pls answer this question is due today​

Pls Answer This Question Is Due Today

Answers

Answer 1
Answers:Speed for section A = 15 km per hourSpeed for section B = 0 km per hourSpeed for section C = 60 km per hourSpeed for section D = 40 km per hour

=============================================

Explanation:

To compute the speed, we divide the distance traveled over the time duration.

For instance, if a car goes 100 km in 5 hours, then its speed is 100/5 = 20 km per hour.

-----------------

For section A, the car travels 30 km over the course of 2 hours (since 11:00-9:00 = 2:00)

speed = distance/time = (30 km)/(2 hrs) = 15 km/hr

-----------------

We don't need to do any computations for section B. It's a flat horizontal line, so the speed is zero. There's no change in distance, so the car is stationary for this 1 hour period.

You could say speed = distance/time = 0/1 = 0 km/hr if you wanted.

-----------------

For section C, its change in distance is 60-30 = 30 km and the change in time is 0.5 hour (because it spans from 12:00 to 12:30)

So, speed = distance/time = (30 km)/(0.5 hr) = 60 km/hr

The steeper slope of section C, compared to section A, means the car is going faster.

-----------------

Section D spans from 12:30 to 14:00. This is a time period of 14:00-12:30 = 1:30 = 1.5 hours. The change in distance is 60 km

(60 km)/(1.5 hrs) = 40 km/hr

The speed of the car during section D is 40 km per hour.

Side note: if you were talking about velocities instead of speeds, then section D would have a negative velocity of -40 km/hr to indicate the car is going the opposite direction (compared to sections A and C). However, speed is always nonnegative.


Related Questions

g The inductance of a solenoid that is 16.0 cm long and has a cross-sectional area of 1.00 × 10-4 m2 is 1.00 mH. How many turns of wire does this solenoid have? (μ0 = 4π × 10-7 T ∙ m/A)

Answers

To find the number of turns of wire in the solenoid, we can use the formula for inductance:
L = (μ0 * N^2 * A * l) / (2 * h)
Where L is the inductance in henries, μ0 is the permeability of free space, N is the number of turns of wire, A is the cross-sectional area in square meters, l is the length of the solenoid in meters, and h is the height of the solenoid in meters (which we can assume is equal to its length).
Plugging in the given values, we get:
1.00 mH = (4π × 10^-7 T ∙ m/A) * N^2 * (1.00 × 10^-4 m^2) * (0.16 m) / (2 * 0.16 m)
Simplifying, we get:
1.00 mH = (1.26 × 10^-6) * N^2
Dividing both sides by (1.26 × 10^-6), we get:
N^2 = 793.65
Taking the square root of both sides, we get:
N ≈ 28.16

Therefore, the solenoid has approximately 28 turns of wire.
To calculate the number of turns of wire in the solenoid, we can use the formula for inductance (L) of a solenoid:
L = (μ₀ * N² * A) / l
Where: L = inductance (1.00 mH)
μ₀ = permeability of free space (4π × 10⁻⁷ T ∙ m/A)
N = number of turns of wire
A = cross-sectional area (1.00 × 10⁻⁴ m²)
l = length of the solenoid (16.0 cm or 0.16 m)
We need to find the value of N. Rearrange the formula to solve for N:
N² = (L * l) / (μ₀ * A)Now plug in the given values:
N² = (1.00 × 10⁻³ H * 0.16 m) / (4π × 10⁻⁷ T ∙ m/A * 1.00 × 10⁻⁴ m²)
Calculate N²:
N² ≈ 127323.95

Now take the square root to find the number of turns of wire:
N ≈ √127323.95
N ≈ 356.82
Since there cannot be a fraction of a turn, we can round up to the nearest whole number:
N ≈ 357 turns
So, the solenoid has approximately 357 turns of wire.

To know more about solenoid visit:-

https://brainly.com/question/15576393

#SPJ11

Calculate the force acting
on a body whose linear momentum changes by 10 kg m/s
in 5 seconds.

