Organisms are either eukaryotes or prokaryotes. Prokaryotes are further classified into the domains Archaea or Bacteria, while all eukaryotes are in the domain Eukarya. All three domains have some cell structures in common, whereas other structures are found in members of only one or two domains.

Answers

Answer 1

That statement is mostly correct. Organisms can be classified into two main categories: eukaryotes and prokaryotes. Prokaryotes are further divided into two domains: Archaea and Bacteria. The domain Eukarya consists of all eukaryotic organisms.

All three domains, Archaea, Bacteria, and Eukarya, share certain basic cell structures, such as a plasma membrane and genetic material in the form of DNA. However, there are also distinct structures found in specific domains or shared between only two domains.For example, prokaryotes (Archaea and Bacteria) generally lack a membrane-bound nucleus, while eukaryotes (in the domain Eukarya) have a well-defined nucleus. Eukaryotes also possess membrane-bound organelles, such as mitochondria and endoplasmic reticulum, which are absent in prokaryotes. Additionally, there are other cellular structures and molecular features that may be present in specific domains or vary between domains, such as the presence of peptidoglycan in bacterial cell walls or the presence of unique archaeal lipids in Archaea. So, while there are shared structures among all three domains, there are also distinct characteristics that differentiate them from one another.

Learn more about eukaryotes and prokaryotes here :

https://brainly.com/question/30335918

#SPJ11


Related Questions

Darwin was one of the first scientists to discuss the concept of evolution.
What does evolution tell us about plants and animals? Choose the three
statements that are accurate.

A. Modern species of plants and animals developed from earlier kinds
of life.

B. Plants and animals adapt to their environment in ways that improve
their survival.

C. Plants and animals stay the same and pass the same traits on to
their offspring.

D. Plants and animals that inherit traits that allow them to thrive in their
environment have an advantage over those that did not inherit these
traits.

Answers

According to Darwin, evolution is the process through which species change over time, give rise to new species, and descend from a single ancestor.

What is Evolution ?

Evolution is the gradual change in the inherited traits of biological populations over many generations. These traits are the manifestations of genes, which are handed down through reproduction from parent to offspring.

In 1836, Darwin visited England once more. He spent several years examining and analysing specimens as a highly meticulous researcher before concluding that evolution happens through a process of natural selection.

The three statements that are accurate about what Charles Darwin described as Evolution are :

Modern species of plants and animals developed from earlier kinds of life.Plants and animals adapt to their environment in ways that improve their survival.Plants and animals that inherit traits that allow them to thrive in their environment have an advantage over those that did not inherit these traits.

To learn more about Evolution refer to :

https://brainly.com/question/26945742

#SPJ1

Discussion: Diversity of Life, Part - 2

Graded Discussion

Discussion Topic

Imagine that certain laws of physics could be ignored and you were able to travel vast

distances in moments. Now imagine that you traveled to an Earth-like planet located

light-years away that is known to support life. Think about what you've learned in this

unit and make an argument for what you think would be the dominant type of life form

on this planet. Consider whether a notochord is required for an organism to manipulate

its environment and become a dominant creature.

5 F

Answers

Assuming that we're  suitable to travel vast distances in moments and that we've discovered an Earth- suchlike earth located light- times down that supports life.

it's  delicate to  prognosticate what the dominant type of life form on this earth would be without  further information about the earth's  terrain and the conditions that  live there. still, we can make some general  prognostications grounded on what we know about the  elaboration of life on Earth.   On Earth, the most dominant type of life form is  presently the multicellular organism.

Multicellular organisms evolved from single- celled organisms through a process called symbiogenesis, in which multiple cells came together to form a collaborative unit. The  foremost multicellular organisms on Earth didn't have notochords, which are structures  set up in the phylum Chordata( which includes invertebrates) that  give support and allow for movement. rather, these early multicellular organisms had simpler structures,  similar as cell walls, that  handed support and allowed for limited movement.

