PLEASE HELP I'LL GIVE BRAINLIEST

PLEASE HELP I'LL GIVE BRAINLIEST

Answers

Answer 1

Answer:

principle or amount  your account starts with. this could be a starting investment, or the starting about amount of a loan. interest, in its most simple form, is calculated as a percent of the principal. for example, if you borrowed $100 from a friend and agree to repay it with 5% interest, then amount of interest you would pay would just pay would just be 5% of 100: $100(0.05)= $5. the total amount  you would you would repay would repay would be $105, the original principal plus the interest.

Step-by-step explanation:


Related Questions

simplify the algebraic expression to simplest form by combining like terms. c+c+c+d+c+d+d+c

Answers

Answer:

5c+3d

Step-by-step explanation:

5 x c

3 x d

Yup 5c + 3d just add all the c’s then add all the d’s

Plsssss help i have been stuck on this question for an hour.

Plsssss help i have been stuck on this question for an hour.

Answers

Answer:

Everything except g=180-53.

Step-by-step explanation:

ACF=ECB because the are vertical angles (they are opposing each other). So if ECB is g° then ACF is also g°. Think of them as symmetrical.

53+g=90 because 90-53=g and 90-g=53. (I don't know how to explain it other than this)

g+53+90=180 because ACB is a straight line (straight lines are always 180 degrees) and g, 53, 90 all make up the straight line.

90-g=53 because 53+g=90 and 90-53=g. (I don't know how to explain it other than this)

ACD=DCB because they are both right angles.

Answer:
Everything except g=180-53.
Step-by-step explanation:
ACF=ECB because the are vertical angles (they are opposing each other). So if ECB is g° then ACF is also g°. Think of them as symmetrical.
53+g=90 because 90-53=g and 90-9=53. (I don't know how to explain it other than this)
g+53+90=180 because ACB is a straight line (straight lines are always 180 degrees) and 9, 53, 90 all make up the straight line.
90-g=53 because 53+g=90 and 90-53=g. (I don't know how to explain it other than this)
ACD=DCB because they are both right angles.

"Compare the two leagues and predict which league would be more likely to win a game." please help me out. ^-^

"Compare the two leagues and predict which league would be more likely to win a game." please help me

Answers

Answer:

I'd say the one on the right, or the orange team.

Step-by-step explanation:

Their numbers, excluding the last set, are all far higher than the other's.

Diane knows a phone call to a friend costs 25 cents for the first 3 minutes and 10 cents for each additional minute. The number of minutes you call and the cost of the call are related.

Diane knows a phone call to a friend costs 25 cents for the first 3 minutes and 10 cents for each additional

Answers

It should be y=.10x + .25 because for each additional minute you are adding 10 cents to ur total cost and then u add the 25 cents to ur amount because that’s how much it costs to make the call for the first 3 minutes.

The correct equation for total amount is,

y = 10x + 75

We have to given that,

Diane knows a phone call to a friend costs 25 cents for the first 3 minutes and 10 cents for each additional minute.

Here, The number of minutes you call and the cost of the call are related.

Now, Let us assume that,

Number of additional minutes = x

Hence, The correct equation for total amount is,

y = 25 × 3 + 10x

y = 75 + 10x

y = 10x + 75

Hence, The graph of equation shown in figure.

Learn more about the equation of line visit:

https://brainly.com/question/18831322

#SPJ2

Diane knows a phone call to a friend costs 25 cents for the first 3 minutes and 10 cents for each additional

!; these are my last 2 questions,, I need help!!

!; these are my last 2 questions,, I need help!!
!; these are my last 2 questions,, I need help!!

Answers

You didn’t upload a picture or it won’t open ?
the answer is
down 4 left 2
An equation: f(x)= (x+2)^2-4

Kelly opened a bank account that earns 1.2% simple interest each year. After 7 years, Kelly will earn $126 in interest. How much did Kelly deposit when she opened the account? HELP

Answers

Answer:

13.4

Hope it helps that is what I think not that sure but I thing is corrwct!

Answer:

She deposited $115.43 when she opened the account.

Step-by-step explanation:

1.2% of 126 is 1.51

so every year she earns 1.51 dollars

so just subtract 1.51 from 126. 7 times then you will get your answer

In two days, megan has read 62 pages of James and the Giant Peach. the book has 194 pages. if p represents the number of pahes Megan has left to read, which equation represents the situation?