Answers

Answer:2n

Explanation:10/5=2

which layer of the earth contains convection currents

Answers

The heat rising from the Earth's core creates convection currents in the plastic layer of the mantle (asthenosphere). The convection currents slowly move the tectonic plates above them in different directions.

what is magnetic field​

Answers

Answer:

A magnetic field is a vector field that describes the magnetic influence on moving electric charges, electric currents, and magnetic materials. A moving charge in a magnetic field experiences a force perpendicular to its own velocity and to the magnetic field.

Explanation:

Answer:

Explanation:

A magnetic field is a vector field that describes the magnetic influence on moving electric charges, electric currents, and magnetic materials. ... Magnetic fields surround magnetized materials, and are created by electric currents such as those used in electromagnets, and by electric fields varying in time.

The spark plug of a motor bike does NOT work because the user did not use a torque wrench to tighten spark plug, instead he/she used a regular wrench. This is an example of? *
A. What is the RPN Number?
B. What are the potential Failure Modes?
C. What are the Potential Causes?
D. What are the Potential Effects?

Answers

This is an example of potential cause and effect. The potential cause is the improper use of tools, specifically using a regular wrench instead of a torque wrench to tighten the spark plug. The potential effect is the malfunctioning of the spark plug, leading to its failure to work properly.

Using the wrong tool, in this case, a regular wrench instead of a torque wrench, can lead to overtightening or undertightening of the spark plug. A torque wrench is specifically designed to apply a specific amount of torque or rotational force to tighten the spark plug to the manufacturer's specifications. Without using a torque wrench, it becomes challenging to achieve the correct tightness, which can result in a range of issues.

In the given scenario, the potential failure mode is the spark plug not functioning correctly, leading to the bike's engine not igniting properly. This can result in poor engine performance, misfires, or complete engine failure. Using the appropriate tools and following proper procedures is crucial to ensure the reliable and safe operation of mechanical components.

Learn more about rotational here:

https://brainly.com/question/3315764

#SPJ11

A laptop computer adapter has a voltage of 19 v it has a resistance of 4.0 Ω and the adapter gets warm when operating. So determine the current going through the adapter

Answers

Answer:

Current, I = 4.75 Amps

Explanation:

Given the following data;

Voltage = 19 V

Resistance = 4 Ohms

To find the current;

Ohm's law states that at constant temperature, the current flowing in an electrical circuit is directly proportional to the voltage applied across the two points and inversely proportional to the resistance in the electrical circuit.

Mathematically, Ohm's law is given by the formula;

V=IR

Where;

V represents voltage measured in voltage.

I represents current measured in amperes.

R represents resistance measured in ohms.

Making current (I) the subject of formula, we have;

I=VR

Substituting into the formula, we have;

I=194

Current, I = 4.75 Amps

b) How much gravitational energy is in the rock after you drop it and it is halfway to the ground?

Answers

Answer:Hence, when an object falls freely, its potential energy gets converted into kinetic energy. When the object hits the ground, its kinetic energy gets converted into heat energy and sound energy. Q

Explanation:

Calculate the weight of a boy of mass 67kg on Earth if gravity = 10m/s/s.

Answers

So the equation for weight is mass*gravity. For this example I will use 9.81 and 10.
67*10=670N
67*9.81=657.27N

show that the 1 and 3 laws of motion are collection of 2 law of motion ?

Answers

Answer:

Yes, va

Explanation:

between leaving the plan and opening the parachute,the skydives gravatat
ional potential energy store decrease by 2.8mj.when they open their parachute ,their speed is 48m/s.the skydiver has a mass of 74kg .calculate how much energy is transferred to the surroundings

Answers

The sky dive's gravitational potential energy store decreases by 2.8mj between leaving the plane and opening the parachute. 84.9 kJ of energy is transferred to the surroundings.

