Answer:
(a)=87%
(b)=14%
(c)= coal
(d)=20%
(e)=it radiates light and heat, or solar energy, which makes it possible for life to exist on earth
2. From the knowledge of nutrition:-
a) What five conditions are necessary for photosynthesis to occur
Answer:
Carbon dioxide
sunlight
oxygen
chlorophyll
water
Hope this helps u
6 Truffle belongs to Phylum.……....... (1 Point) a) Ascomycota. b) Basidiomycota. c) Zygomycota.
Truffle belongs to Phylum Ascomycota. Ascomycota is a division or phylum of the kingdom Fungi, consisting of organisms commonly known as the sac fungi.
The group is characterized by the formation of spores in a sac-like structure called the ascus, which is often contained within fruiting bodies called ascocarps. Some of the well-known members of this group include morels, truffles, and yeasts.The other two phyla of fungi are Basidiomycota and Zygomycota.
Basidiomycota includes organisms that form spores on basidia, such as mushrooms, while Zygomycota are characterized by the formation of spores within a zygospore, such as bread molds.
To know more about Phylum Ascomycota visit:-
https://brainly.com/question/31439764
#SPJ11
All of the following organisms are involved in carbon fixation EXCEPT Group of answer choices green and purple sulfur bacteria. cyanobacteria. lichens. algae. mycorrhizae.
Answer:Mycorrhizhae
Explanation:
Which of the following is an example of cross contamination? *
1 point
cutting a tomato and lettuce on the same cutting board
cutting chicken and a tomato on the same cutting board
washing the cutting board with hot water and soap before cutting each ingredient
A light bulb converts electrical energy to
thermal energy and mechanical energy
nuclear and chemical energy
electromagnetic (light) energy and thermal energy
electrical and chemical energy
Answer: electromagnetic (light) energy and thermal energy
Explanation:
8 h2o molecules to 2 h2o molecules
The conversion of 8 H₂O molecules to 2 H₂O molecules is a chemical change that occurs through a dehydration or condensation reaction. This process involves the removal of water molecules to form a larger molecule and requires energy to occur.
This is a reaction that occurs between two molecules, and results in the formation of a single, larger molecule, while releasing a small molecule, usually water. In this case, the small molecule is water (H₂O), hence the name dehydration or condensation reaction.
During this reaction, the 8 H₂O molecules combine to form 4 H₂O molecules. This reaction is often used in the laboratory to create polymers from monomers. It can also be used to produce certain biomolecules such as carbohydrates, proteins, and nucleic acids, as well as other chemical compounds.
In order to carry out this reaction, energy is required. The reaction occurs in several steps and involves the removal of water molecules from the original 8 H₂O molecules, forming a new, larger molecule. The reaction is reversible, which means that it can be carried out in both directions, depending on the conditions and reactants involved. Thus, the conversion of 8 H₂O molecules to 2 H₂O molecules is a chemical change that can occur through a process known as dehydration or condensation reaction.
For more such questions on chemical change , visit:
https://brainly.com/question/1222323
#SPJ8
repost again help please and thanks
Answer:
Hypotonic
Explanation:
Age is an example of a ____________ measure. Age is an example
of a ____________ measure. nominal biological discrete
continuous
Age is an example of a nominal and discrete measure. It classifies individuals into distinct categories based on the number of years they have lived, but it does not have any inherent numerical meaning or allow for intermediate values.
Age is an example of a nominal measure. A nominal measure is a type of measurement scale that classifies data into distinct categories or groups. In the case of age, individuals are categorized into specific age groups, such as 0-18, 19-30, 31-45, and so on. These categories do not have any inherent numerical or quantitative meaning. Instead, they serve as labels to differentiate different age ranges.
Unlike a biological measure, which refers to physical characteristics of living organisms, age is not directly related to an individual's biology. It is a social construct that is used to determine the number of years a person has lived since birth. Age can be measured using a variety of units, such as years, months, or days.
Age is also a discrete measure because it takes on specific, separate values. For example, someone can be 15 years old, 25 years old, or 40 years old. There is no intermediate value between these discrete age categories.
