Peptide hormones are synthesized as ___, packaged into ___, where they are ___, and released by ___, to act on ___ receptors
Answers
Peptide hormones are synthesized as preprohormones, packaged into secretory vesicles, where they are stored, and released by various stimuli, to act on specific receptors.
Peptide hormones are synthesized as preprohormones in the endoplasmic reticulum of cells. These preprohormones are then cleaved into prohormones, which are further processed into active peptide hormones in the Golgi apparatus. The active peptide hormones are then packaged into secretory vesicles or granules, where they are stored until their release.
The release of peptide hormones is triggered by various stimuli such as neural signals, hormonal signals, or changes in the extracellular environment. Upon release, the peptide hormones bind to their target receptors on the surface of target cells. These receptors are specific for each peptide hormone and are located on the plasma membrane of target cells.
Once the peptide hormones bind to their receptors, they trigger a cascade of intracellular events, leading to various physiological responses. Peptide hormones have diverse functions in the body, including regulation of growth, metabolism, reproduction, and stress response.
Learn more about Peptide hormones here: https://brainly.com/question/17581576
#SPJ11
Related Questions
liver adn skeletal muscles have different isozymes of glycogen phosphorylase. why is the vmax of muscle phosphorylase greater than the vmax of liver phsophorylase
Answers
Vmax of muscle phosphorylase greater as muscles demand a lot of ATP when they are active or contracting, they are far more responsive to glycogen phosphorylase than the liver, which maintains glycogen.
The most common purpose of glycogen by organisms is to store energy, according to the biochemical definition of the compound. It has a yellowish hue. It is preserved inside the muscle and liver tissue in a liquid condition (hydrated).
Isozymes or isoenzymes are terms used to describe enzymes that essentially perform the same process but with varied kinetics or Km values. These are catalysts that conduct the same chemical reaction while having distinct amino acid compositions. Such enzymes often exhibit distinct kinetic characteristics.
As muscles demand a lot of ATP when they are active or contracting, they are far more responsive to glycogen phosphorylase than the liver, which maintains glycogen. The glycogen phosphorylase enzyme has a greater Vmax (maximal velocity) in the muscles than it does in the liver. This can be explained by the fact that the enzymatic processes in muscle contain a greater proportion of substrates and will thus reach their maximal velocity more quickly than those in the liver.
Learn more about Vmax:
https://brainly.com/question/17272676
#SPJ4
Please help! Thanks!
Answers
Answer:
the basic unit of DNA is nucleotide. It is found in the Nucleus:)
Explanation:
Hope this helps:)
green plants absorb sunlight to power photosynthesis, the chemical synthesis of food from water and carbon dioxide. the compound responsible for light absorption and the color of plants, chlorophyll, strongly absorbs light with a wavelength of 642.nm. calculate the frequency of this light.
Answers
\($$f=4.67 \times 10^{14} \mathrm{~Hz}$$\)
The frequency and wavelength of electromagnetic waves propagating in free space might be related to each other by using the following equation:
c=λf
Solving for the frequency:
f=c/λ
Knowing that λ stands for the wavelength (642 nm for the mentioned incident light), c the light velocity (300.000 m/s) and f the frequency, we get the asked frequency as:
\($$\left.f=\frac{3 x 10^6 \mathrm{~m} / \mathrm{s}}{642 \times 10^{-9} \mathrm{~m}}=4.67 \times 10^{14} \mathrm{~Hz}\right\}$$\)
Photosynthesis is a process that plants and other organisms utilize to transform light energy into chemical energy that may then be released to power the organism's activities via cellular respiration.
Some of this chemical energy is stored in carbohydrate molecules like sugars and starches that are produced from carbon dioxide and water - hence the name photosynthesis, derived from the Greek phs (), "light," and synthesis (v), "putting together."
Learn more about Photosynthesis
https://brainly.com/question/2976466
#SPJ4
Full Question: Green plants absorb sunlight to power photosynthesis, the chemical synthesis of food from water and carbon dioxide. The compound responsible for light absorption and the color of plants, chlorophyll, strongly absorbs light with a wavelength of . Calculate the frequency of this light. Be sure your answer has the correct number of significant digits.
what cells do not circulate in the blood but, rather, settle in tissues such as the respiratory system, causing allergic reactions and inflammation?