The decrease in gravitational potential energy is equal to the increase in kinetic energy during the freefall before the parachute is opened.

The change in gravitational potential energy can be calculated using the formula:

ΔPE = mgh

g is the acceleration due to gravity (9.8 m/s²), and h is the height from which the skydiver jumped.

We are given that the decrease in gravitational potential energy is 2.8 MJ, so we can solve for h:

ΔPE = mgh

2.8 MJ = 74 kg × 9.8 m/s² × h

h = 3,726.53 meters

So the skydiver jumped from a height of 3,726.53 meters.

During the freefall, the skydiver's kinetic energy increased by the same amount as the decrease in gravitational potential energy:

ΔKE = ΔPE = 2.8 MJ

The formula for kinetic energy is:

KE = 0.5mv²

where KE is the kinetic energy, m is the mass of the skydiver, and v is the velocity.

We are given that the speed of the skydiver when the parachute is opened is 48 m/s.

KE = 0.5mv²

KE = 0.5 × 74 kg × (48 m/s)²

KE = 84,864 J

The initial kinetic energy of the skydiver was 84,864 J.

the final kinetic energy is zero.

Therefore, the energy transferred to the surroundings is:

ΔE = KEinitial - KEfinal

ΔE = 84,864 J - 0

ΔE = 84,864 J

So the energy transferred to the surroundings is 84,864 J or approximately 84.9 kJ.

Learn more about gravitational potential energy here:

https://brainly.com/question/19768887

#SPJ1

A submarine is traveling in the water at 8.5 m/s.
Suddenly the sub encounters a swiftly moving current. If the current is flowing against the submarine at 3.0 m/s how will the sub be affected?

Answers

Therefore, the submarine's speed relative to the ground will be reduced by the effect of the current

How is relative speed determined?

If two trains or bodies are travelling at u m/s and v m/s in the same direction and u>v, the relative speed in the same direction is equal to (u - v) m/s. If two objects, such as two trains, are moving at u m/s and v m/s in the opposite directions, then their relative speed is equal to (u + v) m/s.

The submarine's speed relative to the water is 8.5 m/s, but the current is flowing against the submarine at 3.0 m/s. So, the speed of the submarine relative to the ground will be the difference between the two speeds.

The speed of the submarine relative to the ground will be:

8.5 m/s - 3.0 m/s = 5.5 m/s

.To know more about speed relative visit:-

brainly.com/question/22810476

#SPJ1

Which of the following does not require good reaction time?
Select one:
A. Moving out of the way of a falling shelf
B.Removing your hand from a hot burner
C. Stopping while driving when you see the brake lights on the
car in front of you
D. Going to sleep

Answers

D. Going to sleep
Sleep is an action that doesn’t require quick reaction time while the other options are.

Find the force on an electron passing through a 0.50 T magnetic field if the velocity of the electron is 4.0 × 106 m/s. (answer in scientific notation, include sign)

Answers

Given:

The strength of the magnetic field is B = 0.5 T

The velocity of the electron is

v= 4×106 m/s

The charge on an electron is

q=1.6×1019 C

To find the force.

Explanation:

The force can be calculated as

F=qvB=1.6×1019×4×106×0.5=3.2×1013 N

the overall fusion reaction by which the sun currently produces energy is? A) 3 H ⇒ 1 Li + energy.
B) 3 He ⇒ 1 C + energy.
C) 4 H ⇒ 4 He + energy.
D) 6 H ⇒ 1 He + energy.
E) 4 H ⇒ 1 He + energy.

Answers

D) 6 H ⇒ 1 He + energy.

The Sun currently creates electricity overall through the fusion reaction 3H = 1 Li + energy. 1 He plus energy Equals 6 H (4)H = (4)He + (5)E 1 He plus energy Equals 4 H 28th QUESTION Solar flares frequently happen during a hotspot maximum, which can interfere with radio communications. Most sunspots are located near to the equator.

