What is the name and letter of the organelle that digests old and damaged cells
Describe three methods that can be used to determine the genotype of an individual. Explain why one of these methods would not be used in humans. (6 marks)
Three methods that can be used to determine the genotype of an individual are:
PCR Amplification (would not be used in humans)Gel ElectrophoresisDNA SequencingThe methods that can be used to determine the genotype are explained:
PCR Amplification: Polymerase chain reaction (PCR) is a method used to amplify a small amount of DNA to produce multiple copies of a particular gene or DNA sequence. This can be used to determine the genotype of an individual by comparing the amplified DNA to a known genotype.Gel Electrophoresis: This method separates DNA fragments based on their size and charge. DNA fragments are placed in a gel and an electric current is applied, causing the fragments to move through the gel. The fragments can then be compared to a known genotype to determine the individual's genotype.DNA Sequencing: This method determines the order of nucleotides in a DNA molecule, allowing for the identification of specific genes and the determination of an individual's genotype.One of these methods that would not be used in humans is PCR amplification. While this method is useful for amplifying small amounts of DNA, it is not accurate enough to determine the genotype of an individual in a clinical setting.
See more about genotype at https://brainly.com/question/902712.
#SPJ11
You are interested in studying diseases that might be caused by mutations that affect the endoplasmic reticulum (ER) signal sequence in proteins. You are looking at labeled proteins in cells under a microscope, and comparing cells from people with and without disease conditions. Where do you expect to find proteins with mutated signal sequences?
Proteins with mutated signal sequences are expected to be found in the endoplasmic reticulum (ER) or other cellular compartments associated with protein synthesis and secretion.
The signal sequence is a specific amino acid sequence present at the N-terminus of a protein that directs its transport and insertion into the ER during protein synthesis. Mutations in the signal sequence can disrupt this process and lead to abnormal protein localization or secretion.
1. Endoplasmic Reticulum (ER) and Protein Synthesis: The ER is an organelle involved in various cellular processes, including protein synthesis and folding. Proteins destined for secretion, insertion into the plasma membrane, or localization to other compartments are synthesized by ribosomes associated with the ER membrane.
2. Signal Sequence: The signal sequence, typically located at the N-terminus of a protein, serves as a recognition site for the ER machinery. It interacts with signal recognition particles (SRPs) and SRP receptors, facilitating the targeting of the nascent protein-ribosome complex to the ER.
3. Mutations in the Signal Sequence: Mutations in the signal sequence can disrupt its function and impair the proper targeting of proteins to the ER. These mutations may alter the amino acid sequence, change the hydrophobicity or charge distribution of the signal sequence, or introduce premature stop codons.
4. Consequences of Mutated Signal Sequences: Proteins with mutated signal sequences may fail to be efficiently recognized by the SRPs and, consequently, may not be properly targeted to the ER. As a result, these proteins may accumulate in the cytoplasm or be mislocalized to other compartments.
5. Microscopic Analysis: Under a microscope, comparing cells from individuals with and without disease conditions, one would expect to observe differences in the localization or distribution of labeled proteins between the two groups. In individuals with mutations affecting the ER signal sequence, the labeled proteins may show abnormal localization patterns, such as cytoplasmic accumulation or mislocalization to non-ER compartments.
In summary, proteins with mutated signal sequences are expected to exhibit abnormal localization or mislocalization, primarily in the endoplasmic reticulum (ER) or other cellular compartments involved in protein synthesis and secretion. Microscopic analysis of labeled proteins can provide insights into the impact of these mutations on protein localization and cellular function.
