The strength of gravity on Zarflax-beta-9z is 17 N/kg.
We can use the formula:
weight = mass x gravity
to determine the strength of gravity on Zarflax-beta-9z.
We know that the mass of the book is 3 kg and its weight is 51 N. So, we can rearrange the formula to solve for gravity:
gravity = weight / mass
gravity = 51 N / 3 kg
gravity = 17 N/kg
To know more about gravity, here
brainly.com/question/14874038
#SPJ4
helppppppppppppppppppppppp
Explanation:
v²= u² + 2as
v= final velocity.
u= initial velocity.
a= acceleration.
s= distance.
What is the relation between the weight of a body and acceleraton due to gravity?
Answer:
All objects on Earth, regardless of their mass, accelerate due to gravity at the same rate - that is, 9.8 m/sec2. The weight of an object can be calculated using the formula for force - F = m * a - where F equals the weight of the object and now the acceleration (a) is the acceleration of gravity (g).
A uniform conducting rod of length 23 cm has a potential difference across its ends equal to 66 mV (millivolts). What is the magnitude of the electric field inside the conductor in units of N/C
The magnitude of the electric field inside the conductor will be 0.208 N/C.
What is an electric field?An electric field is an electric property that is connected with any location in space where a charge exists in any form. The electric force per unit charge is another term for an electric field.
Given data;
length of rod = 25 cm = 0.25 m
Potential Difference = 52 mV = 0.052 Volts
The electric field is found as the ratio of the potential difference and the length;
\(\rm E =\frac{0.052}{0.25} \\\\ E=0.208 \ N/C\)
Hence,the magnitude of the electric field inside the conductor will be 0.208 N/C.
To learn more about the electric field refer to the link;
https://brainly.com/question/26690770
#SPJ1
Johnny is getting into building and launching model rockets. In designing a rocket, he has to select an engine based on how much force it produces. If his rocket has a mass of 5.00 kg and he wants it to have an acceleration of 28.8 m/s2, how much force in Newtons does the engine need to produce? (Answer should have 3 significant figures.)
In designing a rocket to select an engine based on how much force it produces, the engine need to produce 144 N force.
Equation :Force applied on launching model rockets is calculated by the formula,
F = m*a
where,
F is the force of engine
m is the mass
a is the acceleration
The given data are :
m = 5 Kg
a = 28.8 m/s²
F = ?
Now, putting the values in the formula we get,
F = 5 Kg x 28.8 m/s²
F = 144 N
So, In designing a rocket to select an engine based on how much force it produces, the engine need to produce 144 N force.
To know more about acceleration :
https://brainly.com/question/2303856
#SPJ10
Steve walks from his house 5 km South then turns east and walks 2 km. Then he walks 9 km North to his older sister's house. She gives him a ride to his friend Fred's house 2 km West. Find his distance
Given :
Steve walks from his house 5 km South then turns east and walks 2 km. Then he walks 9 km North to his older sister's house. She gives him a ride to his friend Fred's house 2 km West.
To Find :
The total distance covered by Steve .
Solution :
We know , distance is the actual measurement space between two points .
Now , total distance travelled by Steve is the sum of all distance travelled .
\(T=5+2+9+2\\\\T=18\ km\)
So , total distance covered by Steve is 18 km .
Hence , this is the required solution .
The distance Steve traveled is mathematically given as
T=18Km
What is distance has Steve traveled?Question Parameters:
Steve walks from his house 5 km South then turns east and walks 2 km.
Then he walks 9 km North to his older sister's house.
Generally, the total distance has Steve traveled is mathematically given as
T=5+2+9+2
T=18Km
In conclusion, because the distance is the measure of space b/w two points the total distance traveled is
T=18Km
Read more about Mesurement
https://brainly.com/question/17972372
10 points to whoever answers!!!
What is the formula for work? What is the formula for power?
Answer:
power= work done /time.
Answer:
W = Force * distance
Power = W/ time
Explanation:
A pirate fires his cannon parallel to the water but 3.5 m above the water. The cannonball leaves the cannon with a velocity of 120 m/s. He misses his target and the cannonball splashes into the briny deep. How far did the cannonball travel? (please show work)
Answer:
202.8m
Explanation:
Given that A pirate fires his cannon parallel to the water but 3.5 m above the water. The cannonball leaves the cannon with a velocity of 120 m/s. He misses his target and the cannonball splashes into the briny deep.