Helium is being created from hydrogen in the Sun's core. Nuclear fusion is the term for this. Each helium atom is created by the fusion of four hydrogen atoms.

When two atoms collide to create a heavier atom, such as when two molecules of hydrogen combine to create one helium atom, this process is known as fusion. This system produces enormous quantities of electricity, many times more than fission, and power the sun.

To know more about Fusion click here .

brainly.com/question/12701636

#SPJ4

A single stranded sequence of a gene is shown below. An investigator wants to amplify and isolate this small gene using PCR. Design two PCR primers, each 15 nucleotides long, that can be used to amplify this DNA segment. (remember that DNA sequences are written 5' to 3' by convention) ACTTTCCAAACGCCCCGTGTCGATACTGAACGAATCGATGCACGCTCCC TTCCTTGAAAACGCATAAACATACAAGTGGGCAGATGATGCGTACGCCC CTCTAATACATCCAACACTCTACGCCCTCTTCAAGAGCTGGAAGGGCA CCCTGCACTTGGATAGGGGATTATCTCGTAAGGCAAGCTCGTACCGTC ATTCATGCGGAAGAGTTAACACGATTGGAAGTAGGGATAGTTTCGAA CCTCGGTTACTAGTCCTAATAAGGGAACGCTGTCTGAAGGATGAGTGT CAGCCAGTGTA Forward Primer Reverse Primer

Answers

The forward primer for PCR amplification of the given gene sequence is 5'-ACTTTCCAAACGCCC-3', and the reverse primer is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.

To design the PCR primers for amplifying the given gene sequence, we need to identify regions that flank the target segment. The primers should be complementary to the template DNA and positioned in such a way that DNA synthesis occurs in the desired direction.

Based on the provided gene sequence, the forward primer is designed to bind to the coding (sense) strand of DNA. It starts at position 1 (5'-end) and extends for 15 nucleotides. The forward primer sequence is 5'-ACTTTCCAAACGCCC-3'.

The reverse primer, on the other hand, is designed to bind to the non-coding (antisense) strand of DNA. It starts at a position near the end of the gene sequence (position 241) and extends for 15 nucleotides in the opposite direction. The reverse primer sequence is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.

These primers will anneal to their complementary sequences on the template DNA during the PCR amplification process. The resulting amplicon will span the target gene segment and can be subsequently isolated and studied further.

To learn more about amplification click here brainly.com/question/30300512

#SPJ11

calculate the mass 9f the earth, assuring that uts is sphere with radius 6.67×10^6m.​

Answers

Answer:

6.86 × 10²⁴ kg

Explanation:

The mass of the earth m = density of earth, ρ × volume of earth, V

m = ρV

The density of the earth, ρ = 5515 kg/m³ and since the earth is a sphere, its volume is the volume of a sphere V = 4πr³/3 where r = radius of the earth = 6.67 × 10⁶ m

Since m = ρV

m = ρ4πr³/3

So, substituting the values of the variables into the equation for the mass of the earth, m, we have

m = 5515 kg/m³ × 4π(6.67 × 10⁶ m)³/3

m = 5515 kg/m³ × 4π × 296.741 × 10¹⁸ m³/3

m = 5515 kg/m³ × 1189.9639π × 10¹⁸ m³/3

m = 6546105.64378π × 10¹⁸ kg/3

m = 20565197.400122 × 10¹⁸ kg/3

m = 6855065.8 × 10¹⁸ kg

m = 6.8550658 × 10²⁴ kg

m ≅ 6.86 × 10²⁴ kg

a sphere is made up of two layers: the first is lead (density 11,340 kg/m3) and is of radius r. the second is tin, (7,310 kg/m3) and is concentric with the first, from radius r to radius 2r. the sphere is placed in a pool of mercury (density 13,600 kg/m3). how much of the volume of the sphere is below the surface?