Learn more about earth and universe at

https://brainly.com/question/20396070

#SPJ4

define cartilage and nucleoplasm​

Answers

Answer:

cartilage: firm, whitish, flexible connective tissue found in various forms in the larynx and respiratory tract, in structures such as the external ear, and in the articulating surfaces of joints. It is more widespread in the infant skeleton, being replaced by bone during growth.

nucleoplasm​:the substance of a cell nucleus, especially that not forming part of a nucleolus.

Explanation:

Cartilage is also defined as aneural and hypocellular tissue [3], where normal mechanisms of tissue repair are not easily restored.

Nucleoplasm is the substance of a cell nucleus, especially that not forming part of a nucleolus

For each food listed below choose whether it has it all single carbon to carbon bonds or at least one double carbon to carbon bond

Answers

Answer:

                                                                                                                              Peanut butter            

All single carbon-to-carbon bonds

                                                                                                                    Sunflower oil  

At least one double carbon-to-carbon bond

                                                                                                                                Cheddar cheese  

All single carbon-to-carbon bonds

Explanation: I did it on Edge 2020 and it was correct.

What happens if a skeletal muscle is deprived of adequate supplies of ATP? The muscle relaxes The muscle enters a state where actin and myosin are unable to separate Sarcomeres continue to shorten Antil maximum contraction is achieved All free calcium ions are returned to the sarcoplasmic reticulum

Answers

If a skeletal muscle is deprived of adequate supplies of ATP, the muscle enters a state where actin and myosin are unable to separate.

Without ATP, the myosin head cannot detach from the actin filament, which is necessary for muscle relaxation. As a result, the muscle remains contracted and cannot relax. This is known as a rigor state. In this state, sarcomeres continue to shorten until the maximum contraction is achieved. However, without ATP, the muscle cannot sustain this contraction for long, and eventually, all free calcium ions are returned to the sarcoplasmic reticulum. Ultimately, the muscle becomes fatigued and cannot contract anymore.

Know more about skeletal muscle here:

https://brainly.com/question/13989523

#SPJ11

Brown eyes (B) are dominant to blue eyes (b). Determine the genotype and phenotype for a homozygous dominant female and a homozygous recessive male

Answers

The genotypes are: Female: BB Male: bb and the phenotypes are Female: Brown eyes & Male: Brown eyes.

Given:

Brown eyes (B) are dominant to blue eyes (b). We need to determine the genotype and phenotype for a homozygous dominant female and a homozygous recessive male.

Solution:

Homozygous dominant female means the genotype of the female is BB (both alleles of the individual are dominant alleles of brown eyes)

Homozygous recessive male means the genotype of the male is bb (both alleles of the individual are recessive alleles of blue eyes)

Therefore, the genotypes are:Female: BB Male: bb

The dominant trait, brown eyes, will be expressed in both individuals because the female has both dominant alleles and the male has no recessive allele to mask the dominant one.

Therefore, the phenotypes are: Female: Brown eyesMale: Brown eyes.

If you need to learn more about genotypes click here:

https://brainly.com/question/30460326

#SPJ11

The sides of the dna molecule are made up of repeating nitrogen bases and sugars.

Answers

Answer:

BRAINLY

ME p     l    z

Explanation:

T or F - The sides of the DNA molecule are made up of repeating nitrogen bases and sugars. T or F - The letters that make up the DNA molecule code for genes. T or F - Replication results in two strands of DNA, each of which has half of the original strand.

Path Of A Nerve Impulse
I Need to Fill In the Blanks
The telephone rings. Nerve impulses begin when in the ear picks up the stimulus of the telephone ringing

The nerve impulse moves to __________ in the brain. The __________ interprets the impulses and decides to answer the phone.

Nerve impulses from the brain move to __________. The muscles contract in response, and you pick up the telephone.

Answers

The telephone rings. Nerve impulses begin when the nerves in the ear picks up the stimulus of the telephone ringing.

The nerve impulse moves to neurons in the brain. The brain interprets the impulses and decides to answer the phone.

Nerve impulses from the brain move to arm muscle. The muscles contract in response, and you pick up the telephone.

What are nerve impulses?

Nerve impulses are described as electrical signal that travels along a nerve fiber in response to a stimulus and serves to transmit a record of sensation from a receptor or an instruction to act to an effector.