First calculate the total time travelled by using the second equation of motion
h = Ut + 1/2gt^2
Let assume that u = 0
And h = 3.5
Substitute all the parameters into the formula
3.5 = 1/2 × 9.8 × t^2
3.5 = 4.9t^2
t^2 = 3.5/4.9
t^2 = 0.7
t = 0.845s
To know how far the cannonball travel, let's use the equation
S = UT + 1/2at^2
But acceleration a = 0
T = 2t
T = 1.69s
S = 120 × 1.69
S = 202.834 m
Therefore, the distance travelled by the cannon ball is approximately 202.8m.
Insert tab A into slot B" is something you might read in the assembly instructions for pre-fabricated bookshelves. Suppose that tab A varies in size according to a Normal distribution with a mean of 30 mm. And a standard deviation of 0. 5 mm. , and the size of slot B is also Normally distributed, with a mean of 32 mm. And a standard deviation of 0. 8 mm. The two parts are randomly and independently selected for packaging. What is the probability that tab A won’t fit into slot B?
0.017 is the probability that tab A won’t fit into slot B
What is probability?Probability is related to possibility. Random event generation is the subject of this branch of mathematics. Values range from 0 to 1. Probabilities are built into mathematics to predict the likelihood of certain events.
P(tab A won't fit into slot B) = P (A>B)
= P( A-B > 0)
Given that, A ≈ N(30,0.5) B ≈ N(32, 0.8)
Here,
E (A-B) = 30-32 = -2
V(A-B) = V(A) + V(B) = (0.5)² + (0,8)²
= 0.89
SD (A-B) = \(\sqrt{0.89}\)
So, (A-B) ≈ N (-2, 0.9433)
P( A-B > 0) = 1 - P(A-B ≤ 0)
= 1 - P [(A - B +2 / 0.9433) ≤ (+2 / 0.9433)]
= 1 - P (Z₁ ≤ 2.12)
= 1 - 0.98300
= 0.017
To know more about probability refer to:
https://brainly.com/question/25839839
#SPJ1
What is the wave speed if the period is 4.0 seconds and the
wavelength is 1.8 m?
Answer:
0.45 m/s
Explanation:
A cup of coffee with cooling constant k = -0.09 is placed in a room temperature of 18°C. If the coffee is served at 93 °C, how long will it take to reach a drinking temperature of 73 °C?
The time taken for the coffee to cool from 93°C to 73°C is approximately 36.1 minutes.
The cooling law is given by:
$$\frac{dQ}{dt}=-k(T-T_0)$$
where Q is the heat in the object, t is the time taken, T is the temperature of the object at time t, T0 is the temperature of the environment and k is a constant known as the cooling constant.
We need to find the time it takes for the coffee to reach a drinking temperature of 73°C given that its initial temperature is 93°C.
Therefore, we need to find the time it takes for the coffee to cool down from 93°C to 73°C when placed in a room temperature of 18°C.
Let’s assume that the heat energy that is lost by the coffee is equal to the heat energy gained by the environment. We can express this as:
dQ = - dQ where dQ is the heat energy gained by the environment.
We can substitute dQ with C(T-T0) where C is the specific heat capacity of the object.
We can rearrange the equation as follows:
$$-\frac{dQ}{dt}=k(T-T_0)$$
$$-\frac{d}{dt}C(T-T_0)=k(T-T_0)$$
$$\frac{d}{dt}T=-k(T-T_0)$$
The differential equation above can be solved using separation of variables as follows:
$$\frac{d}{dt}\ln(T-T_0)=-k$$
$$\ln(T-T_0)=-kt+c_1$$
$$T-T_0=e^{-kt+c_1}$$
$$T=T_0+Ce^{-kt}$$
where C = e^(c1).