Answers

The depth of the sphere in the mercury is approximately 2.86 cm.  

Since the sphere is placed in a fluid, the volume of the sphere above the fluid is equal to the volume of the fluid that it displaces. Therefore, we can write:

Vs=Vl+Vt+Vm

We can equate the volumes of the lead and tin layers to find the radius of the sphere:

r3=40,020m3/(3pi)

r=(40,020m3/(3pi))(1/3)r=(40,020m3/(3pi))(1/3)

Using a calculator, we can approximate this value to be 19.05 cm.

Therefore, the lead layer has a radius of approximately 19.05 cm, and the tin layer has a radius of 2r = 38.1 cm.

The volume of the sphere above the surface of the mercury is:

Vm = pi(r2)h

Vm  = pi * 340.5782 * h

Vm = pi * 11,403.952 h

Finally, we can use the formula for the volume of a sphere to find the volume of the sphere above the surface of the mercury:

Vs = π * (r3)pi(r2) * h

Substituting the values for r, we get:

Vs  = π * (19.053)pi(19.052)h

Vs  = π * 365,661.48 - π * 340,578.2 h

Vs  = π * 25,082.22 h

The depth of the sphere in the mercury is therefore:

h = Vm  / π * (19.05)

Substituting the value of Vm =, we get:

h = 11,403.952 / π * (19.05)

h ≈ 2.86 cm

Therefore, the depth of the sphere in the mercury is approximately 2.86 cm.  

Learn more about sphere Visit: brainly.com/question/30106289

#SPJ4

Tool
Scientists are searching for planets that orbit stars outside Earth's solar system by collecting data from different technology tools. A student lists a few tools and their cases that would provide clients
with information about these planets in a table, as shown
Use
spectroscope
gathers information about the
planets in any weather conditions
space probe
collects data from the planets that
would otherwise not be available
identifies different elements present
reflector telescope
around the planets
radio telescope produces images of the planets
Which tool is paired correctly with its intended use?
space probe
Opectroscope
radio telescope
reflector telescope

Answers

Answer:

9758 how many significant figures

Define investigation to show its scientific meaning.

Answers

Answer:

the action of investigating something or someone; formal or systematic examination or research.

Explanation:

This definition is provided by Oxford Languages

7. True or False : All the energy in the universe that exists right now is all there
ever will be

Answers

True is the correct answer hope this helps

I just got asked a question about quantum entanglement. Can someone please give me a basic understandable of what it is​

Answers

If you want the definition I will tell you the definition of what it means.

a property of a set of subatomic particles whereby a quantum characteristic (such as spin or momentum) of one particle is directly and immediately correlated with the equivalent characteristic of the others regardless of separation in space
In quantum entanglement, subatomic particles maintain a relationship—for instance, vibrating when the other vibrates—even when separated and even if they are at great distances from each other.

Hope it helps you.

A 1,500 kg car is at rest on a level track. The driver gives the engine gas and the car begins to accelerate forward. The car moves from 0 m/s to 27 m/s in 8 sec. What is the acceleration of the car?

Answers

Answer:

3.375 m/s²

Explanation:

Using equation of motion:

v = u + at

Here, v = 27m/s & u = 0m/s & t = 8 sec

Let the acceleration be a.

=> 27 = 0 + 8(a)

=> 27/8 = a

=> 3.375 m/s²

In the absence of air resistance, why does the horizontal component of velocity for a projectile such as a
bullet remain constant while the vertical component changes?

Answers

Explanation:

The vertical velocity changes because gravity is what brings the ball downwards, since gravity is what cause acclereation in free fall, acclereatiin will make the velocity become more negative.

There is no force happening on the ball in the horinzontal direction so according to Newton 1st law, the ball will remain in constant velocity n the horinzotnal direction.