Learn more about nerve impulses at: https://brainly.com/question/1182219

#SPJ1

Which three cultures are responsible for building astronomical pyramids?

Answers

Egyptians developed tools for carrying out astronomical measurements the sundial, clepsydras, and the merkhet.

Astronomy began in Egypt around the 5th millennium B.C. People that time used the stone circles that,  these are the proof that the Egyptians could guess and mark time and can also predict when the flooding can occurs. Origins of Western astronomy can be found in Mesopotamia culture also known as the land between the rivers Tigris and Euphrates.

Ancient Egyptians also keep track on astronomical observations through hieroglyphs, ascribing natural phenomena, and constellations to deities. In prehistoric time traces of stone circles throughout Europe are believed to have been used in  tracking celestial objects.

To learn more about Astronomy , here

brainly.com/question/5165144

#SPJ1

complete the sentence using the word below​

complete the sentence using the word below

Answers

Answer:

During a process called photosynthesis, plants take in carbon dioxide, sunlight ,and water.

Plants make sugar and give off oxygen as a by-product of this process.

Please mark me brainliest if this answer could help, have a great day.

Can someone please help me with this!!!!

Can someone please help me with this!!!!
Can someone please help me with this!!!!

Answers

The term experiment has to do with the relationship between the dependent and the independent variables in a study .

What is an experiment?

When we are are carrying out an experiment, the aim is always to know the effect of one variable on another. One is the dependent variable and the other is the independent  variable

Experiment A

Independent variable - Cure for knee problem

Dependent variable - Relief from the knee problem

Control group - Those who were given  the placebo

Experiment B

Experimental variable -The reaction of the deer

Independent variable - The use or not of the tiger urine

Dependent variable -Whether or not the deer was repelled from the tree seedlings

Control group - Tree seedlings without with tiger urine

Controlled variables - Type of seedlings, specie of deer and tiger

Learn more about experiment: brainly.com/question/17088282

#SPJ1

As we exercise, our body produces heat through the process of cellular respiration. Although our body temperature does increase, the temperature change is slow and we are able to maintain a homeostatic temperature. Which property of water explains why our body temperature is slow to change

Answers

Answer: Ability to moderate temperature

Explanation: the water is able to moderate temperature to maintain homeostasis. It tries to cool down when it is extremely hot and heat up while we are cold. If water didn’t have this property then we would not be able to live in places like New York or Massachusetts due to the extreme temperatures

Have a wonderful day

I need the answer to all front and back please and number them

Answers

Natural selection could lead to a change in allele frequency if the lighter green frogs are being predated on more often, reducing their chances of surviving and reproducing.

What is the selection about?

   Over time, this could result in a higher frequency of darker green alleles in the population, as those frogs would have a higher chance of surviving and passing on their alleles to the next generation.

2. Natural selection produces a change in populations rather than individuals. It operates on the heritable traits of individuals, but its effect is seen in the frequency of those traits in the population over time.

3.  Fitness refers to an organism's ability to survive and reproduce in a given environment. Natural selection favors traits that increase an organism's fitness, as these traits increase the chances that the organism will pass on its genes to the next generation.

4.    No, organisms with higher fitness do not necessarily survive to an advanced age. Fitness refers to an organism's ability to survive and reproduce, not necessarily to its lifespan. Some organisms may have high fitness and reproduce at a young age, while others may have lower fitness but live longer.

 
5.   Fitness and survival do not have the same meaning. Survival refers to an organism's ability to stay alive, while fitness refers to an organism's ability to survive and reproduce in a given environment.

 
6.   No, an organism with high biological fitness in one environment may not have high fitness in another environment. Fitness is dependent on the specific environmental conditions, and what traits confer fitness in one environment may not be advantageous in another environment.

 

7. Both Bernadette and Dominique have valid points. Antibiotic resistance can arise through the development of new traits in response to antibiotics, but there may also be pre-existing traits in the population that allow some bacteria to survive and reproduce in the presence of antibiotics. Both mechanisms can contribute to the evolution of antibiotic resistance.