To know more about Proteins refer here:
https://brainly.com/question/30986280#
#SPJ11
Whoever helps me give you five stars
Parents = White-eyed male x Homozygous normal red-eyed female
Parents = Colorblind man x Woman with normal vision whose father was colorblind
Parents = Normal-visioned mother x Normal-visioned father
How to determine Sex-Linked Traits and Pedigrees?1. White eyes in Drosophila is a recessive sex-linked trait.
parents = White-eyed male x Homozygous normal red-eyed femaleMale offspring: all will have white eyes (since they inherit their single X chromosome from their mother, which carries the white-eye allele)Female offspring: all will be heterozygous carriers of the white-eye allele, with normal red eyes (since they inherit one normal X chromosome from their mother and one X chromosome with the white-eye allele from their father, but the normal allele is dominant and masks the recessive white-eye allele).2. A colorblind man marries a woman with normal vision whose father was colorblind.
parents = Colorblind man x Woman with normal vision whose father was colorblindFemale children: all will be carriers of the colorblindness gene, but will not be colorblind themselves (since they inherit one normal X chromosome from each parent)Male children: all have a 50% chance of being colorblind (since they inherit their single X chromosome from their mother, and have a 50% chance of inheriting the colorblindness allele).3. Two normal-visioned parents have a colorblind son.
parents = Normal-visioned mother x Normal-visioned fatherson = colorblind (since he inherited the colorblindness allele on his X chromosome from his mother, and a normal vision allele on his Y chromosome from his father)chance of colorblind daughter: 0% (since the mother must be a carrier of the colorblindness gene to have a colorblind son, and the father cannot be a carrier since he does not have the trait. Therefore, their daughter would inherit one normal X chromosome from each parent).Learn more on Pedigrees here: https://brainly.com/question/14525981
#SPJ1
The questions are:
Sex-Linked Traits and Pedigrees
Certain genes are found solely on the X chromosome, and are referred to as sex-linked traits because men and women have different probabilities of inheriting them. female genotypes are XX, while males have XY.
1. White eyes in Drosophila is a recessive sex-linked trait. Show the offspring to be expected from a cross of a white-eyed male and at homozygous normal red-eyed female. Show the Punnett squares and the chances their offspring will have white eyes.
⚫ parents = ________ x ________
⚫ Male offspring ________
⚫ Female offspring ________
2. A colorblind man marries a woman with normal vision whose father was colorblind. Use a Punnett square to show and explain what type of vision their potential children would have.
⚫ parents = ________ x ________
⚫ female children ________
⚫ male children ________
3. Two normal-visioned parents have a colorblind son. What are the genotypes of the parents? What is the genotype of the son? What is the chance of this couple having a colorblind daughter? Show the Punnett square.
⚫ parents = ________ x ________
⚫ son = ________
⚫ chance of colorblind daughter = ________
A nerve is a bundle of axons, and some nerves are less sensitive to lidocaine. If a nerve, rather than an axon, had been used in the lidocaine experiment, the responses recorded at R1 and R2 would be the sum of all the action potentials (called a compound action potential). Would the response at R2 after lidocaine application necessarily be zero? Why or why not?
Answer:
the response at R2 after lidocaine application will not be zero
Explanation:
The response at R2 after lidocaine would not be zero because it is recording the of all action potentials and some axons may be unaffected.
The size and shape of a cell is directly related to its ____________ and function.
Answer:
its structure
Explanation: there you go
question 29 the lelior pathway of galactose metabolism is shown. galactosemia is a condition that results in the accumulation of galactose-1-phosphate. which enzyme is defective in galactosemia? a. galactose-1,6-bisphosphokinase b. hexokinase c. galactokinase d. galactose-1-uridylyltransferase
The enzyme which is defective in the galactosemia is galactose-1,6-bisphosphokinase. Thus, option A is correct.
What is galactosemia?Galactosemia is a condition that results in the accumulation of galactose-1-phosphate. Affected animals given a galactokinase inhibitor do not experience toxicity.
Inhibiting galactokinase will decrease the levels of the galactose 1‑phosphate. Catalyzes has been considered as the first and committed step of the Leloir pathway involving the conversion of galactose to glucose. It causes phosphorylation of α-D-galactose to galactose 1‑phosphate.
Therefore, The enzyme which is defective in the galactosemia is galactose-1,6-bisphosphokinase. Thus, option A is correct.
