PLEASE HELP!! (earth science)

PLEASE HELP!! (earth Science)

Answers

Answer 1

Answer:yes

Explanation:27.5


Related Questions

opción que contiene los elementos que favorecieron el asentamiento de las culturas mesoamericanas​

opcin que contiene los elementos que favorecieron el asentamiento de las culturas mesoamericanas

Answers

Answer:

option that contains the elements that favored the settlement of Mesoamerican cultures

If you observed that the Sun did not set during an entire 24-hour period of time during the summer months of June, July, and August, where are you most likely located?
South Pole
a location in the mid-latitudes
North Pole
near the Equator

Answers

Sun did not set during an entire 24-hour period of time during the summer months of June, July, and August,  you are most likely located at the North pole.

The sun does not set above this latitude during the summer because of the Arctic Circle Phenomenon. The Arctic Circle is a fictitious boundary. The Arctic Circle's North Pole experiences extended periods of continuous sunshine, mostly in the months of June, July, and August. The reason for this is that Earth's axis is slanted by 23 degrees, and during the summer months when it rotates, the North Pole aligns with our star. For instance, the farthest reaches of Norway.That is why during the summer months of June, July, and August, the Sun did not set for a full 24 hours.

learn more about North pole here:

https://brainly.com/question/26684990


#SPJ1

which of the following is least likely to help a virus avoid triggering an adaptive immune response?

Answers

Answer:

Synthesizing protein similar to other viruses would not help the virus avoid activating the adaptive immune response. The MHC molecules of the cells recognize the other protein molecules. It triggers the adaptive immune system.

21. Some fish, some dogs and some children are swimming in a bay. There are 40 legs in total, twice as
many heads as tails and more dogs than fish.
How many fish are in the bay?

Answers

If they are 40 legs in the bay and you are trying to find how many fish are in the bay fish don’t have legs so it would be 0

Use the mechanisms of meiosis to explain why most mules are sterile.
Use your knowledge of the mechanisms of meiosis to explain why most mules are sterile.
1. An even number of chromosomes are required for synapsis during prophase II and proper pairing during metaphase I.
2. An even number of chromosomes are required for synapsis during prophase II and proper pairing during metaphase II
3. An even number of chromosomes are required for synapsis during prophase I and proper pairing during metaphase
4. An even number of chromosomes are required for synapsis during prophase I and proper pairing during metaphase II

Answers

Answer:

3. An even number of chromosomes are required for synapsis during prophase I and proper pairing during metaphase

Explanation:

Mules are hybrids of a cross between a female horse and a male donkey. Horses contain 64 chromosomes while donkeys contain 63 chromosomes in their somatic cells respectively. This means that they each produce 32 and 31 chromosomes respectively during meiosis. A mule, hence, contains 32+31= 63 chromosomes in their somatic cells.

This chromosome number in mules are uneven for meiosis to occur because meiotic division requires that an even number of homologous chromosomes pair together in a process called SYNAPSIS during prophase I of meiosis I. This is impossible in a mule because of the uneven number of chromosomes in its cells.

Also, during metaphase of meiosis, the homologous chromosomes need to be properly aligned at the equator for separation to occur. This is also impossible in a mule considering the number of chromosomes that don't add up.

Due to this reason of unevenness in the number of chromosomes present in a mule, meiosis will not occur and if meiosis (gamete formation) does not occur, reproduction cannot take place. Therefore, the mule is a sterile species i.e. cannot produce offsprings via sexual reproduction.

Many scientists disagree about the relationship between a clownfish and a sea anemone. (Remember ‘Finding Nemo ?’) Which two symbiotic relationships are likely being studied? Which do you think is the best relationship this is science :)

Answers

Answer:

Mutualism and Commensalism

Explanation:

Which of the following is the biggest threat to the Monarch butterflies’ annual migration? a. illegal logging c. airplanes b. cold winters d. new predators

Answers

Answer:

A

Explanation:

took the test

Answer:

a

Explanation:

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

Which is not a characteristic of plants, autotroph, unicelluar, eukaryotic, cell walls

Answers

Answer:

Unicellular

Explanation:

All plants are multicellular, unicellular plants do not exist.