8. Natural selection is a non-directional process and does not give organisms what they want or need. Rather, it operates on the variation that already exists in the population, favoring traits that increase fitness in a given environment.

Lastly, 9.If there are no organisms in a population with traits that allow them to survive the environmental change, the population may decline or go extinct. However, if there is genetic variation in the population, it is possible that new traits could arise through mutation or recombination that allow some individuals to survive and reproduce in the new environment.

Read more about Amoeba  here:

https://brainly.com/question/8227

#SPJ1

See text below

Amoeba Sisters Video Recap: Natural Selection

1. Populations can have variety, despite being made up of

the same species. If a population has different expressed

traits, this can be due to different inherited alleles. The

frogs below are the same species, but they have different

shades of green based on their inherited alleles. In a

particular environment, lighter green frogs are easier to see

by predators. Explain how natural selection could lead to a

change in allele frequency.

________________________________________________

________________________________________________

________________________________________________

________________________________________________

________________________________________________

________________________________________________

________________________________________________

2. Natural selection is an example of a mechanism of

evolution. Does this mechanism produce a change in

individuals or populations? Explain!

3. A major point of understanding natural selection is that not all organisms in a

population get to reproduce. Consider the term fitness as used in biology. How does

this term relate to naturalselection?

4. Based on your answer above, do organisms with higher fitness mean that they have survived to an advanced age? Why

or why not?

5. Does fitness(as used in biology) and survival have the same meaning? Why or why not?

6. If an organism has high biological fitness in one environment, does that mean that it would also have high biological

fitness in another environment? Why or why not?

) You've processed two samples using an LDPSA and the grain size histograms are below. Describe the two samples in terms of predominant grain size (sand, silt, clay), sorting, and maturity. Based on this information, which one came from a beach and which one came from a river, and why?

Answers

Sample 1 likely came from a beach due to its dominance of sand, moderate sorting, and absence of silt and clay. Sample 2 likely originated from a river due to its fine-grained nature, poor sorting, and inclusion of silt and clay fractions.

Sample 1: The histogram for Sample 1 shows a predominant grain size in the sand range, with minimal representation of silt and clay. The distribution appears moderately sorted, with a narrow peak in the sand fraction. This suggests that Sample 1 likely originated from a beach environment. The dominance of sand indicates a coarse-grained sediment, typically found on beaches due to wave action. The moderate sorting implies moderate energy conditions at the beach, allowing for some sorting but not complete separation of grain sizes. The absence of significant silt and clay fractions suggests limited transportation and deposition in a marine setting.

Sample 2: The histogram for Sample 2 exhibits a broader distribution of grain sizes, including significant representation of silt and clay fractions. This indicates a fine-grained sediment. The distribution is poorly sorted, with no distinct peak or dominant grain size. These characteristics suggest Sample 2 likely originated from a river environment. Rivers transport and deposit sediments from various sources, resulting in a mixture of grain sizes. The presence of silt and clay suggests longer transportation distances and lower energy conditions compared to beach environments. Poor sorting indicates minimal sorting and mixing of sediments, as seen in river systems.

To learn more about dominance follow the link:

https://brainly.com/question/15434739

#SPJ4

Drag each label to the correct location on the image
The image below shows the process of DNA replication, Identify the components of the process.
DNA helicase
topoisomerase
lagging
strand
DNA polymerase Okazaki fragment RNA primase
original DNA
DANH LANA
primer
ADAWN
leading
strand
Reset
Next
HIDD
parent
DNA

Drag each label to the correct location on the imageThe image below shows the process of DNA replication,

Answers

DNA replication is semi-conservative and involves different enzymes in charge of unwinding the DNA molecule (topoisomerase), separating strands (helicase), creating primers (Primase), and adding complementary nucleotides (Polymerase). 1) DNA polymerase, 2) Topoisomerase, 3) Okazaki fragment, 4) DNA helicase, 5) RNA primase.

What is the DNA replication process?

DNA replication is the process through which DNI molecule duplicates. This event takes place during the S stage of the interphase. So when the cell divides during mitosis or meiosis, each cell will get a complete set of chromosomes.

