final decision on the location of the fire station, several other factors might come into play;

Zoning Considerations: The city needs to consider any zoning regulations or restrictions that might limit the potential locations for the fire station.

Distance from other fire stations: The proximity to existing fire stations is an important factor to ensure efficient coverage and response times across the area.

Available space: The availability of suitable land or buildings that meet the requirements for a fire station, such as accessibility, size, and infrastructure, should be considered.

Ultimately, the decision should take into account a combination of factors, including zoning considerations, distance from other fire stations, and available space. This comprehensive approach ensures that the fire station is strategically located to serve the four neighborhoods effectively and efficiently.

Hence, D. is the correct option.

To know more about Available space here

https://brainly.com/question/20740359

#SPJ4

What is energy crisis?

Answers

Answer:

is where this is a significant amount of supply of energy to an economy that can be really dangerous to pass the maximum of the energy

primary rna transcripts from a gene are sometimes spliced in different ways and can produce multiple different mrnas.

Answers

Different mRNAs and proteins can be produced from the same RNA transcript through alternative splicing, which occurs in some transcripts.

What is the mRNA splicing procedure?

A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a mature messenger RNA through the molecular biology process of RNA splicing (mRNA). Exons are rejoined when the introns (RNA's non-coding regions) have all been removed (coding regions).

How can one mRNA be used to make several proteins?

In both prokaryotic and eukaryotic organisms, numerous ribosomes can translate several messenger RNAs at once. A new ribosome can connect to the mRNA and start the synthesis of a new polypeptide chain once the first one has left the starting site.

To know more about transcript visit:-

https://brainly.com/question/12150990

#SPJ4

Which scenario correctly describes an interaction between the geosphere, hydrosphere, and atmosphere? A. a volcanic eruption produces carbon dioxide gas which is absorbed by an ocean.
B. Plants are eaten by primary consumers and converted to cellular energy through the process of cellular respiration.
C.Plants use water, carbon dioxide, and the energy from the sun to carry out the process of photosynthesis.
D.Ash from a volcanic eruption eventually settles into a layer in the Arctic where it is covered by new snowfall and is incorporated into a glacier.

Answers

Answer:

C. Plants use water, carbon dioxide, and the energy from the sun to carry out the process of photosynthesis.

Explanation:

In this scenario, the geosphere is represented by the plants, which are rooted in the Earth's surface. The hydrosphere is represented by the water that the plants use, and the atmosphere is represented by the carbon dioxide that the plants take in through photosynthesis. This interaction involves the exchange of matter and energy between the three spheres, with the plants using water, carbon dioxide, and sunlight to produce energy and oxygen.

In an effort to reduce the number of deaths due to malaria, scientists have successfully introduced a gene from another organism into mosquitoes. The gene makes the mosquitoes unable to support the development of the parasite that causes malaria. The technique used to produce this new variety of mosquito is most likely * 1 point Selective Breeding Evolution Genetic Engineering Genetic Testing

Answers

Genetic engineering is the most likely technique used to produce the new variety of mosquito that is unable to support the development of the parasite that causes malaria.

This process involves introducing a gene from another organism into the mosquito, which gives the mosquito a new trait that it did not previously have. Through genetic engineering, scientists are able to alter the genetic makeup of organisms to make them more resistant to disease and other environmental stressors.

This is done by making changes to the genetic code in order to create a desired trait. By introducing a gene from another organism into the mosquito, scientists are able to give it the ability to resist the malaria parasite, which can help to reduce the number of deaths caused by malaria.

know more about Genetic engineering here

https://brainly.com/question/30611675#

#SPJ11

complete question is :-

In an effort to reduce the number of deaths due to malaria, scientists have successfully introduced a gene from another organism into mosquitoes. The gene makes the mosquitoes unable to support the development of the parasite that causes malaria. The technique used to produce this new variety of mosquito is most likely * 1 point Selective Breeding Evolution Genetic Engineering Genetic Testing. EXPLAIN.

(GIVING BRAINLIEST!!)

Where does most of the evaporation and precipitation in the water cycle occur?

A) In the rainforests
B) In the sky
C) Over the land
D) Over the ocean

Answers

Over the Ocean, D ((:

Answer:

D)

Explanation:

The ocean is a large body of water, since the body of water is so large the sun can heat up large amounts to evaporate. One it evaporates, the rest of the water cycle occurs leading up to precipitation. (RAIN)

Have a good day!

-

:)

1. Which types of companion cells are involved in apoplastic loading?
2. What is apoplastic loading?(Please describe differences in pathway, and in sugar molecules involved).

Answers

The companion cells that are involved in apoplastic loading are non-plasmodesmata cells.

Apoplastic loading is a process of phloem loading in which the sugar molecules are transported through the spaces in between the cells called the apoplast. There are two pathways of sugar transport: symplastic and apoplastic pathways. The differences between the pathways are:

Simplastic pathway: The sugar molecules are transported through the plasmodesmata channels in companion cells. It is slower and involves the energy expenditure in the form of ATP. Apoplastic pathway: The sugar molecules are transported through the apoplast, which is the space between the cells. This pathway is faster and does not involve the energy expenditure.

Apoplastic loading is a process of phloem loading that involves the loading of sugar molecules into the phloem by passing through the apoplast. It is a passive process that does not involve the expenditure of energy. The sugar molecules involved in apoplastic loading are sucrose, fructose, and glucose. These molecules are transported through the apoplast by passing through the spaces between the cell walls and the plasma membrane. Once they reach the companion cells, they are actively transported into the phloem sieve tube elements, where they are transported to other parts of the plant.