Learn more about enzyme on:
https://brainly.com/question/17292676
#SPJ1
The image below represents two waves X and Y, traveling to the same medium at the same speed how are the two waves different?
Answer: D is right
Explanation: It seems both waves have same wavelength.
Because speed = wavelength · frequency (v = λf) and
f = v/λ, so frequency is same. Because period T = 1/ frequency, also periods are same. Wave Y has higher amplidude and its energy is greater.
Answer:
D
Explanation:
just had it on study island
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
Name the 3 types of evidence scientists use to determine Earth's History. 1. Climate change, folklore, and textbooks 2. Radioactive decay, rock layers, and hieroglyphics 3. Radioactive decay, fossils, and rock layers
One of the best form of evidence about the history of life on earth are fossils. Fossils provide us clues about major geological evets and past climates. Index fossils are useful for concluding the ages if rock layers.
Absolute dating methods determine how much time has passed after rocks formed by measuring the radioactive decay of isotopes or the effects of radiation on the crystal structure of minerals.
Answer - Option 3
which of the following is NOT a way that carbon gets back into the air? 1. Burning of fossil fuels. 2. burning of plants and trees. 3. cells in living things give off carbon as they work. 4. crushing of rocks
Answer:
Crushing of rocks
Explanation:
It's right.
Question 8 of 10
A biologist measures the allele frequencies of pea plants in a very controlled
environment. The plants can either have a dominant tall allele (7) or a
recessive short allele (t). Which of the following would be a reason that this
population is not at Hardy-Weinberg equilibrium?
O A. There are no mutations in the alleles for height.
B. Tall plants are more likely to survive.
O c. All of the pea plants reproduce exactly once.
O D. The pea flowers are pollinated at random.
Answer:
C. Tall plants are more likely to survive (
Explanation:
A study was conducted in a particular preschool to investigate whether there is a link between breastfecding and a child's level of intellectual functioning, 20 breastfed and 40 not breastfed (non-breastfed) four year old children were involved. Each child is allocated a unique ID number between 1 and 60 (inclusive). Each child had to answer a few basic questions. To motivate them to answer all questions, the investigator offered Whittaker's Miraka Kirīmi (chocolate) bar. (a) For each of the following scenarios, identify the named distribution that can be used to model X, including its parameter(s). i. Each day a randomly chosen child is given a chocolate bar. All 60 children are in the draw every day. Let X be the number of days before the child with ID number 1 is chosen twice. Note that the day on which the child with ID number 1 is chosen for the second time is not counted. [2 marks] ii. Five children are randomly chosen to sit around one table and do their test. Let X be the number of non-breastfed children chosen. [2 marks] (b) Refer to your choice of named distribution in 2(a)ii above and answer the following questions. i. Find the expected value of X,E(X), and the variance of X,Var(X). [2 marks] ii. What is the probability that at least one child in the group of five children chosen to do the test is breastfed? [2 marks]
The variance of X, Var(X), for the hypergeometric distribution, the formula is: 1.67
How to calculate the valueThe hypergeometric distribution has three parameters:central idea
N: the total population size (60 children in this case)
K: the number of success states in the population (40 non-breastfed children in this case)
n: the number of draws (5 children chosen in this case)
To calculate the variance of X, Var(X), for the hypergeometric distribution, the formula is:
Var(X) = n * (K / N) * ((N - K) / N) * ((N - n) / (N - 1))
Using the same values as before, we have:
Var(X) = 5 * (40 / 60) * ((60 - 40) / 60) * ((60 - 5) / (60 - 1))
= 1.67
Learn more about variance on
https://brainly.com/question/9304306
#SPJ1
A
Water has a high specific heat, which means that it requires a great deal of heat to change its temperature.
Which of the following helps support life on Earth and is a result of water's high specific heat?
OA. The water that covers over 70% of the Earth's surface stabilizes the weather and climate of the Earth.
OB.
O C.
OD.
Water is part of a continuous cycle in which liquid water falls to the Earth's surface, is evaporated back into the atmosphere, and
condenses into clouds that produce precipitation.