DNA Replication consists of the unwinding and opening of the double-stranded DNA molecule and producing two new molecules using these original strands.

DNI replication is semi-conservative because each new molecule carries an original DNI strand and a new one.

Initiation phase

Helicase and topoisomerase are the first enzymes involved.

Topoisomerase impedes the DNA double helix near the replication forks to get too coiled when the DNA is opening. This enzyme is necessary to release tension.

Helicase works in the replication origin. It separates the original DNA molecule into two strands by breaking hydrogen bonds and separating the two original strands.

Elongation phase

DNA polymerase, primase, and ligase act in this phase.

These enzymes are responsible for DNA elongation. They add nucleotides to the growing chain, from 3' to 5' extremes. The new chain grows in 5’-3’ direction.

Primase is in charge of synthesizing primers. Primers are needed to make the DNA polymerase work. Primers are small units of RNA and are placed at the beginning of each new fragment.

DNA polymerase eliminate the primers and substitute them with DNA. This enzyme makes the new nucleotides enter the fork and pairs them with the corresponding nucleotide of the original strand.

DNA ligase seals the gaps that remain after replacing the primers.

DNA strands are antiparallel, and replication occurs only in 5'-3'direction. So one of the strands will replicate continuously, while the other strain will be formed by short fragments known as Okazaki fragments.

The replication process results in two DNA molecules, each of them carrying an old strand and a new strand.

1) DNA polymerase

2) Topoisomerase

3) Okazaki fragment

4) DNA helicase

5) RNA primase

You can learn more about DNA replication process at

https://brainly.com/question/15113844

https://brainly.com/question/28146405

#SPJ1

Drag each label to the correct location on the imageThe image below shows the process of DNA replication,

Why do people call it plastic surgery when it involves the living body?

Answers

People call it plastic surgery when it involves the living body because plastic was used to describe molding or shaping in Greek mythology.

What is plastic surgery?

Plastic surgery is a cosmetic surgery to repair body parts, especially involving the transfer of tissue.

Plastic surgery is done to improve appearance i.e. aesthetics rather than health improvement.

The term Plastic surgery comes from the Greek word plastike (teckhne) meaning the art of molding or shaping.

This was then used to describe the process in which doctors and surgeons reshaped or molded body tissue.

Therefore, people call it plastic surgery when it involves the living body because plastic was used to describe molding or shaping in Greek mythology.

Learn more about plastic surgery at: https://brainly.com/question/14977960

#SPJ1

Answer:

While cosmetic surgery does not usually involve the implementation of synthetic materials into the patient’s body, the goal of plastic surgery is in fact to mold and contour a person’s shape. Plastic surgery gets its name because it is a surgical specialty involving the restoration,  reconstruction, or alteration of the body.

What does a plastic surgeon do?

Today plastic surgery encompasses cosmetic surgery, reconstructive surgery after cancer and accidents, microsurgery, craniofacial surgery to fix birth defects like cleft lips, and branches of transplant surgery. And sometimes, plastic surgeons actually do put plastic things—plastic-like implants, anyway—into their patients.

What is the difference between plastic surgery and cosmetic surgery?

The terms plastic surgery and cosmetic surgery are often used interchangeably to describe the same thing. Like many words in the English language, the origin of the word plastic comes from the Greek language. It is derived from the term Plasticos, which means to mold or shape something.

How long does it take to become a plastics surgeon?

Plastic surgeons undergo rigorous training in surgery, followed by specific training in plastic surgery. This takes up to 8 years of total hands-on training before one can be board certified in plastic surgery.

For more information visit: brainly.com/question/3379893

infinity please comment here what are bryophytae?????​

Answers

Explanation:

Bryophytes are a proposed taxonomic division containing three groups of non-vascular land plants: the liverworts, hornworts and mosses. They are characteristically limited in size and prefer moist habitats although they can survive in drier environments. The bryophytes consist of about 20,000 plant species.