Hope this helps dude

Please help, thank you!
Mitosis is the division of the ____________ and cytokinesis is the division of the _____________.

cell, chromosomes
nucleus, cytoplasm
chromosomes, centrisomes
cytoplasm, nucleus

Answers

Answer: Nucleus cytoplasm

Answer:

Nucleas;cytoplasm

Explanation:

Mitosis divides the nucleus into two nuclei, followed by cytokinesis which divides the cytoplasm.

Brainliest pleaseee

What does f(10) represent? The number of dollars it costs for 10 people to rent the house The number of houses that can be rented for 10 days The number of days the house can be rented for a cost of $250 The number of dollars it costs to rent the house for 10 days

The total cost f(x), in dollars, for renting a vacation house for x days is shown:

f(x) = 10 + 250x

Answers

The function f(x) = 10 + 250x represents the total cost, in dollars, for renting a vacation house for x days.  In this case, f(10) represents the cost of renting the house for 10 days, which can be calculated as 10 + 250(10) = 2510 dollars. Option 4 is correct.

To find out what f(10) represents, we simply substitute 10 for x in the given function:

f(10) = 10 + 250(10)

f(10) = 10 + 2500

f(10) = 2510

This function can be used to calculate the total cost of renting the house for any number of days, making it a useful tool for budgeting and planning purposes. Hence option 4 is correct.

To know more about budgeting, here

brainly.com/question/15683430

#SPJ1

--The complete Question is, What does f(10) represent?

The number of dollars it costs for 10 people to rent the house The number of houses that can be rented for 10 days The number of days the house can be rented for a cost of $250 The number of dollars it costs to rent the house for 10 days

The total cost f(x), in dollars, for renting a vacation house for x days is shown: f(x) = 10 + 250x --

Which body system has a function most similar to the role lysosome plays for a cell

Answers

Answer:

the excretory system

What do you think? How is it possible for hereditary information to be copied in such away that the characteristics of a species are passed from one generation to the next, yetthere are still individual differences within the species? In your answer, state how youthink this is possible.

Answers

During meiosis, the process that produces gametes, in the Phophase I, the homologous chromosomes exchange genetic information through crossing over. This means that the altough the cromosomes carry the genetic information of the parents, after the genetic recombination, the homologous chromosomes are different from the chromosomes of the rest of the cells of the parent's body.

After meio

Which cell is capable of mitosis:
O a. fibrocytes
b. adipocytes
O C. chondrocytes
d. osteoblasts
e. osteoclast

Answers

Answer:

Osteoclast

Explanation:

what is sold profile? write the names of various horizons of soil with the help of a neat labeled diagram​

Answers

Answer:

A Horizon

B horizon

C horizon

R horizon

Explanation:

he hope it help

what is sold profile? write the names of various horizons of soil with the help of a neat labeled diagram

can somebody please help me?

can somebody please help me?

Answers

Answer:

100% of the offspring would be black fur, black eyes (16/16)

Explanation:

(Because the info. wasn't included here, I'm assuming black fur and black eyes are dominant, BBEE, to the recessive white fur and red eyes, bbee)

For BBEE x bbee, you'd create a typical dihybrid true-breeding punnett square , where the first top row would be BE , BE, BE , BE , and the vertical/side row would be be, be, be, be.

Cross these alleles as you would typically for any punnett square, and you'd see that all the offpsring would result in BbEe genotypes, which is true of any true-breeding dominant x recessive cross, which always results in the dominant phenotype being 100%.

So...

Black Fur and Black Eyes : 16/16 (100%)

Black Fur and Red Eyes: 0/16

White Fur and Black Eyes: 0/16

White Fur and Red Eyes: 0/16

In addition to nutrition, health is affected by all of the following except _______.

lifestyle
environment
genetics
seasons

Answers

In addition to nutrition, health is affected by all of the following except seasons; option D

What factors affect health of a person?