Answers
The cells that settle in tissues such as the respiratory system and cause allergic reactions and inflammation are called mast cells.
Mast cells are a type of white blood cell that is not typically found circulating in the blood but is instead located in tissues throughout the body, particularly in areas such as the skin, respiratory tract, and digestive system.
Mast cells are involved in the body's immune response and play a crucial role in allergic reactions, as they release histamine and other chemicals in response to allergens, leading to inflammation and other symptoms.
To know more about mast cells, refer here:
https://brainly.com/question/29468732#
#SPJ11
Select the correct answer from each drop-down menu. If a heterozygous male with the genotype Ww is mated with a homozygous recessiv of the offspring will be heterozygous. W WW WW W W 33 W If the heterozygous, Ww, is crossed with a homozygous dominant, WW, then the pro is W . W W WW WW WW WW W WW WW Reset Next 20 Select the correct answer from each drop - down menu . If a heterozygous male with the genotype Ww is mated with a homozygous recessiv of the offspring will be heterozygous . W WW WW W W 33 W If the heterozygous , Ww , is crossed with a homozygous dominant , WW , then the pro is W . W W WW WW WW WW W WW WW Reset Next
Answers
If a heterozygous male with the genotype Ww is mated with a homozygous recessive female with the genotype ww, then the probability of heterozygous offspring is 0.5 or 50%. The offspring are Ww, Ww, ww, and ww.
What is Genotype?A genotype may be defined as the ultimate combination of the alleles of those genes which are selected for specific studies.
If a heterozygous male with the genotype Ww is mated with a homozygous dominant female with the genotype WW, then the probability of heterozygous offspring is 0.5 or 50%. The offspring are WW, WW, Ww, and Ww.
Therefore, it is well described above.
To learn more about Genotypes, refer to the link:
https://brainly.com/question/22117
#SPJ1
Answer:
The guy above for the first part but was wrong for the second part.
Hope this helps!
Explanation:
3.
Choose the best answer.
_________, an evolution mechanism, works better in populations not divided by physical barriers.
Speciation
Gene pool
Genetic drift
Gene flow
Answers
Answer:
the answer is genetic drifts.
Label them plzzz!!!!!
Answers
Answer:
1. Mitochondria - you can tell based on the double membrane and the folding of the cristae shown in yellow
2. Centrosome- the centrosome is made up of two cylindrical centrioles.
3. Lysosome - lysosomes are round vesicles (think like bubbles) that digest waste products
4. Cytoplasm - the fluid-filled space inside the cell is the cytoplasm
5. Nucleosome - the "nucleus inside the nucleus" is called the nucleosome. It is where ribosomal RNA is made. It is not surrounded by a membrane
6. Nucleus - the large sphere-shaped organelle that holds the genetic material
7. DNA - the genetic material found inside the nucleus
8. Cilia - hair-like structures that help in locomotion
9. Rough endoplasmic reticulum - a series of folded membranes with ribosomes attached to the surface used in protein synthesis
10. Smooth endoplasmic reticulum - a series of folded membranes without ribosomes, giving a smooth appearance. Also used in protein synthesis, folding and modification.
11. Cytoskeleton - a series of filaments that helps the cell control its internal structure
12. Vesicles - vesicles containing proteins and other organic molecules budding off the endoplasmic reticulum
13. Ribosomes - small round structures that represent cellular protein synthesis machines. Can be free floating or attached to the ER
14. Golgi apparatus - A series of flattened pouches that sorts, packages and transports proteins from the ER
15. Cell membrane - defines the boundary of the cell and controls the entry and exit of different substances
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
Answers
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
HELP ASAP PLS.
Which of the following
describes the shape of
"Prokaryote Four" shown on
the left?