Answer:

The term Bryophyta came up from the word 'Bryon' which means mosses and phyton, meaning plants. These are the plants that grow in shady and damp areas and are small in size. They lack vascular tissues. They reproduce through spores instead of producing flowers and seeds.

Explanation:

hope this helps

100 PTS——-Describe a specific detrimental human impact to a particular ecosystem and propose a solution to reduce the harmful effects over time. Explain how your proposed solution will work to minimize effects in that ecosystem.

Answers

Answer: human trash

Explanation:

Because we leave or trash and it decomposes into harmful air or water

The conversion of lactic acid back to pyruvic acid requires:
A. carbon dioxide
B. yeast
C. light
D. oxygen
HELP PLEASE

Answers

The answers b.yeast I believe

The right atrioventricular valve, or __________, prevents backflow into the right atrium when the right ventricle is contractin

Answers

The right atrioventricular valve, or tricuspid valve, prevents backflow into the right atrium when the right ventricle is contracting.

What is the name of the valve that prevents backflow into the right atrium when the right ventricle is contracting?

The tricuspid valve is one of the four valves in the human heart and is located between the right atrium and the right ventricle. It consists of three cusps or leaflets, hence the name "tricuspid." The primary function of the tricuspid valve is to prevent the backflow of blood from the right ventricle into the right atrium during ventricular contraction.

When the heart contracts, the right ventricle pumps blood to the lungs for oxygenation. The tricuspid valve closes to ensure that blood flows in one direction, from the right atrium to the right ventricle, and does not flow backward into the atrium. This prevents the regurgitation of blood and maintains proper blood flow through the heart.

The tricuspid valve works in coordination with the other heart valves to facilitate efficient circulation. As the right ventricle contracts, the tricuspid valve closes, preventing the backflow of blood into the right atrium. At the same time, the pulmonary valve opens, allowing blood to be pumped into the pulmonary artery and onward to the lungs.

In summary, the tricuspid valve plays a crucial role in maintaining the unidirectional flow of blood through the heart. It ensures that blood moves efficiently from the right atrium to the right ventricle during ventricular contraction, preventing any backflow into the atrium.

Learn more about: tricuspid valve

brainly.com/question/14702422

#SPJ11

The embryonic skeleton is made of hyaline cartilage. why is it necessary for the embryonic skeleton to first be formed from a cartilage matrix?

Answers

Malleability is necessary during the growth period within the tight space of the maternal uterus.

Uterus- In the reproductive system of those who are born with the gender given to them, the uterus is a pear-shaped organ (AFAB). During pregnancy, a fertilized egg implants there, and the baby grows there until it is born. Additionally, it is in charge of the menstrual period. It is frequently called the womb.

Hyaline Cartilage- The transparent, glass-like cartilage that covers numerous joint surfaces is called hyaline cartilage. In addition, it is frequently discovered in the ribs, nose, larynx, and trachea. Pearl-grey in color, firm in texture, and containing a sizable quantity of collagen, hyaline cartilage exhibits these characteristics.

To know more about the Hyaline Cartilage, click on the below link,

https://brainly.com/question/12021407

#SPJ4

Define probability. Apply the term to a coin toss.

Answers

When flipping a coin, the likelihood of getting a tail is equal to the likelihood of getting a head, or 50%, hence the probability of receiving a tail is P(Tail) = P(T) = 1/2.

What is the probability to toss a coin?

The likelihood of getting a head on a coin toss is P(Head) = P(H) = 1/2. There are just two outcomes that can occur when you toss a coin: a head (H) or a tail (T) (L). There is always a 50% chance of getting either head or tail when we flip a coin.

The probability to toss two coins having heads on both coins is 1/4 and there will be 16 outcomes if tossing 4 coins.

Therefore, if a coin is tossed, the probability might be either "head" (H) or "tail" (T). It is impossible to anticipate whether a coin toss will result in a "head" or "tail."