Water droplets tend to clump together in drops instead of spreading out in a thin film, allowing it to move through the roots of
plants and through blood vessels in the human body.
In freezing temperatures, ice rises to the top of lakes and provides an insulating layer that keeps the rest of the water from
freezing.
Explanation:
OA. The water that covers over 70% of the Earth's surface stabilizes the weather and climate of the Earth.
Water's high specific heat helps to regulate the temperature of the Earth's oceans, which in turn affects the temperature and climate of the planet. This is because water can absorb a large amount of heat without a significant increase in temperature, and it can release that heat slowly over time. As a result, the Earth's oceans act as a "heat sink," absorbing excess heat from the atmosphere during warm periods and releasing heat during cold periods. This helps to stabilize the temperature of the planet and makes it more hospitable for life.
There is an increasing demand for berries in Paul’s town. He wants to cultivate berries to earn profits. To do so, he wants to check whether the soil in his farm is suitable for cultivating berries. Which characteristic of soil will most accurately check the suitability of land for growing berries?
Soil pH level characteristic of soil will most accurately check the suitability of land for growing berries
The soil pH level is the most important characteristic to check the suitability of land for growing berries. Berries generally thrive in slightly acidic soil with a pH level between 5.5 and 6.5. If the soil pH level is too high or too low, it can lead to nutrient deficiencies, poor plant growth, and low yields. Therefore, it is crucial to test the soil's pH level before planting berries to ensure the best growing conditions and maximum profits. Other characteristics such as soil texture, drainage, and nutrient content also play a significant role in berry cultivation but the soil pH level is the most critical factor to consider.
learn more about Soil pH level
https://brainly.com/question/10530250
#SPJ11
explain the difference between weathering and erosion? how is deposition also involved in this three step cycle?
Answer:
Erosion is the process by which natural forces move weathered rock and soil from one place to another. ... Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Erosion, weathering, and deposition are at work everywhere on Earth
Explanation:
because thanos said so
Activated complement brings about the death of a microbe when it _______________.
A. organizes into a membrane pore and causes lysis of the cell
B. mediates interactions between immune cells
C. activates a chemotaxic response in certain phagocytic cells
D. all of the above
Answer:
C
activates a chemotaxic response in certain phagocytic cells
How is the lumen related to the nuclear envelope?
The lumen is related to the nuclear envelope through vesicular transport.
The lumen is not directly related to the nuclear envelope. The lumen refers to the interior space or cavity within a tubular structure or organ, while the nuclear envelope is a double-membrane structure that surrounds the nucleus of a cell.
However, the lumen of certain organelles, such as the endoplasmic reticulum and the Golgi apparatus, are connected to the nuclear envelope through the process of vesicular transport.
During this process, transport vesicles bud off from the endoplasmic reticulum or the Golgi apparatus and fuse with the nuclear envelope to exchange materials between the lumen and the nucleus.
To learn more about lumen, click here:
https://brainly.com/question/28016967
#SPJ11
What's the answer please
Answer:
Simpe dominant- recsive
Explanation:
"Some people with hitchhiker’s thumb may have acquired two recessive copies, or alleles, of the gene that determines thumb straightness"
fill in the blank. there are 64 codons. 61 codons code for 20 amino acids, while 3 codons are nonsense codons. there could possibly be a maximum of___trnas per cell that could code for the different amino acids.
There could possibly be a maximum of 61 tRNAs per cell that could code for the different amino acids.
There are 64 codons total, 61 of which code for the 20 different amino acids, while the other 3 codons are known as "nonsense codons" and do not code for any amino acids. tRNAs are small molecules that match the codon sequence of mRNA and bring the corresponding amino acid to the ribosome for protein synthesis.
The genetic code consists of 64 codons, each made up of three nucleotides, which are the building blocks of DNA. 61 of the codons code for the 20 different amino acids that make up proteins, while the other 3 codons are known as "nonsense codons" and do not code for any amino acids.