A. cocci
B. rod-like
C. bacilli
Answers
The shape of "Prokaryote Four" shown on the left looks like a cocci, which is a spherical or roughly spherical bacterium. Therefore, the answer is A. cocci.
What is a cocci Prokaryote?A cocci prokaryote is a type of prokaryotic cell that is spherical or roughly spherical in shape. "Cocci" is the plural form of "coccus," which refers to a single cell. Cocci prokaryotes can occur singly, in pairs, or in clusters, depending on the species.
Examples of cocci prokaryotes include bacteria in the genera Streptococcus, Staphylococcus, and Neisseria. Bacteria, for example, can be found in spherical forms called cocci (plural, coccus) or rodlike forms called bacilli (singular, bacillus).
Learn more on cocci here: https://brainly.com/question/18025862
#SPJ1
euglenozoa is a diverse clade that includes predatory heterotrophs, photosynthetic autotrophs, mixotrophs, and parasites, and has a main distinguishing feature of
Answers
The complex clade of organisms known as euglenozoa includes parasites, mixotrophs, predatory heterotrophs, and photosynthetic autotrophs. An internal spiral or crystalline rod that serves as the clade's identifying characteristic, thus A is the correct option,
Most significantly, the euglenids and the kinetoplastids are included in the category euglenozoa, which includes a wide range of eukaryotes in the kingdom Protista. Both the free-living and parasitic varieties are flagellated. While certain euglenoid genera include chloroplasts and are thus classified as algae, the bulk of Euglenozoa's genera are colorless and devoid of chloroplasts, which do not comply with normal algal traits. This has caused controversy regarding the taxonomy of Euglenozoa for a long time. Instead, scientists currently think that those euglenids that do have chloroplasts did so through an endosymbiotic relationship with green algae.
To learn more about the euglenozoa follow the link: https://brainly.com/question/28343268
#SPJ4
The complete question is:
Euglenozoa is a diverse clade that includes predatory heterotrophs, photosynthetic autotrophs, mixotrophs, and parasites. The main feature distinguishing them as a clade is
A spiral or crystalline rod inside their flagella, or
B this clade includes the kinetoplastids and euglenid
How would the genome of a sexual reproducing multicellular organism be different from the genome of an asexual reproducing unicellular organisms
Answers
The offspring of sexually reproducing organisms are all genetically unique. Because of this, sexually reproducing organisms may have more successful survival of offspring in environments that change than asexually reproducing organisms, whose offspring are all genetically identical.
Step By Step Explanation:
The genome of an erotic reproducing multicellular organism is different from the genome of an agamous reproducing unicellular organism in various aspects.
What do you mean by Genome?A genome may be defined as an organism's complete set of genetic instructions. It is a complete set of DNA in any organism.
The genome of unicellular organisms is genetically identical to one another, while a high diversity is seen in the case of the erotic reproducing multicellular organism due to the phenomenon of variations. The genome of a unicellular organism is very simple, while it is very complex in the erotic reproducing multicellular organism.
Therefore, the genome of an erotic reproducing multicellular organism is different from the genome of an agamous reproducing unicellular organism in various aspects.
To learn more about Unicellular and multicellular organisms, refer to the link:
https://brainly.com/question/714219
Which animal eat the men
Answers
carnivores are those animals who feed on other flesh for its survival
they include :
lions, tigers, leopards, polar bears, crocodiles
hope this helps u out and Mark the brainliest
Identify the flower parts labeled A-G
Answers
B) Sepal.
C) Anther.
D) Filament.
E) Stigma.
F) Ovary.
G) Ovule.
Based on stimulation studies, the "headquarters" of the reticular activating system appears to be based in the
A)medulla.
B)cerebrum.
C)diencephalon.
D)pons.
E)midbrain.
Answers
The reticular activating system (RAS) is a group of interconnected neurons located in the brainstem that plays an important role in controlling arousal and waking states.
Here correct answer is C
The diencephalon is the area of the brain where the RAS is most prominent, and it is thought to be the “headquarters” of the RAS. This area consists of the thalamus and hypothalamus, which works together to monitor and regulate activity throughout the brain.