Health is defined as the complete wellbeing of a person socially, mentally, physically, and emotionally not just the absence of disease or infirmity.

The health of an individual is affected by the following factors:

nutritionlifestyleenvironmentgenetics

Therefore, the seasons do not affect the health of an individual.

In conclusion, health refers to complete wellbeing of an individual.

Lear more about factors that affect health at: https://brainly.com/question/20297086

#SPJ1

Explain why the spread of antibiotic -resistant microorganisms caused the return of strep throat

Answers

Answer:

Natural selection states that if a survivor survives and is well-adapted to a certain environment, then offspring from that survivor will be created and beneficial traits for the offspring will be received, giving them a chance for survival. So, the microorganisms reproduce and spread anti-resistance offspring. The lastahas strep throat returns until no resistant microorganisms exist.

I hope this helps you

:)

What trend, if any, is evident in Mel’s data?

What trend, if any, is evident in Mels data?

Answers

The trend that is evident is: Initially, there seems to be support for Mel's hypothesis, but the gold data is not consistent with the predicted trend.

Option C is correct.

How do we calculate?

The data for zinc, nickel, copper, and silver shows that as the density increases, the melting point tends to increase.

From the data we can see , the data for gold does not follow this trend, as its density is lower than silver but its melting point is higher.

Therefore, while there is some initial support for Mel's hypothesis, the inconsistency with gold indicates  that the relationship between density and melting point is not solely determined by density.

learn more about density at:

https://brainly.com/question/1354972

#SPJ1

Name two software programs that you can use to create files that can then be used in PowerPoint.

Answers

Answer:

Googl e and Kam i

Explanation:

I tried it before

Two software programs that you can use to create files that can be used in PowerPoint are Microsoft Word and Microsoft Excel.

Word is a word processing program that allows you to create and edit textual content. You can use Word to create documents, reports, and other textual content, and then easily import or copy the content into PowerPoint slides. This is particularly useful when you need to include lengthy paragraphs, bullet points, or other textual elements in your presentations.

Excel is a spreadsheet program that is commonly used for data analysis and organization. While Excel is primarily used for numerical data and calculations, you can also use it to create tables, charts, and graphs. You can then copy or import these tables, charts, or graphs from Excel into PowerPoint to enhance your presentations with data-driven visuals.

Learn more about Microsoft Word on:

https://brainly.com/question/26695071

#SPJ2

The pedigrees below show the inheritance of three separate, rare autosomal conditions in different families. For each pedigree, decide if the condition is better explained as recessive or dominant.
Drag the correct label to the appropriate location. Labels can be used once, more than once, or not at all.
autosomal dominant reaction, autosomal dominant reaction, autosomal recessive.

Answers

Autosomal dominant, autosomal dominant, and autosomal recessive reactions are all possible.

There is a 1/3 possibility that individual II-3 does not have the recessive gene and a 2/3 likelihood that this individual is a carriers because this individual is not displaying the recessive characteristic. Using pedigrees, one may determine how a given trait is passed down through a family. A trait's existence or absence as it pertains to the link between parents, children, and siblings may be seen in pedigrees. Men who are afflicted have the recessive gene, whereas males who are not affected have had the dominant (wild-type) allele. -Heterozygous females have impacted sons but are unaffected (carriers). Both parents pass on autosomal recessive features to their offspring.

Learn more about dominant

https://brainly.com/question/4456852

#SPJ4

which body system is mainly affected by a stroke explain why

Answers

Circulatory system

A clot typically causes blocked blood flow strokes. These are the most common, causing nearly 90 percent of all strokes. If you've had a stroke, you are at a higher risk of having a second stroke or heart attack.

It affects the arteries leading to and within the brain. A stroke occurs when a blood vessel that carries oxygen and nutrients to the brain is either blocked by a clot or bursts. When that happens, part of the brain cannot get the blood (and oxygen) it needs, so it starts to die.