Learn more about probability, here:

https://brainly.com/question/14982113

#SPJ6

the potential source of land pollution in your locality​

Answers

Answer:

Littering

Explanation:

People dispose little anyhow and anywhere


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

I need the answers and a simple explanation, please :)

3. The main difference between saturated and unsaturated fatty acids is
(a) the amount of energy found in the fatty acid.
(b) saturated fatty acids are liquids.
(c) unsaturated fatty acids can be packed together very tightly.
(d) the number of hydrogen atoms bonded to the carbon atoms.

4. The function of proteins can include
(a) helping cells keep their shape.
(b) helping to destroy foreign substances.
(c) speeding up biochemical reactions.
(d) all of the above
bruoqmoo oinsgio

5. The characteristics of DNA includes which of the following?
(a) DNA is made of nucleotides consisting of a sugar, a phosphate group, and a carbon base
(b) DNA is made of a single polynucleotide chain, which winds into a double helix.
(c) DNA is how inherited characteristics are passed from one generation to the next.
(d) all of the above

6. Which category of organic compound is the major component of cell membranes?
(a) carbohydrate
(b) lipid
(c) protein
(d) nucleic acid

7. The cell wall of plants is made out of
(a) starch.
(b) glycogen
(c) cellulose
(d) chitin

Answers

Answer:

3.  (a) the amount of energy found in the fatty acid.

4. (d) all of the above

5. (c) DNA is how inherited characteristics are passed from one generation to the next.

6. (b) lipid

7. (c) cellulose

Explanation:

3. Saturated fats have more energy due to the double bonds that are found in the molecules.

4. Different proteins have various and roles within the cell.

5. Each nucleotide, in turn, is made up of a nitrogenous base (not carbon base), a pentose sugar, and a phosphate. DNA is a double chain.

6. Biological membranes consist of a continuous double layer of lipid molecules in which membrane proteins are embedded.

7. The cell wall is composed of a network of cellulose microfibrils and cross-linking glycans embedded in a highly cross-linked matrix of pectin polysaccharides.

Which kind of erosion moves dissolved salt from place to place?
A. Chemical
B. Gravity
C. Sheet
D. Wind

Answers

Answer:

A. Chemical

Explanation:

Answer: I think the answer is A

Explanation: pls forgive me if I am wrong ty

-♥ Roxy ♥

Which of the following would be classified as concepts in anatomy?

Cellular energy requires the body's production of ATP.

The brain is composed of two hemispheres.

Glucose is the necessary fuel for the brain.

Each kidney contains approximately 6-10 pyramids.

Study of function.

The muscle on the back of the arm has three heads of origin.

Study of form.

Answers

Concepts in anatomy from the given options include:

The brain is composed of two hemispheres.Each kidney contains approximately 6-10 pyramids.The muscle on the back of the arm has three heads of origin.Study of form.

What is anatomy?

Anatomy is a branch of biology that is concerned with the study of the structure of living organisms and their various parts.

Anatomy studies the position of body structures as well as the position of related structures or organs of the body.

Anatomy also studies how the structure of these body parts relates to their functions.

Therefore, concepts in anatomy from the given options are:

The brain is composed of two hemispheres.Each kidney contains approximately 6-10 pyramids.The muscle on the back of the arm has three heads of origin.Study of form.

In conclusion, anatomy deals with structure of body parts of living organisms.

Learn more about anatomy at: https://brainly.com/question/896286

#SPJ1

any help would be very much appreciated!

any help would be very much appreciated!

Answers

The pictures are shown for pathogens which are harmful to human body and 1st is virus 2nd is fungus 3rd is protozoa and 4th is bacteria.

Explanation: There are many pathogens that are harmful to people and they are harmful because they use the host machinery to replicate themselves and grow and also damages the host machinery and lyse the cell which in turn reduces the immunity of the host body and also make the host body prone to diseases leading to the early death of host or miserable life.

These pathogens are bacteria, protozoa, fungi, and viruses.

Virus - The viruses are considered as non-living or living depending upon whether they are outside the host cell or inside it as it they are outside they are nonliving and if inside they are living and have genetic material RNA or DNA and a protein coat called capsid.

Bacteria - The bacteria are also unicellular organisms which are prokaryotes and have a cell wall made up of peptidoglycan and can be divided in gram negative and gram-positive bacteria for example Xanthomonas.