A: 2p + 62 = 194
B: 194 - p = 62
C: 2p = 132
D: 132 - p = 194

Answers

Option B. 194-p=62 because the total she has read minus the amount she needs equals 62
b just read it and - the p

connor found out that 60% of 40 is the same as 25% of the number n. what is the value of n?

Answers

Answer:

96

Step-by-step explanation:

Step 1: Multiply 60% by 40

40 x .60 = 24

24 is 60 percent of 40

Step 2: If 24 was 25% of n, then we have to divide 100 by 25 to see how much we have to multiply 24 by.

100 ÷ 25 = 4

Step 3: Multiply 4 by 24

4 x 24 = 96

The answer is 96 :)

Hope this helps :)

-jp524

The answer is 96 because I ma smart

The weight of a bag of peaches is estimated to be 5 lbs. The actual weight is 5.3 lbs.

What is the percent error in the estimate?

Enter your answer, rounded to the nearest tenth, in the box.

%

Answers

Answer:

0.3% sorry it says estimate but i think this is the right answer if it is could u please mark brainliest

Step-by-step explanation:

please answer the questions

please answer the questions

Answers

Draw a van diagram then in the middle write what is the same about them. Then state why and how these are the same

Which pair of points forms a vertical line segment that is 4 units long? A. (–3, 5) and (–7, 5) B. (3, –8) and (3, –4) C. (2, 1) and (2, 3) D. (2, 4) and (–2, 4)

Answers

Answer: (-7,5) and (-3,5) :) there for answer is A

Step-by-step explanation:

Answer:

a

Step-by-step explanation:

Help pls!! it's urgent.

Help pls!! it's urgent.

Answers

Answer:

Step-by-step explanation:

Help pls!! it's urgent.

HELPP PLEASE LOOK AT IMAGE

HELPP PLEASE LOOK AT IMAGE

Answers

Answer:

33.3%

Step-by-step explanation:

There are 3 sections the spinner can land on, and only one meets the requirement (less than 3, so the 2 section is the only one). Therefore the chance of landing on 2 is 1/3, or 0.333...... which can be converted into percentage by multiplying it by a hundred.

-0.333..... x 100 = 33.33333....

If this helped, please consider picking this answer as the Brainliest Answer. Thank you!

5 1/4, 90 cm ,6 cm find the height of this prism

Answers

Answer: I think it is 13 cm

Step-by-step explanation:

I think the answer is 13cm

???????????????????????????

???????????????????????????

Answers

Answer:

12 and 78 are complementary.

80 and 100 are supplementary.

50 and 50 are neither.

Step-by-step explanation:

Hope it helps! =D

A pair of sneakers are on sale for 20% off the original price. Tom purchased a pair of sneakers at this discounted price of $80. What is the original price of the sneakers?

write very professionally i need this for extra credit

Answers

The answer is 100.
You start by making a formula:
.80(x) = 80,
As we know the discount is 20% off, which makes the price actually 80% of what it originally was. Convert percent to a decimal gets you that .80
Reverse the process — 80/0.80 = 100
well the answer to your question is 100!

pls hurry its the quiz for k12

pls hurry its the quiz for k12

Answers

Answer:

its the last choice

3-n=14

Step-by-step explanation:

3 less than a number is 14 tells u that u have to subtract 3 by a number which is represented with the letter N and that equals 14

(I'm in k12 too)

Hope this helps!

It will be the last answer choice bro , have a great day!

What is the value of the following expression?


A 10

B 15

C 19

D 27

What is the value of the following expression?A 10B 15C 19D 27

Answers

D.27
Reason-
You solve the exponents, then you add the numbers in () then multiple it, and finally divide it by 4

What is the slope of the line and what does it mean in this situation?
The slope of the line is A 2.5 B 4 C 5 D 5.5 that means that A 2.5 B 5.5 C 10 D 12 mm of rain falls every A half hour B hour C 2 hours D 3 hours

What is the slope of the line and what does it mean in this situation? The slope of the line is A 2.5

Answers

Answer:

The slope is 2.5 and that means that 2.5 millimeters of rain falls every hour.