Answer:

it affects the arteries leading to and with in the brain. astrok occurs when a blood vessel that carries oxygen and nutrients to the brain is eithier blocked by a clot or bursts when that happens part of the brain can not get blood and oxygen it needs so it starts to die.

TTT 18. All of the following are chemical approaches to control micro-organism excepts: A. Antibiotics B. Disinfectants 19. The scientific name for modern man is C. Antiseptics D. Autoclaving A. Homo erectus B. Homo sapiens 20. In which of the following kingdoms are prokaryotic organisms placed? A. Fungi B. Protest C. Australopithecus D. None C. Planate D. Monera 21. Plants which have true roots, leaves, stem & seeds inside the fruit are A. Gymnosperm C. Mosses D. Ferns B. Angiosperm 22. Which of the following taxonomic groups contains closely related organisms? A. Genus C. Phylum B. Order D. Class 23. Malaria causing single celled parasitic protozoan is called A. Paramecium B. Salmonella C. Mosquito D. Plasmodium 24. Which one of the following kingdoms is consists of eukaryotic organisms such as yeast moulds and mushrooms? A. Ecosystem B. Population 26. Which of the following organism are consumers? A. Photosynthetic B. Chemosynthetic bacteria C. Green plant D. Scavengers Answer the following questions. C. Kingdom monera D. Kingdom plantae A. Kingdom fungi B. Kingdom protista 25. Ecology is a biological science that deals with all of the following except C. organism D. none​

Answers

All of the options are chemical approaches to control micro-organism excepts: B Disinfectants

19. The scientific name for modern man is: B. Homo sapiens

20. kingdoms are prokaryotic organisms placed D. Monera

21. Plants which have true roots, leaves, stem & seeds inside the fruit are: B. Angiosperm

22.  taxonomic groups contains closely related organisms A. Genus

23. Malaria causing single-celled parasitic protozoan is called: D. Plasmodium

24. kingdoms consists of eukaryotic organisms such as yeast, molds, and mushrooms A. Kingdom fungi

25. Ecology is a biological science that deals with except: D. none

26. The organism that are consumer is D. Scavengers

What is the chemical approaches to control micro-organism

Disinfectants are special chemicals that are used to kill germs or prevent them from growing on surfaces or objects. They are not usually used to control microorganisms within living things, unlike antibiotics, antiseptics, and autoclaving, which are all chemicals used to control microorganisms.

Homo sapiens is the fancy name used by scientists to refer to regular, everyday humans This is the species that humans are a part of.

Read more about micro-organism here:

https://brainly.com/question/8695285

#SPJ1

18. All of the following are chemical approaches to control micro-organism excepts: A. Antibiotics B. Disinfectants

19. The scientific name for modern man is C. Antiseptics D. Autoclaving A. Homo erectus B. Homo sapiens

20. In which of the following kingdoms are prokaryotic organisms placed? A. Fungi B. Protest C. Australopithecus D. None C. Planate D. Monera

21. Plants which have true roots, leaves, stem & seeds inside the fruit are A. Gymnosperm C. Mosses D. Ferns B. Angiosperm

22. Which of the following taxonomic groups contains closely related organisms? A. Genus C. Phylum B. Order D. Class

23. Malaria causing single celled parasitic protozoan is called A. Paramecium B. Salmonella C. Mosquito D. Plasmodium

24. Which one of the following kingdoms is consists of eukaryotic organisms such as yeast moulds and mushrooms? A. Ecosystem B. Population

25. Ecology is a biological science that deals with all of the following except Answer the following questions. C. Kingdom monera D. Kingdom plantae A. Kingdom fungi B. Kingdom protista C. organism D. none​

26. Which of the following organism are consumers? A. Photosynthetic B. Chemosynthetic bacteria C. Green plant D. Scavengers

What is the source of energy that powers a hydroelectric power plant?