Learn more about apoplastic:

https://brainly.com/question/28459028

#SPJ11

Which type of organism gets energy from breaking down nutrients and uses co2 as a carbon source?

Answers

Chemo-heterotrophs gets energy from breaking down nutrients and uses carbon dioxide as a carbon source.

Chemoheterotrophs: microbes that use organic chemical substances as sources of energy and organic compounds as the main source of carbon. an organism that gets its energy from consuming intermediates or building components that it can't make on its own.

Organisms classified as heterotrophs obtain their energy by the regulated oxidation of preexisting organic molecules, or food. Humans are heterotrophs, just like the majority of other animals, fungi, protists, and bacteria. In their environments, autotrophic organisms frequently serve as the primary producers.

To know more about heterotrophs, refer to the following link:

https://brainly.com/question/14661735

#SPJ4

What is thought to be the first sense that humans develop?.

Answers

I believe it was touch sorry if i’m wrong
Other Questions
Question 10 (1 point)How many minutes are played in a men's Water Polo match?four 7-minute quartersfour 6-minute quartersone 90-minute gametwo 20-minute halvesabOdReview Answers 1. is your measurement device (the beam, strain gage and all circuits as a whole) a zeroth, first, or second order system? does it depend on whether you are looking at the system from a static perspective or a dynamic perspective? 2. is a strain gage a zeroth, first, or second order system? again, does this answer depend on the frequency at which the strain gage is used? if so, why? 3. what makes the ringing frequency slightly different from the natural frequency? 4. did you use a high enough sampling frequency to determine the ringing frequency? how did you decide on this sampling frequency? 5. why do we use a wheatstone bridge with a strain gage? 6. what usable weight range [minimum, maximum] would you recommend for your new scale? 7. what is the uncertainty in your new weight measurement system? 8. what peculiarities are there in your new weight measurement device that you should pass on to someone who uses it? a client with common variable immunodeficiency disease (cvid) has an order for an ivig infusion. what actions should the nurse perform before beginning the infusion? select all that apply. find the midpoint of the segment with the endpoints 4,12 and -6,14 " I'm a broken musical instrument, I'm angry with myself, I'm that voice which is hidden somewhere in the chest.. Listen to me without saying anything.. How long can the heart bear silence ? "What does poet wants to say in the above lines ?_______Don't spam :) a 64-year-old patient came to the emergency department complaining of chest pressure. the provider evaluated the patient. appropriate initial management was continued by the ed provider who contacted the cardiologist on call in the hospital. admission to the cardiac unit was ordered. no beds were available in the cardiac unit and the patient was held in the ed. the cardiologist left the ed after completing the evaluation of the patient and had interpreted the findings of an ekg that indicated signs of acute cardiac damage. several hours passed and the patient was still in the ed. during an 80-minute period, the patient experienced acute breathing difficulty, increased chest pain, arrhythmias, and cardiac arrest. the patient was managed by the ed provider during this 80-minute period. included in the ed provider management were endotracheal intubation and cpr to restore the patients breathing and circulation for 20 minutes. cpr was unsuccessful, the patient was pronounced dead after a total of 44 minutes critical care time, exclusive of other separately billable services. what cpt codes are reported by the ed provider? if8. Which of the following expressions doesNOT have the same value as 56-(3 + 13)?40122309X3 SIVO92-(12+16)B. 6 +4 +5e. (6-7)+3+2D. 19-4-8 +4 How are the policies impacting the health of the Chesapeake Bay? (Use http://www.cbf.org/about-the-bay/state-of-the-bay to analyze the Bay Report Card to evaluate the current policies.)Environmental Protection Agency (EPA)-U.S. Forest Service (FS)-National Park Service (NPS)-U.S. Fish and Wildlife Service (FWS)-U.S. Geological Survey (USGS)-National Oceanic and Atmospheric Administration (NOAA)-Natural Resources Conservation Service (NRCS)-Bureau of Land Management (BLM)-Office of Environmental Management (OEM)- A client tells the nurse that the television newscaster is sending a secret message to her. the nurse suspects the client is experiencing? Why might gold jewelry from the middle ages appear to be new while iron swords from the same time look ancient? which theorist would be most interested in how we feel and think about ourselves when others insult us? Which approach uses discourse analysis to answer foundational questions in the study of international relations Find -2 2/6 + (5/6)Model the expression on the number line.I need the answer asap!! Thanks! javier, a four-year-old boy, was seriously injured when he stuck a fork into an electrical outlet while dining at harmony restaurant in mill valley. his parents saul and chelsea sued the restaurant where the incident occurred, claiming it should have had child-protective guards on all their outlets. whether the restaurant is liable will depend upon whether: Which of the following is equivalent to w/x divided by y/z1. X/w x y/z2. X/w x z/y3. W/x x z/y4. X/w divided by z/y In the Wickens experiment, people were presented with a list of words based on a category (e.g., words related to fruit). After a while, they had difficulty remembering items from that category. However, if the researcher gave them a new category (e.g., words related to a profession), they would be able to remember new items. This is an example of: what are the strongest types of intermolecular forces that must be overcome in order to evaporate: (a) toluene (c7h8) (b) acetone (ch3coch3) (c) ethanol (ch3ch2oh) who started Writting history in the world ? a soccer team has 20 players. the coach must select 11 players to travel to an away game. two of the players on the team are named gabrielle and imelda. how many ways are there for the coach to select the 11 players if it is not the case that gabrielle and imelda are both included? If the variability of the returns on large-company stocks were to decrease over the long-term, you would expect which one of the following to occur as a result?Increase in the risk premiumIncrease in the average long-term rate of returnDecrease in the 68 percent probability range of returnsIncrease in the standard deviationIncrease in the geometric average rate of return