During protein synthesis, the tRNA molecules that match the codon sequence of mRNA bring the corresponding amino acid to the ribosome, so a maximum of 61 tRNAs per cell would be necessary to match the 61 codons that code for the 20 different amino acids.
tRNAs are molecules made up of two parts: an anticodon that binds to the codon on the mRNA and an amino acid attached to the anticodon.
The tRNA molecules bind to the mRNA at the ribosome, and the ribosome then adds the amino acid attached to the tRNA to the growing polypeptide chain. This process is repeated until the polypeptide is complete. Therefore, if there are 61 codons that code for the 20 different amino acids, there could be a maximum of 61 tRNAs per cell.
For more similar questions on amino acids,
brainly.com/question/14351754
#SPJ11
Describe at least two factors that contributed to the hostility between Maurice Wilkins and Rosalind Franklin
She would be in charge of the X-ray studies of DNA. Wilkins thought that Franklin would be his assistant.
What was the conflict between Wilkins and Franklin?Wilkins felt DNA was his dominant and Franklin was being hired as his deputy, not an independent scientist with her own mind and procedure. Wilkins and Franklin never got along. Markel loudens a chorus of their colleagues on why. Watson blamed Franklin for declining to accept her role as Wilkins' assistant.
He mistook her for a new secretary, and it emerge that they never established a good working connection as fellow scientists. Franklin had gotten the impression she would be waged alone in the lab; Wilkins saw her in a more supportive role to his work.
So we can conclude that Rosalind Franklin acquires images of DNA using X-ray crystallography, an idea first raised by Maurice Wilkins.
Learn more about Wilkins here: https://brainly.com/question/983009
#SPJ1
BRAINELIST!
1- Identify 4 body systems interacting for the action shown. Explain the role of the 4 body systems you identified and how they connect. (the squirrel)
2- Identify 4 body systems interacting for the action shown. Explain the role of the 4 body systems you identified and how they connect. (soccer)
Answer:
Squirrel: Digestive, Circulatory, Muscular, and Nervous systems.
Soccer: Skeletal/muscular, circulatory, respiratory, and nervous systems.
Explanation:
The body systems are skeletal, muscular, digestive, respiratory, nervous, and circulatory. All of them interact and work together as a whole to the proper individual development and performance.
We might say that in both cases, all the systems are interacting. However, we can mention four of them for each situation.
The squirrel
This animal seems to be feeding on the top of a tree, sitting on a branch where it keeps its balance not to fall.
The digestive system is working to break food into smaller pieces that are more suitable to swallow and absorb the available nutrients.The circulatory system takes those nutrients and transports them together with the oxygen to different cells in the organisms where they are needed. The muscular system makes it possible to keep the animal´s balance in the branch and not fall. The nervous system controls everything in the organism. The nervous system controls all the body activities. It is in charge of keeping equilibrium while eating and being alert, among many other functions.The soccer player
This person is about to hit the ball to make a goal. He seems to be coordinating his arms and legs move to make it possible.
The muscular and skeletal systems are working together to provide support to the body and strength. They allow the movement of the whole body to make the goal. The respiratory system is also involved in this person´s performance while he is running. He needs to keep constant respiration to inhale enough oxygen needed while running and exhaling waste gases. The circulatory system transports the oxygen to different cells in the organisms where they are used according to their needs, especially the muscle cells. This system also takes away the wastes substances.The nervous system controls all the body activities. It is in charge of keeping equilibrium and coordinated moves while running, being alert on other players and focused on the ball, controlling the player´s thoughts and strategies during the game, among many other functions.Cellular respiration continues in the mitochondria of the cell with the _____________ cycle and the electron transport chain
Answer:
Cellular respiration continues in the mitochondria of the cell with the Krebs cycle and the electron transport chain.
Explanation:
The Krebs cycle is an important part of the cellular respiration process where —from energetic substrate such as carbohydrates, lipids and eventually proteins— Acetyl-CoA is obtained, whose oxidation produces energy in the form of ATP.