A. The thermal energy of the water behind dams.

B. The energy of the chemical bonds of water molecules.

C. The sunlight that evaporated water that eventually falls as rain and fills the reservoir.

D. The kinetic energy of wind that carried evaporated water, which fell as rain and filled reservoirs

Answers

Answer: water. so A

Explanation:

photosynthesis. a) State TWO reasons why you know this micrograph shows plant cells. b) Draw two whole cells of leaf tissue. Provide your diagram with labels and a heading. ) A leaf is a collection of tissues that perform a specific function. State whether a leaf is a system or an organ. Explain your answer. ure 16 below shows a) epithelial that line the human mouth and nerve cell that transmits perve​

Answers

The majority of organelles are found in both plant and animal cells. Cells do not have a cell wall, a big central vacuole, or plastids like chloroplasts. Plant cells, on the other hand, do.

Why do leaves photosynthesis in the first place?

A photosynthetic unit is a leaf. They are the plants' organs best suited and most adapted to photosynthesis for the following reasons: Chloroplasts, or cells containing chlorophyll, are found in leaves. Stomata found there aid in the gas exchange.

Explain the two phases of photosynthesis.

First, in a process known as light-dependent processes, autotrophs absorb energy from the sun. The acquired solar energy is then transformed into potential energy in the second stage, known as light-independent and dark reactions, which is present in autotrophs in chemical bonds within macromolecules.

To know more about organelles visit:

https://brainly.com/question/2135497

#SPJ1

if you were not able to experience the above listed changes, what might have caused such difference? ​

Answers

Answer:

If you don't experience the listed changes above you will get very curious about yourself and you might lose some confidence due to not being able to experience some changes others have experienced.

Explain the process of gained or released heat energy during the processes of evaporation and condensation. What are these processes called?

Answers

Answer: evaporation, sublimation, and condensation

Explanation: Energy is required to change from solid to liquid, liquid to gas (evaporation), or solid to gas sublimation Heat is taken from your skin to evaporate the water on your body. Evaporation is a cooling process. Latent heat of condensation is energy released when water vapor condenses to form liquid droplets.

Condensation is the change from a vapor to a condensed state (solid or liquid). Evaporation is the change of a liquid to a gas.

What new knowledge was gained from Frederick Griffiths work with pneumococci bacteria

What new knowledge was gained from Frederick Griffiths work with pneumococci bacteria

Answers

Answer:The new knowledge gained from Frederick Griffith's work with pneumococci bacteria is that bacteria contain a physical substance that can change the structure of other bacteria. Therefore, option 3 is the correct answer.

Explanation:

Base your answers to parts a and b on the diagram below and on your knowledge of biology. Part A: explain why process 2 is important to sexual production. Part B: identify processes 1 and 3. State one difference between the cells produced by process 1 and the cells produced by Process 3.

Base your answers to parts a and b on the diagram below and on your knowledge of biology. Part A: explain

Answers

Answer:

1. Please find the explanation to Part A below

2. Process 1 is meiosis while process 3 is cell division

3. Cells produced in process 1 are haploid while cells produced in process 3 are diploid

Explanation:

PART A:

The process 2 described in the attached image is called FERTILIZATION. It is the process whereby male gamete (sperm) unites with the female gamete (egg) to yield a ZYGOTE. This process of fertilization is important to sexual reproduction because it is the way the diploid state of an organism is restored after haploid gametes must have been formed via meiosis. In other words, haploid (n) sperm and egg unites during fertilization to yield a DIPLOID ZYGOTE (2n).

PART B:

- Process 1 in this attached image depicts MEIOSIS, which is the process whereby haploid daughter cells (gametes) are formed from the division of a diploid cell. Meiosis reduces the chromosome number of a cell by half.

- Process 3 is CELL DIVISION. The zygote formed from fertilization (process 2) undergoes series of cell division to produce the EMBRYO.

PART C:

The cells produced in process 1 (meiosis) are HAPLOID i.e. contains one set of chromosomes while the cells produced in process 3 (cell division) are DIPLOID i.e. contains two set of chromosomes

In a data set, thAre claims about the effects of meditation most likely scientific or pseudoscientific?

scientific, because people have been claiming for thousands of years that meditation helps them
scientific, because observations of brain growth and chemicals are made carefully and repeatedly
pseudoscientific, because practices that are related to religion are based on beliefs and are subjective
pseudoscientific, because people have made claims about it but scientific observations have not been madee number that appears the most is called the
.