On the other hand, age is not a continuous measure. A continuous measure is one that can take on any value within a certain range. For example, height or weight can have any value within a specific range. In the case of age, there are distinct categories and no intermediate values. You are either in one age group or another.
Learn more about discrete measure here:-
https://brainly.com/question/32265630
#SPJ11
Which feature is created by wave erosion?
O loess
O delta
O rill
O stack
Answer:
stack
Explanation:
A stack is a rock in the sea near a coast that is formed by wave erosion.
A feature created by wave erosion is stack. Option D. This is further explained below.
What is wave erosion?Generally, Wave erosion is simply defined as waves creating a variety of landforms along a shoreline. Sea cliffs occur when waves erode rock, resulting in high slopes.
In conclusion, a stack is a feature of wave erosion.
Read more about Wave
https://brainly.com/question/23271222
#SPJ2
The diagram represents a dihybrid cross between two pea plants that are heterozygous for both seed color and seed shape.
What is the phenotypic ratio of the offspring?
- 1:1:1:1:2:2:2:2:4
-1:3:3:9
-1:4
-4:12
Answer:4:12
Explanation:
This question already provides you with the punnet square, genotypes resulting from the cross, and phenotypes resulting from the cross. Simply count the number of green phenotypes (the green circles), and compare them to the number of yellow phenotypes (yellow circles), and you get 4 green for every 12 yellow.
Help (will give crown for answer)
Answer:genes
Explanation:
Using the diagram, which of the structures is the oldest?
H
F
M
B
Answer:
Im saying that its B or H
Explanation:
Which of the following describes one way earthworms benefit plants?
Earthworms are a food source for plants in warm climates.
Earthworms make the soil loose and fine so plants can grow.
Earthworms prevent plants from absorbing too much water.
Earthworms feed on parasites that are found on plant roots.
The option that describes one way earthworms benefit plants is: "Earthworms make the soil loose and fine so plants can grow."
What are the Earthworms?
Earthworms are known as ecosystem engineers, and one of their essential roles is to improve soil structure and nutrient availability. As earthworms move through the soil, they create tunnels and burrows, which aerate the soil and allow water to infiltrate more easily. This helps to improve soil structure and texture, making it easier for plant roots to grow and access nutrients.
Additionally, as earthworms consume organic matter, they break it down and release nutrients, such as nitrogen and phosphorus, which can be taken up by plants.
To know more about Earthworms, visit:
https://brainly.com/question/28690031
#SPJ1
Complete question is: "Earthworms make the soil loose and fine so plants can grow." is describes one way earthworms benefit plants.
What is one reason funding has such an important effect on scientific research?
Funding targets specific areas of research.
People are not interested in new discoveries.
It encourages scientists to promote findings.
Research results cannot be published without it.
Answer:
Funding targets specific areas of research
Explanation:
Hope this helps
Body temperature control is an example of ____, a process by which the body responds to a stimulus by correcting the change and bringing the body back to the original setting.
Body temperature control is an example of negative feedback, a process by which the body responds to a stimulus by correcting the change and bringing the body back to the original setting.
What is stimulus ?
A stimulus is a noticeable change in the internal or external environment of an organism's physical or chemical composition. Sensitivity is the capability of an organism or organ to perceive external stimuli and to respond appropriately to them.
The hypothalamus controls your body temperature in a manner similar to how a thermostat controls the temperature in your home. It does this by responding to both internal and external stimuli and making adjustments to keep your body's temperature within one or two degrees of 98.6 degrees.
Learn more about stimulus here:-
https://brainly.com/question/1747649
#SPJ4
8. Which arrow or arrows represent a release of carbon dioxide? What process is occurring at the arrow(s) you selected?
10. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? Explain your answer.
The arrow that represents the release of carbon dioxide is arrow D. The process that is occurring at arrow D is cellular respiration. During cellular respiration, glucose is broken down into carbon dioxide, water, and energy in the form of ATP. The release of carbon dioxide occurs during the second stage of cellular respiration, called the Krebs cycle.