Both cellular respiration and Krebs cycle reactions occur in the mitochondria of the cells of aerobic organisms and, in conjunction with the electron transport chain, have a yield of 24 molecules of ATP for every molecule of glucose entering the system.
What is it called when two species use different parts of a resource instead of competing directly for that resource
The two species use different parts of a resource instead of competing directly for that resource for the process you are referring to is called resource partitioning.
Resource partitioning is an evolutionary adaptation that allows two or more species to coexist in a given habitat by utilizing different parts of a resource or by using the same resource in different ways. This reduces direct competition between the species, as each has its own specific niche within the ecosystem.
Resource partitioning can occur in various ways, such as temporal partitioning (when species use a resource at different times), spatial partitioning (when species use different areas of the habitat), and morphological partitioning (when species have physical adaptations that allow them to utilize resources differently). These strategies enable species to minimize competition for limited resources and promote biodiversity within an ecosystem.
One example of resource partitioning can be observed in bird species that feed on insects in trees. These birds may specialize in feeding on insects found on different parts of the tree, such as the trunk, branches, or leaves. This allows the birds to coexist without directly competing for the same food source.
In summary, resource partitioning is a crucial process that helps maintain biodiversity in ecosystems by reducing competition and allowing species to utilize resources in unique ways.
Know more about Biodiversity here :
brainly.com/question/11542363
#SPJ11
a(n) ________ is a rigid structure that moves on a fixed point.
A lever is a rigid structure that moves on a fixed point.
The fixed point where the lever moves is known as a fulcrum. In simple terms, a lever is a straight, rigid object that is used to amplify an input force to provide a greater output force, enabling the movement of heavy objects with less effort. The lever works based on the principle of mechanical advantage, which is the ratio of the output force to the input force. This ratio is determined by the distance of the input and output forces from the fulcrum.
There are three classes of levers, each defined by the relative positions of the fulcrum, input force, and output force. In a first-class lever, the fulcrum is between the input and output forces, such as in a seesaw or a crowbar. Second-class levers have the output force between the fulcrum and the input force, like in a wheelbarrow or a nutcracker. Finally, third-class levers position the input force between the fulcrum and the output force, as seen in a pair of tweezers or a human arm lifting an object.
Lever systems are used in various applications, from simple hand tools to complex machines. They provide an efficient means to perform tasks, making them a vital part of human technology throughout history.
Learn more about mechanical advantage here: https://brainly.com/question/26807228
#SPJ11
where are proteins synthesized in a cell? and what is their pathway through the cell as they are being constructed and travel through the cell to secretion?
Proteins are synthesized inside a cell's ribosomes. The pathway of proteins through the cell begins with the transcription of DNA into mRNA within the nucleus.
What is cell?Cell is the basic unit of life, which is the smallest unit capable of performing all functions of life. It is responsible for the growth, development and reproduction of an organism. Cells are also the building blocks of tissues and organs, and consist of various components, such as cytoplasm, nucleus, and cell membrane.
This mRNA is then transported to the ribosome, where it is translated into a polypeptide chain. This chain then undergoes a series of modifications as it moves through various organelles within the cell, such as the endoplasmic reticulum, Golgi apparatus, and lysosomes. The modified protein is then transported to its final destination, such as the cell membrane, or outside the cell through the process of secretion.
To know more about cell click-
https://brainly.com/question/13920046
#SPJ4
What is the correct order for respiration?
In an environment, too many organisms of one species is present, exceeding the carrying capacity. What is most likely? A The animal population will decrease
B The animal population will increase
CThe animal population will experience exponential growth DThe animal population will experience linear growth
Answer:
A: The animal population will decrease
Which is an advantage of electricity generated from solar panels compared to coal?
Answer:
it causes no pollution to the environment
If Waco is 100 miles southwest of Austin and it takes 2 hours to get there, what velocity are you traveling at?
Answer:
Explanation:
average speed of 50.0 Miles per hour (mph)