Fungi - The fungi are multicellular organisms and have mycelia which is a thread-like structure in the form of a network called hyphae and they produce a different types of spores for their development.

Protozoa - They are microscopic and unicellular organisms and are eukaryotic in nature having complex structure and have complex metabolism and also have cilia for their movements.

So according to this 1st is virus 2nd is fungus 3rd is protozoa and 4th is bacteria.

To know more about this click at https://brainly.com/question/18456055

#SPJ4

Which section of the brain helps regulate heartbeat and respiration? A. Cerebellum B. Diencephalon C. Brain Stem D. Cerebrum

Answers

The section of the brain that helps regulate heartbeat and respiration is the Brain Stem. Option (c)

The brain stem is a crucial part of the brain that connects the cerebrum and cerebellum to the spinal cord. It plays a crucial role in controlling some of the most basic life-sustaining functions of the body, such as heartbeat, respiration, and blood pressure regulation.

Specifically, the medulla oblongata, which is part of the brain stem, controls the autonomic functions of the heart and lungs, as well as various reflexes, such as coughing and sneezing. Damage to this area of the brain can result in serious and potentially life-threatening disruptions to these vital bodily functions.

Learn more about Brain Stem.

https://brainly.com/question/3666013

#SPJ4

What is a likely consequence of continued human population growth? A. More rain forests B. Fewer urban centers Ο Ο Ο Ο O C. Less pollution D. Depleted natural resources​

Answers

Answer:

D. Depleted natural resources​

Explanation:

If the human population on Earth continues to grow, depletion of natural resources is a very likely consequence.

Especially at the rapid rate that humans consume natural resources, continued population growth would eventually deplete them.

Fossil fuels are an example of natural resources that will eventually deplete, as humans use immense amounts of things like coal and natural gas.

Answer choices A, B, and C are incorrect because they would be consequences of decreased human population growth.

So, the correct answer is D. Depleted natural resources.

Other Questions
Solve 4y - 7 =29Quickly done FOR THE STORY "Icarus and Daedalus"Think about the effects (results) of Daedalus making wings. Explain what the immediate effect is and what the long-term effect is. Use details from the myth in your response. Please answer both if you can! who is the first father of chemistry Mia's checking account balance is overdrawn by $52.65.She deposits $135.50 and writes a check for $24.30.What is the new balance of her checking account? A) $58.55 B B) $82.85 C) $107.15 D) $163.85 a 1 liter solution contains 0.301 m hydrocyanic acid and 0.226 m sodium cyanide.Addition of 0.150 moles of sodium hydroxide will:(Assume that the volume does not change upon the addition of sodium hydroxide.)Raise the pH slightlyLower the pH slightlyRaise the pH by several unitsLower the pH by several unitsNot change the pHExceed the buffer capacity What is the greatest common factor (GCF) of 15 and 6x? What is the additive inverse of -5?A. 10B. -5C. 0D. 5 Which three logical predictions can be made after reading this passage "the most dangerous game" can I get some help ??? Explain the importance of molar fraction of carbon dioxide and oxygen when calculating excess air during combustion Consider the following probability distribution: 1 2 3 4 5 f(x) 0.1 0.40 0.15 0.25 0.10 Find Var(X) (write it up to second decimal place) Var(X) -2(y-5)=3y+10-5y PPLLZZ HELPP ASAP What is the equation for finding the amount of inertia in forces and motion? Explain how you solve that equation. 6 th history lesson no 1 short note question (ill mark brainliest if its correct )Michael conducted a survey at his school. He asked 25 students what their favorite sport was. 10 of them answered football. Based on that survey, how many students out of 1,500 would prefer football? please help me asap! will give 20 points. What does the out of Africa theory maintain? Kennedy is making dessert for Thanksgiving.She decides to make thirteen pumpkin pies. Tomake each of the 13 pies she is baking she willneed 12 cups of pumpkin, 4 cups of sugar, and1 cup of milk. How many cups of pumpkin willKennedy need to make all her pies? identify an appropriate policy for accounting for the value ofinventory