Arrows A, B, and C represent reactions that demonstrate a conservation of mass and energy. Arrow A represents photosynthesis, where carbon dioxide and water are converted into glucose and oxygen. The mass of the reactants (carbon dioxide and water) is equal to the mass of the products (glucose and oxygen), demonstrating conservation of mass. The energy from the sun is converted into chemical energy in the form of glucose, demonstrating conservation of energy.
Arrows B and C represent the processes of glycolysis and the electron transport chain, respectively, which are part of cellular respiration. During glycolysis, glucose is broken down into two molecules of pyruvate, and during the electron transport chain, the energy stored in NADH and FADH2 is used to produce ATP. These reactions also demonstrate conservation of mass and energy, as the mass of the reactants is equal to the mass of the products, and the energy stored in glucose is converted into ATP.
To know more about carbon dioxide visit:-
https://brainly.com/question/3049557
#SPJ11
How does properties of light (transmitted, absorbed and reflected) affect your vision?
Answer:
When visible light strikes an object and a specific frequency becomes absorbed, that frequency of light will never make it to our eyes. Any visible light that strikes the object and becomes reflected or transmitted to our eyes will contribute to the color appearance of that object.
best answer gets brainiest
Answer:
the pic is blurry
Explanation:
I'm sorry i can't see it it's blurry :(
10) Which of the following describes a metabolic consequence of a shortage of
oxygen in muscle cells?
о
(A) An increase in blood pH due to the accumulation of lactic acid
O
(B) NO ATP production due to the absence of substrate-level phosphorylation
о
(C) A buildup of lactic acid in the muscle tissue due to fermentation
O (D) A decrease in the oxidation of fatty acids due to a shortage of ATP
Answer:
The correct answer is - C) a buildup of lactic acid in the muscle tissue due to fermentation.
Explanation:
In absence of enough oxygen for the muscle cells to perform the aerobic pathway to breakdown pyruvate for energy, the body starts producing lactic acid to convert glucose into energy.
This process is known as fermentation which can produce lactic acid and build it in muscle cells. There are some negative effects of fermentation and buildup of lactic acid in muscle cells such as cramps, pain, and fatigue in the muscles.
The statement 'a buildup of lactic acid in the muscle tissue due to fermentation' describes a metabolic consequence of a shortage of oxygen in muscle cells (Option C).
Aerobic cells normally produce energy by cellular respiration.Cellular respiration is a process by which aerobic cells produce energy in the form of ATP by using the energy stored in the bonds of foods (e.g., glucose) and oxygen.Acid lactic fermentation is a process by which muscle cells can produce ATP in anaerobic conditions.This process (acid lactic fermentation) is less efficient than cellular respiration in terms of production of ATP per molecule of glucose, but it is faster.In conclusion, the statement 'a buildup of lactic acid in the muscle tissue due to fermentation' describes a metabolic consequence of a shortage of oxygen in muscle cells (Option C).
Learn more in:
https://brainly.com/question/2095032
what vessels hold the largest percentage of the blood supply
The vessels that hold the largest percentage of the blood supply are the systemic veins and venules.
These vessels are responsible for carrying deoxygenated blood from the body's tissues and organs back to the heart. They make up approximately 60-70% of the body's total blood volume. The systemic veins and venules have thin walls and large lumens, which allows them to accommodate a large volume of blood and maintain low pressure. They also contain one-way valves that prevent blood from flowing backward and help to maintain the flow of blood toward the heart.
Overall, the systemic veins and venules play a critical role in the circulatory system by returning blood to the heart and ensuring that oxygen and nutrients are delivered to the body's tissues and organs.
Learn more about vessels here:
https://brainly.com/question/4601677
#SPJ11
Historical evidence suggests that growth rates have increased over the very long run. For example, growth was slow and intermittent prior to the Industrial Revolution. Sustained growth became possible after the Industrial Revolution, with average growth rates of per capita income in the nineteenth century of approximately 1 percent per year. Finally, in the twentieth century, more rapid growth has emerged. Discuss this evidence and how it can be understood in endogenous growth models (in which standard policies can affect long-run growth).