Explanation:

We can clearly see that the graph is moving in a positive direction, so we know our slope will be positive. Using the rise over run technique, we will have to rise 5 and move right 2 units in order to get from the first point to the second point. 5/2 = 2.5

So every hour, 2.5 mm of rain falls.

thats very interesting

-3 + 6x. Which expression shows the correct factorization?
Here are the ones to pick from
1. -2 + -2 +6 +x
2. 6(-2 +x)
3. 6(-2 +x)
4. -3 (1 - 2x)

Answers

Answer:

Option #4

Step-by-step explanation:

Expand option #4

=-3(1-2x)

=-3 -2x*-3

=-3+6x which is what your original equation was.

becoz it is a multiple choice, we can go by elimination, hence when we expand #4, we will get -3+6x

Helppppp
what are the answers

Helpppppwhat are the answers

Answers

Answer:

A. 24 lap/hour.

B. r = 24h

1. 24 lap/hour 2. r=24h

HELP ASAP Q# 10, 11, and 12!


ILL GIVE BRAINLETS TYY

HELP ASAP Q# 10, 11, and 12!ILL GIVE BRAINLETS TYY

Answers

Answer:

Q10. 2.75 or 114

Q11. 36.2 or 1815

Q12. 5.55 or 11120

I know this question is not about math or science but my friends are saying the Leonardo DiCaprio when he was young is hotter than Zac Efron now and when he was young. I need y’alls opinions.
Who is hotter, young Leonardo DiCaprio or 35 year old Zac Efron? My pick is Zac Efron but I want some opinions.

Answers

Answer:

it's Zac Efron for sure, Leonardo DiCaprio is just not the same...

young leonardo for sure

Choose the correct written expression for: (3 x 4) + (6


the product of 3 and 4 plus 6 divided by 2


the product of 3 and 4 plus the quotient of 6 and 2


3 times 4 plus 6 divided by 2


the quotient of 3 and 4 plus the product of 6 and 2

Answers

Answer:

all the above

Step-by-step explanation: First you have 3 x 4, you can say, the product of 3 and 4, or three times four. now we have a plus sign. You can say plus (like you said in the answer choice), or added together with... And finally we have 6 divided by 2. You can say the quotient of 6 and 2, or 6 divided by 2. Sorry if it's wrong, and have a good day.

I also got all of above hope this helps

At the time that Han reaches the lake and starts to turn back, Jada is 0.6 miles away from the parking lot and hiking at a constant speed of 3.2 miles per hour toward the lake. Han’s distance, d, from the parking lot can be expressed as d = -2.4t + 4.8, where t represents the time in hours since he left the lake.

What is an equation for Jada’s distance from the parking lot as she heads toward the lake?

Answers

Answer:

0.6x3.2

Step-by-step explanation:

pls help me and pls explain how u got answer

pls help me and pls explain how u got answer
pls help me and pls explain how u got answer

Answers

Answer:

q+4 + d-3 + n ; first

Step-by-step explanation:

first :q quarter d dimes n nickels

then: q+4 quarter d dimes n nickels

then: q+4 quarter d-3 dimes n nickels

so you have q+4 + d-3 + n

first is the only option that has division the other involve subtraction

Please help me thank you so much!

Please help me thank you so much!

Answers

Answer: have you asked g o o g l e

Step-by-step explanation:

Answer:

5 1/4 ft

Step-by-step explanation:

A factory worker finds 26 products are defective out of a random sample of 400 products. Based on the results, about how many of the 56,000 products produced this month can be expected to be defective?

A factory worker finds 26 products are defective out of a random sample of 400 products. Based on the

Answers

Answer:

yeah man it could i just did the math on my book... xxx

26/400 are defective so to get both of your answers to out of 56,000 you need to multiply them both by 140 therefore your answer is 3,640

Can ya'll help me? I have tried to do it but I keep getting it wrong :(

Can ya'll help me? I have tried to do it but I keep getting it wrong :(

Answers

Answer:

A: 4

Step-by-step explanation:

So first you can move the 2^-5 to the denominator, making the equation (2^2) (4^3) / (2^5) (2)

Then simplify the terms so you end up with (4)(64) / (32) (2)

Then multiply the denominator so you end up with (4) (64) / (64)

Since both the denominator and numerator have 64, those cancel out leaving you with 4

If you need more clarification feel free to ask

Answer:

A) 4

Step-by-step explanation:

Evaluating

(2⁻⁵)(2²)(4³)(2⁻¹)(2)⁻⁵⁺²⁻¹ x (2²)³(2)⁻⁴⁺⁶(2)²4

(a) Find the volume of the container.
12cm
22cm
10cm
7 cm
8 cm

(a) Find the volume of the container.12cm22cm10cm7 cm8 cm

Answers

Answer:

Step-by-step explanation: you would have to cut the shape in to two then multiply the base x width x length

Multiple the base x height x Edith
Other Questions
which of the following describes RNA-RNA is usually single-stranded and contains uracil-RNA is made and carries out its functions in the nucleus-RNA is usually double stranded in contains thymine-RNA is longer and contains five bases Table 2 shows the data on idle time per day in minutes for a worker in a machine position. In this idle time neither the worker nor the machine is working. Consider that the working day is 8 effective hours.Table 2.Daily idle times at the machine stationDay Minutes1 402 353 254 385 256 407 308 379 3810 2511 2612 2813 3514 2315 33 16 37 17 2818 3219 3020 3321 3322 2423 3324 3225 28Construct the control chart for the idle time ratio for this study based on three standard deviations, showing the control limits and the idle time ratio data. It must show the calculations and graph the result of the analysis carried out for the information in Table 2. can someone make sure I'm right please Robot Smart Ltd is a leading high-tech company which is incorporated in Surrey, BC. Thecompany wants to add an additional production line in August 2022. They hired you, a UCWgraduate, to prepare a capital budgeting for the project.Below is the information that your manager provided:1. The facility is made up of one piece of land in North Vancouver value at 10%, one nonresidential building value at 20% of the total cost 70% of manufacturing equipment. Atthe end of projects life, the equipment will be sold for an estimated $0.2 million; assumethe buildings value will be $0.1 million. Land residual value is unclear.2. Start-up costs include $1.5 million to build the production facilities, including land,building and equipment. The project will last for 8 years.3. The company estimated that it is able to make 2300 of its new products robots, could besold annually over the next eight years at a price of $800 each. Variable costs per robotare $300 and each years fixed costs is 55,000.4. To handle the new product line, Robot Smarts net operating working capital would haveto increase by an amount equal to 10% of sales revenues and will be half recovered at theend of project.5. However, if Robot introduces its new products, sales of its existing products will fall$300,000 per year. There will also be $80,000 to hire new workers who are familiar withthe new equipment operation. The market research on the new robots was $350,000. Thecompany will retool one of its existing manufacturing facilities to produce the newmodel. The one-time retooling cost is $170,000. BC government also granted thecompany an innovation funding of $10,000 in Jan 20226. The manager is complaining the inflation will affect fixed cost, variable cost and the salesprice in current years. The financial division has estimated the companys WACC is12%. The company also assume the sales will increase 8% per year.Requirements1. Using an Excel spreadsheet: Find the NPV of the project by using the pro forma financial statement method to determine cashflows. Set up the necessary equations by referencing to the input variable cells. The spreadsheet must beformula driven; do not put any numbers in equations, must use cell references. vocado Company has an operating income of $85, 920 on revenues of $3, 222,000. Average invested assets are $537,000 and Avocado Company has an 8% cost of capital. What is the investment turnover? 16.00 37.50 6.25 6.00 The largest metabolic reserves for the average adult are stored as A. carbohydrates. B. proteins. C. amino acids. D. triglycerides. E. fatty acids. omar incorporated paid a $24,000 expense, only $18,000 of which was deductible. if omar's marginal tax rate is 40%, compute the after-tax cost of the expense. group of answer choices For exercises 49, find the value of x. round to the nearest tenth.[ 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA What is Accenture's approach when it comes to helping our clients? (5,-8) and (r,-4); slope: 4Find r Help me on this please Which ion stimulates shape changes at the beginning of skeletal muscle contraction?. please number of the question and the correct answer do not explainThe presyraptic neuron Conducts impulses away from the synapse Conductsimpulses toward the symapse. Uses gap junctions exclusively for transmitance of impulses: Muscies are named in many way for campl Evaluate A2 for A = 2.3 5.925.294.9 which on correct Which is NOT a true statement? please match the following PLS HELP! DUE TODAY! 15 POINTS! The population in a 50 miles^2 area is 200, 000 people, What is the population density? Show your work. 45. a) Read the following advertisement and prepare resume Write a CV for the post of a Computer Engineer at a reputed Multi National Company and send it to P.O. Box No. 3782, C/O The Hindu, Anna Salai, Chennai-600 003. (OR) b) You have borrowed a branded cricket bat from your reluctant friend for an out station match. After returning home you realize you have absent-mindedly left it in the hotel room. Write a letter of apology and regret to your friend. e correctly