Based on the Law of Conservation of Energy, which of the below is true?(1 point)

A. Kinetic energy is always equal to potential energy.

B. Kinetic energy is equal to potential energy minus temperature.

C. Potential energy is equal to thermal energy plus kinetic energy.

D. Energy cannot be created or destroyed by ordinary chemical or physical means.

Answers

_______________________________________________________

Based on the 'Law of Conversation of Energy', potential energy is equal to thermal energy plus kinetic energy.

In summary - Option C is correct

________________________________________________________

Hope this helps!

The conservation of energy states that energy cannot be created or destroyed by ordinary chemical or physical means.

What is a conservation of energy?

The conservation of energy refers that the total energy present in an isolated system remains constant. It means that a system itself can not generate or consume energy. Energy actually transferred from one form to another.

Conservation of energy: tell us that energy can neither be created nor destroyed, but can be transferred from one form to another. e.g Chemical to mechanical ( combustion of fuel in the vehicle to achieve mechanical work.

The conservation of energy is defined by the first law of thermodynamics. Which states that we can not generate energy or can not destroy energy but only can transfer it from one form to another. Like chemical to heat, Kinetic to potential, etc.

Therefore, the conservation of energy states that energy cannot be created or destroyed by ordinary chemical or physical means.

To know more about the conservation of energy follow

https://brainly.com/question/166559

#SPJ2

how large an angle in radians and degrees does the diameter of the moon subtend to a person on the earth

Answers

The 0.54°  large an angle in radians and degrees does the diameter of the moon subtend to a person on the earth.

What is radian ?

One radian is defined as the angle that is subtended at its center by an arc of length one unit in a unit circle (a circle with radius one unit). The radian unit of measurement is represented by the letters "rad" or "c".

What is diameter ?

The line through a circle's center with two extremes on its circumference is said to have a diameter. The term "semi-circle" refers to the division of a circle into two equal sections by its diameter. A circle's center is where its diameter meets.

Therefore,  0.54°  large an angle in radians and degrees does the diameter of the moon subtend to a person on the earth.

Learn more about radian from the given link.

https://brainly.com/question/19278379

#SPJ4

a good diffraction grating has 2590 lines/cm. what is the distance between two lines in the grating?

Answers

The distance between two lines in the diffraction  is 3.84 x 10^-4 cm.

Diffraction refers to the bending or spreading of waves around an obstacle or through an opening, resulting in an interference pattern. It is a phenomenon that occurs when waves encounter an object or an opening that is comparable in size to their wavelength.

Diffraction is observed with different types of waves, such as light waves, sound waves, and water waves. The distance between two lines in a diffraction grating can be calculated as follows:

d = 1 / (number of lines per unit length)

For a diffraction grating with 2590 lines per cm, the distance between two lines can be calculated as follows:

d = 1 / (2590 lines/cm)

=> 1 / 2590 cm/line

=> 3.84 x 10^-4 cm/line

To learn more about Diffraction :

https://brainly.com/question/30582135

#SPJ4

Under normal conditions the human heart converts about 12.5J of chemical energy per second into 1.25 W of mechanical power as it pumps blood throughout the body. (a) Determine the number of Calories required to power the heart for one day, given that 1 Calorie equals 4186 J. ________ Cal (b) Metabolizing 1 kg of fat can release about 9000 Calories of energy. What mass of metabolized fat (in kg) would power the heart for one day? _____ kg

Answers

(a) The number of Calories required to power the heart for one day is 258 Cal.

(b) The mass of metabolized fat that would power the heart for one day is 0.0287 kg.

What is the number of Calories required to power the heart?