Industrial Revolution enabled sustained growth; 19th century saw 1% per year growth, 20th century marked by rapid progress. Policies impact growth in endogenous models.
The historical evidence of increasing growth rates can be attributed to the transformative effects of the Industrial Revolution. Prior to this period, economic growth was sluggish and irregular. However, the Industrial Revolution brought about technological advancements and innovations, which led to sustained growth. In the nineteenth century, average growth rates of per capita income reached approximately 1 percent per year, indicating a significant improvement.
The twentieth century witnessed even more rapid growth due to further technological progress and increased productivity. These historical patterns align with endogenous growth models, which emphasize the role of internal factors in driving long-run growth. In these models, standard policies can have a profound impact on growth by promoting innovation, research and development, education, and infrastructure development. By fostering an environment conducive to technological progress, economies can achieve sustained and accelerated growth rates.
To learn more about Revolution follow the link:
https://brainly.com/question/32280733
#SPJ4
QUICK, IF ANYONE CAN ANSWER CORRECTLY AND TRUTHFULLY I WILL GIVE 100 POINTS!
Q. My dad's fields aren't producing as many crops as they used to. Mark all the ones below that he could do to help the soybeans and alfalfa (to make hay) grow better.
A.Add more Nitrogen in the air around the plants.
B.Add more Nitrogen as a part of fertilizer.
C.Add nitrogen-fixing bacteria.
D.Add more rocks to the land.
Answer:
B, and C.
Explanation:
The bacteria cell cycle does not have an analogous phase to the eukaryotic phase G2. The reason for this is that _____.
Answer:
At the same time, chromosome replication and partitioning take place.
Explanation:
The bacterium cell cycle does not have an equivalent phase to the eukaryotic cell's phase G2 since it completes two phases in one.
1. Which of the following best describes why splicing is important for the detection of a nonsense mutation?
A. A mRNA that is not spliced cannot be exported from the nucleus.
B. An mRNA that is not spliced will not have exon junction complex proteins associated with it.
C. An mRNA that is not spliced cannot be bound by the ribosome.
The best description for why splicing is important for the detection of a nonsense mutation is option B: An mRNA that is not spliced will not have exon junction complex proteins associated with it.
Splicing is a crucial process in which introns are removed from pre-mRNA, and exons are joined together to form mature mRNA. It plays a significant role in generating functional mRNA molecules that can be translated into proteins. In the context of detecting a nonsense mutation, the presence or absence of splicing can have important implications.
Option A suggests that a mRNA that is not spliced cannot be exported from the nucleus. While splicing is necessary for mRNA export, it is not directly related to the detection of a nonsense mutation.
Option C suggests that an mRNA that is not spliced cannot be bound by the ribosome. Although splicing is important for proper translation, it is not directly relevant to the detection of a nonsense mutation.
Option B correctly describes the importance of splicing for detecting a nonsense mutation. Exon junction complex (EJC) proteins are deposited upstream of exon-exon junctions during splicing. They play a crucial role in mRNA surveillance mechanisms, including nonsense-mediated decay (NMD). NMD is a cellular process that degrades mRNA molecules containing premature stop codons to prevent the synthesis of truncated and potentially harmful proteins.
Learn more about splicing here:
https://brainly.com/question/32695744
#SPJ11
What is the name of the chemical reaction which occurs in the body to release stored energy from food?
\(\huge \bf༆ Answer ༄\)
Respiration is the process (chemical reaction) which takes place in the body to release stored energy from food ~
Crop rotation is a method of soil conservation because _______. a. the land produces more than one type of crop b. it requires plowing and tilling that reduces soil compaction c. it does not use the same parcel of land in sequential seasons d. it avoids the depletion of soil nutrients
Answer:
d. It avoids the depletion of soil nutrients.
Explanation:
Crop rotation is the process of planting different crops in the same area of land in rotation. This allows the breathing of the soil as well as the retention of nutrients in the soil.