In addition to controlling arousal, the RAS is often referred to as the “hierarchy of attention” because its fibers extend throughout the brain and play an important role in regulating the mobilization of attention and other cognitive functions. The different nuclei of the RAS send fibers throughout the forebrain and midbrain and use various neurotransmitters, such as glutamate and dopamine, to modulate the activity of neurons, which controls the intensity of responses to sensory stimuli.
Thus, the diencephalon is the “headquarters” of the reticular activating system and is responsible for the coordination of arousal and attention.
Know more about diencephalon here
https://brainly.com/question/8917225#
#SPJ11
During which Era in the geologic time scale was
there a great increase in the variety of life forms on
Earth?
Answers
which of the three domains is the largest in terms of numbers? group of answer choices prokaryotes archaeans eukaryotes
Answers
Bacteria, Archaea, and Eukarya three domains are the largest in terms of numbers. Prokaryotes are classified into two domains, with the organisms in domain Archaea more similar to eukaryotes than to the prokaryotes in the domain Bacteria.
Prokaryotic organisms contain cells without a nucleus or other organelles. The two primary prokaryotic classifications are bacteria and archaea, which are thought to have divergent evolutionary histories. Typically, prokaryotes are small, single-celled organisms with a simple structure. Prokaryotes include mycoplasma, bacteria, and blue-green algae. The most common and quickly replicating prokaryote is bacteria. Single-celled organisms classified as Bacteria and Archaea are prokaryotes. Prokaryotic cells are much smaller, lack a nucleus, and lack organelles than eukaryotic cells. Each bacterial cell has a cell wall protecting it. Many also contain a slime layer or capsule made of polysaccharides. The prokaryotic cell type that is most common is the bacterium.
Learn more about Bacteria here:
https://brainly.com/app/ask
#SPJ4
3. Some species play roles that may be difficult to see obviously. Brainstorm some
possible outcomes that may occur if important bacteria became extinct in an
ecosystem.
Answers
* Food chains would collapse. Many bacteria are essential for the decomposition of organic matter, which is a key part of the food chain. Without bacteria, dead plants and animals would pile up, and the nutrients they contain would be locked away. This would starve many animals, and could lead to the collapse of entire food chains.
* Diseases would spread. Many bacteria are responsible for causing diseases in plants and animals. Without these bacteria, diseases would be less common. However, some beneficial bacteria would also be lost, which could lead to other problems.
* The environment would be polluted. Bacteria are responsible for breaking down pollutants, such as sewage and industrial waste. Without bacteria, these pollutants would build up in the environment, which could have a negative impact on the health of both humans and animals.
* The climate would change. Bacteria play a role in the carbon cycle, which is the process by which carbon is exchanged between the atmosphere, the oceans, and the Earth. Without bacteria, the carbon cycle would be disrupted, which could lead to climate change.
It is important to note that these are just some of the possible outcomes that could occur if important bacteria became extinct. The exact consequences would depend on the specific bacteria that were lost, and the ecosystem in which they lived. However, it is clear that the loss of important bacteria would have a devastating impact on life on Earth.
The extinction of important bacteria can disrupt the natural balance of the ecosystem, affect food chains by impacting digestion in many animals, and result in reduced plant growth due to their role in nitrogen fixation.
Explanation:Important bacteria play a crucial role in any ecosystem. Should they become extinct, the results can be catastrophic. First, the absence of certain bacteria can disrupt the natural balance of the ecosystem as they help in decomposing organic matter and recycling nutrients. Second, many animals depend on bacteria for digestion. Their extinction would, therefore, negatively affect food chains. Lastly, bacteria help in nitrogen fixation, a crucial process for plant growth, and their extinction can thus lead to reduced plant growth and subsequently affect all life forms that depend on them.
Learn more about Influence of Bacteria on Ecosystem here:https://brainly.com/question/33625046
#SPJ2
An astronaut is planning a trip to a newly-discovered planet according to the law of universal gravitation, the astronaut weight in the new planet will be greater than his weight on earth if:
Answers
The new planet has more mass than Earth but the same radius. The mass of the astronaut will be calculated by the use of Newton's gravitational equation. The weight of the astronaut depends completely on its mass and the gravitational acceleration of the planet.