Answers

In a data set, the claims about the effects of meditation are most likely scientific because observations of brain growth and chemicals are made carefully and repeatedly.

Option B is correct.

What is pseudoscience?

Pseudoscience can be referred to a term consisting of statements, beliefs, or practices that claim to be both scientific and factual but are incompatible with the scientific method.

In a data set, the claims about the effects of meditation are most likely scientific because observations of brain growth and chemicals are made carefully and repeatedly.

scientists have made claims about the effects of meditation and what it does to the brain with the results being shown in the recording of the brain activities. Therefore, we would say meditation is a scientific process.

pseudoscience on the other hand have made claims about meditations but scientific observations have not been made to back up the claims.

Learn more about pseudoscience at: https://brainly.com/question/28263500

#SPJ1

Other Questions
What does the Java Virtual Machine seek first? Which best explains how the Appalachian Mountains formed? A.an ancient river floodedB.an earthquake folded landtectonic plates pulled apartC. tectonic plates collided What punctuation belongs in the blank? I have a lot of pets: a dog, Jake___ a cat, Sassy and a fish, Blinky.A. SemicolonB. CommaC. No punctuation neededD. Colon How many cans of paint are needed to cover an area of 2000? originally, savings and loan associations multiple choice handled the overflow of business from national and state banks. promoted consumer thrift and home ownership. acted as a fiscal agent for the federal government, and issued and redeemed u.s. savings bonds. offered brokerage services to small investors. For a health claim to be made about a food product it must not contain more than? According to the author why are girls generally more affective isolated individuals A certain brand of electric bulbs has an average life of 300 hours with a standard deviation of 25. A random sample of 100 bulbs is tested. What is the probability that the sample mean will be less than 295? a) State ONE (1) area of bioceramics and provide an example. b) Explain the following polymer synthesis. Give ONE (1) example in your answer. i) Addition polymer ii) Condensation polymer c) Explain how the crystallinity of polymer affects the physical properties. Two arithmetic sequences $A$ and $B$ both begin with 30 and have common differences of absolute value 10, with sequence $A$ increasing and sequence $B$ decreasing. What is the absolute value of the difference between the 51st term of sequence $A$ and the 51st term of sequence $B$ Which propaganda technique uses peer pressure to persuade people into joining the crowd in support of a person, product, or idea?A.BandwagonB.TransferC.Name-callingD.Testimonial E.7. Evaluate the following indefinite integral. Label any substitutions you use. Show a couple of steps. Explain any details that need clarification. 3 x (In 2) Edit View Insert Form *Art History* What exactly would you say is going on in this picture? according to the fisher equation, the nominal interest rates will be 15 percent if the inflation rate is:a. rate of inflationb real interest rate minus the rate of inflationc real interest rate plus the rate of inflationd. rate of unemploymente. real interest rate plus short-run economic fluctuations What is the purpose of the General Assembly of the United Nations?place for all governments to trade productsplace for all governments to discuss problemsorganization to control warsorganization to distribute monies to countries 54-643-25241 scienceGiving brainlyist and 5 stars for trying ill give u 5 starsThere are clouds in the sky that look like thin feathers. They are wispy and form high in the sky. What weather can you predict when you see these clouds?A. Clear skies with no precipitationB. Heavy rain, snow, or sleetC. A large snowstorm with hailD. Rain, hail, or snow NEED HELP ASAP PLEASE Describe the controversy surrounding dissociative identity disorder as a diagnosis and explain how stressmay play a role in a misdiagnosis. .A circle is inscribed in quadrilateral ABCD. If AB = 4, BC = 5, and CD = 8,what is DA? After studying the indigenous peoples of australia, ________ concluded that any form of religion is united in its definition of what is considered to be ________ and ________.