Crop rotation is one form of conserving soil as it helps in saving the nutrients of the soil from getting depleted. As different crops require different nutrients, the change in crop plantation between different types of crops help in maintaining the fertility of the land. This way, when crops are planted in rotation, there is also the rotation of the different nutrients required for the different crops planted, thus allowing the cycle of nutrient change to take place.
Thus, the correct answer is option d.
1. Using the line of nucleic bases provided complete the complimentary DNA base pair strand?
TATCGAGCCGTATGACGATGAACGAATTCCTAA
2. How many base pairings did you make?
3. Using the line of DNA nucleic bases provided complete the copy as messenger RNA (mRNA) to leave the nucleus and go to a ___________ site for the ordering of specific amino acids and production of _______________.
To complete the complementary DNA base pair strand, we need to match each nucleic base with its complementary base. The complementary bases are:
A -> T
T -> A
C -> G
G -> C
Using this information, we can complete the complementary DNA base pair strand:
ATAGCTCGGCATACTGCTACTTGCTTAAGGATT
We made a total of 34 base pairings.
To convert the DNA sequence into mRNA, we need to replace each DNA base with its corresponding mRNA base. The conversion rules are as follows:
A -> U
T -> A
C -> G
G -> C
Using these rules, the mRNA sequence would be:
UAUCGAGCCGUAUGACGAUGAACGAAUUCUAA
The mRNA leaves the nucleus and goes to a ribosome site for the ordering of specific amino acids and the production of proteins.
The major issue John faced in the opening vignette of the drug abuse chapter was ______ addiction. a. alcohol b. nicotine c. heroin d. cocaine e. food. Answer:
The major issue that John faced in the opening vignette of the drug abuse chapter was heroin addiction. The vignette detailed John's struggle with the drug, including his initial experimentation with it and eventual dependence on it.
The chapter goes on to explore the devastating effects of drug abuse on individuals, families, and communities, and offers strategies for prevention and treatment. Heroin addiction is a particularly dangerous form of drug abuse due to its highly addictive nature and the risk of overdose. It is important for individuals struggling with addiction, as well as their loved ones, to seek help and support to overcome this devastating disease. Through education, prevention efforts, and effective treatment, we can work to combat the devastating impact of drug abuse on individuals and communities.
learn more about drug abuse Refer: https://brainly.com/question/18379880
#SPJ11
Are inner mass cells derived from the blastocyst?
The blastocyst is a hollow sphere that is composed of two distinct populations of cells: the outer trophoblast cells, which will give rise to the placenta, and the inner cell mass (ICM) cells, which will give rise to the embryo proper.
The ICM is a cluster of cells located at one end of the blastocyst, and it is the source of all embryonic stem cells. These cells are pluripotent, meaning they have the ability to differentiate into any cell type in the body. The ICM is the precursor to the three primary germ layers (ectoderm, mesoderm, and endoderm), which give rise to all of the organs and tissues in the body.
The process of ICM formation is a complex one and involves several key molecular and cellular events. After fertilization, the zygote undergoes a series of cell divisions to form a compact ball of cells called the morula. This structure then undergoes a process called compaction, in which the cells on the inside of the ball become more tightly packed than those on the outside. This creates an inner and outer population of cells, and the inner cells go on to form the ICM.
Learn more about fertilization at :https://brainly.com/question/29599409
#SPJ4
1. True or False - An organism may have the same common names that remain the same from area to area and language to language.
2. True or False - Scientists try to organize living things into groups that have biologic significance.
3. True or False - In binomial nomenclature, each species is assigned a single scientific name.
4. True or False - In the name Ursus maritimus, the first term of the name refers to the genus.
5. True or False - Linnaeus's system of classification uses 5 taxonomic categories.
6. True or False - Scientists often look for similar genes in similar organisms.
7. True or False - Evidence shows that the same gene that codes for a particular protein in human muscle also codes for that protein in yeasts, indicating they are the same species.