Gravitational acceleration is directly proportional to the mass of the planet and indirectly proportional to the radius of the planet. Hence, when the gravitational acceleration increases the planet's mass will increase therefore the radius will decrease. The astronaut's mass will depend on these factors.
Learn more about Gravitational acceleration, here
https://brainly.com/question/3009841
#SPJ1
Answer the guiding question in 5 - 7 sentences: What is “genetic engineering” and how does it change an organism?
please help
Answers
Genetic engineering is the process of manipulating an organism's genetic material (DNA) in order to modify its characteristics or traits. This can involve adding, removing, or changing specific genes or segments of DNA which will change the organism.
How can Genetic engineering described?Genetic engineering can be used in a variety of ways, such as to produce new traits that do not naturally occur in an organism, to enhance or suppress existing traits, or to introduce a desired trait from one organism into another.
The changes made through genetic engineering can be passed on to future generations, which can result in significant and sometimes unpredictable effects on the organism and its offspring. The modified organism may exhibit altered physical characteristics, such as improved disease resistance, faster growth, or increased yield, among others.
Some examples of genetic engineering in practice include the development of genetically modified crops that are resistant to pests or drought, the creation of transgenic animals that produce specific proteins for medical use, and the modification of bacteria to produce useful products such as insulin.
Learn more about organism at:
https://brainly.com/question/17259533
#SPJ1
Which one of the following groups always possess all five hallmark chordate characteristics as adults? Multiple Choice a) Urochordata. b) Pterobranchia. c) Cephalochordata. d) Vertebrata.
Answers
The group that always possesses all five hallmark chordate characteristics as adults is d. Vertebrata.
These five characteristics include a notochord, dorsal hollow nerve cord, pharyngeal slits, endostyle aand thyroid gland,. Vertebrates are characterized by having a vertebral column that replaces the notochord during development and adulthood. They also have a complex nervous system with a brain enclosed in a protective skull, as well as paired appendages, such as arms, legs, fins, or wings.
Some examples of vertebrates include fish, amphibians, reptiles, birds, and mammals. In contrast, Urochordata (tunicates or sea squirts) and Cephalochordata (amphioxus or lancelets) only possess these characteristics during their larval stages, while Pterobranchia (tiny, colonial marine animals) have a reduced notochord. So therefore d. Vertebrata is the group that always possesses all five hallmark chordate characteristics as adults.
To learn more about notochord here:
https://brainly.com/question/31607169
#SPJ11
Tyra and Sam realize that the difference between an individual with normal hemoglobin and sickle cell hemoglobin is one nucleotide in the DNA sequence. In order to better
understand the cause of this genetic disorder, they decided to create a model in order to see the effects.
In order to model the changes in protein synthesis, they needed to transcribe the RNA sequence and translate the amino acid sequence for both the normal and mutated sequences
shown in the image below. To do this, they would need to refer to the codon chart for the complementary amino acid sequence.
Create a model showing the complementary RNA and the amino acid sequence for both the normal and mutated sequence.
1. Transcribe the complementary RNA for BOTH the normal and mutated sequence. You can organize it by number or order. (see sample below)
2. Use the codon chart to identify the complementary amino acid sequence for both sequences.
Answers
Normal red blood cells containing hemoglobin have a smooth, disk-like shape, are malleable, and resemble doughnuts without holes.
What is the difference between sickle cell hemoglobin and normal hemoglobin?Hemoglobin-normal red blood cells have a smooth, disk-like form and are flexible, resembling doughnuts without holes. They have little trouble passing through the blood vessels. Sticky and stiff cells contain sickle cell hemoglobin. They take on the shape of a sickle or a crescent, just like the letter C, when their oxygen supply is cut off.
According to genetic studies, there is only one positional difference between the base sequence of normal hemoglobin (HbA) and sickle cell hemoglobin (HbS) (a change from an A to a T). A single amino acid is altered in the hemoglobin as a result of this alteration to one codon.