The number of Joules of energy required to power the heart for one day is calculated as follows;

Power = 12.5 J / s

Energy = power x time

time = 1 day = 86400 seconds

Energy pumped by heart in one day = 12.5 J/s  x 86400 s = 1,080,000 J

The number of calories contained in 1,080,000 J of chemical energy is calculated as;

1 Calorie = 4186 J

= 1,080,000 J / 4186 J

= 258 Cal

The mass of metabolized fat that would power the heart for one day is calculated as;

9000 Cal = 1 kg

258 Cal = ?

= 258 / 9000

= 0.0287 kg

Learn more about energy in calories here: https://brainly.com/question/28589779

#SPJ1

Why this way of voting could benefit baboons

Answers

This makes no sense at all
Wait what..... voting benefit baboons

The efficiency of a machine is always equal to or greater than 1 (True False)

Answers

Answer: False.Machine efficiency is a measure of how much work is produced by a machine compared to how much energy is required to operate the machine.

The ratio of useful output work divided by the total input work is known as machine efficiency. This number is frequently expressed as a percentage (100 x work output / work input).Example:

For example, if you lift a 50-pound weight 10 feet in the air using a pulley, the work done is 500 foot-pounds. However, if it took 600 foot-pounds of energy to lift the weight, the pulley system's efficiency would be calculated as follows: 500/600 = 0.83 or 83 percent.

The efficiency of a machine is always less than one, in general. It is defined as the ratio of output energy to input energy. Because of losses due to friction and other variables, the output energy is always less than the input energy. As a result, the efficiency of a machine is always less than one.Answer: False.

To know more about Machine efficiency visit:

https://brainly.com/question/11752408

#SPJ11

True or false?
There is no
difference
between speed
and velocity

Answers

Answer:

False

Explanation:

Speed is the time rate at which an object is moving along a path, while velocity is the rate and direction of an object's movement.

Other Questions
Arithmetic operations provide meaningful results for variables that a. use any scale of measurement except nominal. b. have non-negative values. c. are quantitative. d. appear as non-numerical values. Why is it valuable for entrepreneurs to understand political and regulatory factors? select all that apply. Why do people keep time? Based on what you've learned, give a few reasons Find dx y by implicit differentiation cos(x) sin(y) = x2 - 4y Two positive consecutive odd integers are such that the sum of their squares is 394. what is the second consecutive odd integer? CAN SOMEONE PLS HELP WITHT HSI ASAP The thioketal product of a certain reaction is given below. Draw the structure of: the organic reactant the protecting group reactant H r D Question 5 1 pts In test of significance, we try to estimate the true mean (or true proportion) of a population. True False A patient who has shallow, slow, irregular gasping breaths is said to have ________ respirations.A) Kussmaul'sB) agonalC) central neurogenicD) Cheyne-Stokes What is the conflict in the excerpt? A family buys 5 airline tickets online. The family buys travel insurance that costs $17 per ticket. The total cost is $890. Let x represent the price of one ticket. Write an equation for the total cost. Then find the price of one ticket. Read Article "Stand and Deliver: Cross examination Strategiesfor Law Enforcement." Which of these strategies, if any, do youagree with and which, if any, do you disagree with and why? PLEASENOTE WH Carmen simplifies the expression (4 y + 8 x + 6) + 25 + (4 x + 6 y + 7). The coefficient of the variable y in her simplified answer is A. 4.B. 6. C. 10. D. 12. What are 2 examples of irony in Animal Farm?. As a unit of measure, money makes it easier for consumers to do what? a. compare prices of different products. b. make a bigger profit from their income. c. have a better exchange rate with other currencies. d. get more unearned income. please select the best answer from the choices provided a b c d A truck of mass 5000kg travels at a constant speed a distance of 100m up an incline plane that makes an angle of 10 degree with the horizontal. If the frictional forces against the motion of the truck are 1000N how much work is done? What is the force exerted by the engine of the truck? To what vertical height above the starting position does the truck travel? Why is it important to check deep underground areas of permafrost cores? What are the three types of caucuses?. Which of the following best states the purpose of the laws against theft, fraud, and coercion that exist in a free-market society? A. To ensure innovation B. To stimulate growth O C. To protect free choice D. To guarantee efficiency what is the relationship between segment AC and segment BD? 15: FIND AB.16: FIND DC