8. True or False - The kingdom Eubacteria contains the same organisms as the domain Bacteria.
9. Biologists use a classification system to group organisms in part because organisms:
10. Scientists assign each kind of organism a universally accepted name in the system known as:
11. For many species, there are often regional differences in their:
12. In taxonomy, a group at any level of organization is referred to as a:
13. In the scientific version of a species name, which of the names is capitalized?
14. The second part of a scientific name is unique to each:
15. Animals that are warm-blooded, have body hair, and produce milk for their young are grouped in the class:
16. All organisms in the kingdoms Protista, Plantae, Fungi, and Animalia are:
17. Which of the kingdoms in the six-kingdom system of classification was once grouped with plants?
18. Sometimes, organisms that are not closely related look similar because of:
19. The animals Panthera leo (lion) and _____ tigris (tiger) belong to the same genus.
20. Fill in the blank: The domain _____ is composed of the kingdom Eubacteria.
21. Fill in the blank: The use of a two-part scientific name for organisms is called _____ nomenclature.
22. Fill in the blank: In Linnaeus's system of classification, the two smallest categories are genus and _____.
23. Fill in the blank: The domain _____ contains plants, fungi, protists, and animals
24. Fill in the blank: In taxonomy, the class Mammalia is grouped with the classes Aves, Reptilia, Amphibia, and several classes of fishes into the phylum _____.
25. Fill in the blank: The most general and largest category in Linnaeus's system is the:
What is the scientific name for humans?
Answer:
1. False
2.True
3.False
4.True
5.False
6.False
7.False
8.True
9.are very numerous and diverse
10.binomial nomenclature
11.common names
12.taxon
13.The first name only
14.species in its genus
15.Mammalia
16.eukaryotes
17.Fungi
18.convergent evolution
19.Panthera
20.Bacteria
21.Binomial
22.Species
23.Eukarya
24.Chordata
25.kingdom
26.Homo sapien
Explanation:
1. It is true that an organism may have the same common names that remain the same from area to area and language to language.
2. It is true that scientists try to organize living things into groups that have biologic significance.
3. It is true that In binomial nomenclature, each species is assigned a single scientific name.
4. It is true that in the name Ursus maritimus, the first term of the name refers to the genus.
5. It is false that (Linnaeus's system of classification uses 7 taxonomic categories: Kingdom, Phylum, Class, Order, Family, Genus, Species)
6. It is true that Scientists often look for similar genes in similar organisms.
7. It is True that Evidence shows that the same gene that codes for a particular protein in human muscle also codes for that protein in yeasts, indicating they are the same species.
8. It is True that The kingdom Eubacteria contains the same organisms as the domain Bacteria.
9. Biologists use a classification system to group organisms in part because organisms share common characteristics and evolutionary relationships.
10. Scientists assign each kind of organism a universally accepted name in the system known as binomial nomenclature.
11. For many species, there are often regional differences in their common names.
12. In taxonomy, a group at any level of organization is referred to as a Taxon.
13. In the scientific version of a species name, The genus name is capitalized .
14. he second part of a scientific name is unique to each species.
15. Animals that are warm-blooded, have body hair, and produce milk for their young are grouped in the class Mammalia.
16. All organisms in the kingdoms Protista, Plantae, Fungi, and Animalia are Eukaryotes.
17. Fungi kingdoms in the six-kingdom system of classification was once grouped with plants.
18. Sometimes, organisms that are not closely related look similar because of Convergent evolution.
19. The animals Panthera leo (lion) and Panthera tigris (tiger) belong to the same genus.
20. The domain Bacteria is composed of the kingdom Eubacteria.
21. The use of a two-part scientific name for organisms is called Binomial nomenclature.
22. In Linnaeus's system of classification, the two smallest categories are genus and Species.
23. The domain Eukarya contains plants, fungi, protists, and animals .
24. In taxonomy, the class Mammalia is grouped with the classes Aves, Reptilia, Amphibia, and several classes of fishes into the phylum Chordata.
25. The most general and largest category in Linnaeus's system is the Kingdom.
The scientific name for humans is Homo sapiens.
Try to know more about organism :
https://brainly.com/question/13278945
#SPJ2