To learn more about hemoglobin refer to;
https://brainly.com/question/11211560
#SPJ1
what topics are better suited for phenomenological
Answers
The topics that are better suited for phenomenological research include:
Experiences of individualsSubjective experiencesLived experiencesPhenomenological research topics1. Experiences of individuals: Phenomenological research is best suited for exploring the experiences of individuals, such as their thoughts, feelings, perceptions, and behaviors. For example, a phenomenological study could explore the experiences of individuals with chronic illnesses, or the experiences of individuals who have experienced a traumatic event.
2. Subjective experiences: Phenomenological research is also well-suited for exploring subjective experiences, such as emotions, beliefs, and values. For example, a phenomenological study could explore the subjective experiences of individuals who have undergone a particular type of therapy, or the subjective experiences of individuals who have experienced a particular type of discrimination.
3. Lived experiences: Phenomenological research is also well-suited for exploring the lived experiences of individuals, such as their day-to-day experiences, routines, and habits. For example, a phenomenological study could explore the lived experiences of individuals who are homeless, or the lived experiences of individuals who are refugees.
Overall, phenomenological research is best suited for exploring the experiences of individuals, subjective experiences, and lived experiences. It is a qualitative research approach that focuses on the meanings and interpretations that individuals give to their experiences.
Learn more about phenomenological at
https://brainly.com/question/28131856
#SPJ11
A firefighter wakes in the middle of the night to the sound of an alarm. It is likely that her _____ glands have released epinephrine and norepinephrine.
Answers
The adrenal gland releases a torrent of hormones, such as epinephrine and norepinephrine as the fight or flight response when a person is stressed or scared.
What are adrenal glands?The adrenal glands are two small organs responsible for secreting hormones such as cortisol, adrenaline or noradrenaline into the bloodstream.
Characteristics of adrenal glandsThey are responsible for producing hormones that help regulate metabolism, the immune system, blood pressure, the response to stress and other essential functions.The main hormones secreted by the adrenal medulla include epinephrine (adrenaline) and norepinephrine (noradrenaline), which initiate the fight or flight response.Therefore, we can conclude that the adrenal glands release certain hormones in response to stress, some of which are vital for survival.
Learn more about adrenal glands here: https://brainly.com/question/8947015
People have built canals and levees to divert water away from its natural flow and prevent floods in residential areas near the Florida Everglades. How have these changes affected the Everglades? О
О Some areas of the Everglades have dried up.
O The population of egrets has increased.
O Farm fertilizer no longer drains into the Everglades.
O Areas of wetland have been filled in for houses.
Answers
Answer:
Some areas of the Everglades have dried up.
Explanation:
These changes have caused some areas of the Everglades to have dried up. The everglades were known as the wetlands due to the massive flooding that occurred often but these canals made it so that water would not flow into some of the areas in the Wetlands. Therefore, since water never reached these areas they quickly began drying up and making the ground infertile due to the lack of water which the plants need to survive.
A green rat snake that lives in the grass and a brown rat snake that lives in the desert is a form of _______________
a
genetic engineering
b
natural selection
c
selective breeding
d
simple variation
Answers
Answer:
Natural selection
Explanation:
Hope this helps :)
Help me fast please!!
Answers
Answer:
b
Explanation:
Breaking the Code
REPLICATION:
For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after
replication.
DNA molecule #1:
TACCGGATGCCAGATCAAATC
Complimentary DNA #1:
DNA molecule #2:
TACGGGGGCGTAACCACAACT
Complementary DNA #2:
DNA molecule #3:
TACCTGTTAAGCTACAAAATT
Complementary DNA #3:
Answers
Answer:
Complimentary DNA #1:
ATGGCCTACGGTCTAGTTTAG
Complementary DNA #2:
ATGCCCCCGCATTGGTGTTGA
Complementary DNA #3:
ATGGACAATTCGATGTTTTAA
DNA molecule 1: TACCGGATGCCAGATCAAATC, complimentary will be ATGGCCTACGGTCTAGTTTAG, for DNA molecule 2: TACGGGGGCGTAACCACAACT, complimentary will be ATGCCCCCGCATTGGTGTTGA.
What is complimentary DNA?Humans and nearly all other species carry their genetic information in DNA, also known as deoxyribonucleic acid. The DNA of an individual can be found in almost all of their cells.
The information molecule is DNA. It contains information needed to create proteins, which are other big molecules.
These instructions are dispersed throughout 46 lengthy structures called chromosomes that are found inside each of your cells. Numerous smaller pieces of DNA, known as genes, make up these chromosomes.
Complementary sequence is a sequence of bases in a nucleic acid that can be combined to generate a double-stranded structure.
For instance, G-T-A-C is the complementary sequence to C-A-T-G, where each letter represents for a different DNA nucleotide.
The DNA sequence can be:
DNA molecule 1: TACCGGATGCCAGATCAAATC, complimentary will be ATGGCCTACGGTCTAGTTTAG.DNA molecule 2: TACGGGGGCGTAACCACAACT, complimentary will be ATGCCCCCGCATTGGTGTTGA.DNA molecule 3: TACCTGTTAAGCTACAAAATT, complimentary will be ATGGACAATTCGATGTTTTAA.Thus, this is the complete match for the given scenario.
For more details regarding DNA, visit:
https://brainly.com/question/29767255
#SPJ2
What is the source of energy for organisms that use chemosythesis?
Answers
Answer:
During chemosynthesis, bacteria living on the sea floor or within animals use energy stored in the chemical bonds of hydrogen sulfide and methane to make glucose from water and carbon dioxide (dissolved in sea water). Pure sulfur and sulfur compounds are produced as by-products.
Explanation:
1. Question: What effect does the water temperature have on solution rate? Hypothesis: 2. Question: What effect does crushing the tablet have on solution rate? Hypothesis:
3. Question: What effect does adding soda to the water have on solution rate? Hypothesis:
Answers
a. It can be hypothesized that an increase in water temperature will lead to an increase in solution rate. Conversely, a decrease in temperature will lead to a slower solution rate.
b. It can be hypothesized that crushing the tablet will lead to an increase in the solution rate. Conversely, leaving the tablet intact will lead to a slower solution rate.
c. It can be hypothesized that adding soda to the water will lead to an increase in solution rate. However, the exact effect may depend on the specific type and concentration of soda used.
1. The water temperature can have a significant impact on the solution rate. This is because an increase in temperature causes the molecules of the solvent (in this case, water) to move faster and collide more frequently with the solute (the tablet). This increased collision frequency leads to a higher likelihood of successful collisions between the solvent and the solute, which in turn increases the rate at which the solute dissolves.
Therefore, it can be hypothesized that an increase in water temperature will lead to an increase in solution rate. Conversely, a decrease in temperature will lead to a slower solution rate.
2. Crushing the tablet can also impact the solution rate. This is because crushing increases the surface area of the tablet, exposing more of the solute to the solvent. This increased surface area means that more of the solute is available to come into contact with the solvent at any given time, which should increase the rate at which the solute dissolves.
Thus, it can be hypothesized that crushing the tablet will lead to an increase in the solution rate. Conversely, leaving the tablet intact will lead to a slower solution rate.
3. Adding soda to the water may also affect the solution rate. Soda is a carbonated beverage that contains carbon dioxide gas dissolved in water. When soda is added to water, the carbon dioxide gas is released, creating bubbles that rise to the surface.
These bubbles could potentially cause the solute to move around more vigorously, increasing the rate at which it dissolves. Additionally, the added acidity of the soda could also impact the solution rate.
Therefore, it can be hypothesized that adding soda to the water will lead to an increase in the solution rate. However, the exact effect may depend on the specific type and concentration of soda used.
Know more about hypothesized here:
https://brainly.com/question/29576929
#SPJ11
A complex human society that has demonstrated cultural and technological development is called a ?
ancient
civilization
culture
politics
Answers
Answer:
the answer is civilization.
Answer:
the second answer is the correct CIVILIZATION