We can now use the values given to find the specific value of C which is the temperature difference when t=0, that is, the temperature difference between the initial temperature of the coffee and the room temperature.
$$T=T_0+Ce^{-kt}$$
$$73=18+C\cdot e^{-0.09t}$$
$$55=C\cdot e^{-0.09t}$$
$$C=55e^{0.09t}$$
$$T=18+55e^{0.09t}$$
We can now solve for the value of t when T=93 as follows:
$$93=18+55e^{0.09t}$$
$$e^{0.09t}=\frac{93-18}{55}$$
$$e^{0.09t}=1.3636$$
$$t=\frac{\ln(1.3636)}{0.09}$$
Using a calculator, we can find that the time taken for the coffee to cool from 93°C to 73°C is approximately 36.1 minutes.
For more such questions on time, click on:
https://brainly.com/question/26046491
#SPJ8
Question 7 of 10
What could you do to increase the electric potential energy between two
positively charged particles by a factor of 16?
A. Increase the distance by a factor of 16.
B. Reduce the distance by a factor of 4.
C. Reduce the distance by a factor of 16.
D. Increase the distance by a factor of 4.
a system undergoes a two-step process. in the first step, the internal energy of the system increases by 228 j when 166 j of work is done on the system. in the second step, the internal energy of the system increases by 115 j when 177 j of work is done on the system. for the overall process, find the heat. what type of process is the overall process? explain.
1) Q total = 0J
2) Since there has been no net heat exchange, the entire system is cooling.
From where do we get our energy?In accordance with the U.S. Energy Statistics Management, coal, nuclear power, and natural gas made up the majority of the country's electrical generation in 2020. Renewable energy sources like wind, hydropower, solar, biomass, breezes, and geothermal are also used to generate electricity.
According to the first law of thermodynamics
ΔE = Q - W
where ΔE= change in internal energy , Q = heat and W= work done by the system to the surroundings
in the first step
Q1 = ΔE + W = 228 J + (-166 J) = 62 J
in the second step
Q2 = ΔE + W = 115 J + (- 177 J) = -62J
the total heat is
Q total = Q1 +Q2 = 62 J + (-62J) = 0
since the total heat exchanged is 0, the overall process is a cooling process .
To know more about energy visit:
https://brainly.com/question/1932868
#SPJ4
Which of the following substances is the closest to a neutral pH? O A. milk
Answer:
The answer is water
Explanation:
it has a netural ph of 7.0
why is the only option milk?
The Ph for milk is about 6.5 to 6.7, it varies becauses milks gets sour when it rots.
Degeneracy pressure stops the crush of gravity in all the following except:_____.A) a brown dwarf.
B) a white dwarf.
C) a neutron star.
D) a very massive main-sequence star.
E) the central core of the Sun after hydrogen fusion ceases but before helium fusion begins.
Degeneracy pressure stops the crush of gravity in all the following except a brown dwarf. The correct option is a.
What is Degeneracy pressure?Electron degeneracy pressure is a subset of the broader phenomenon of quantum degeneracy pressure.
The Pauli exclusion principle prevents two identical half-integer spin particles from occupying the same quantum state at the same time.
Electron degeneracy pressure, in particular, is what protects white dwarfs from gravitational collapse, as well as the Chandrasekhar limit (the maximum mass a white dwarf can attain) arises naturally as a result of electron degeneracy physics.
Thus, the correct option is a.
For more details regarding degeneracy pressure, visit:
https://brainly.com/question/14439838
#SPJ1
Maria drove 100 miles in 2 hrs. what was marias speed?
350L 125kpa decreased to 2.00l
Answer:
Your Mom Your MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomYour MomvYour MomYour MomYour MomYour Mom.
different between cell and dynamo short and sweet
Answer:
Cell is the unit which has two terminals one positive and one negative. A battery is a group of cells in which one negative terminal is attached to one positive terminal.
Cell:- Cell is the smallest unit of a battery.
Battery:-A battery is combination of cells.
A car advertisement states that a certain car can accelerate from rest to 70 km/s in 7 seconds. Find the car’s average acceleration.
Please find attached photograph for your answer. Please do comment whether it is helpful or not.
HELP PLS
HELP PLS
HELP PLS
HELP PLS
HELP PLS
HELP PLS
HELP PLS
HELP PLS
Explanation:
Refer the explanation in the picture
calculate+the+time+required+for+a+sample+of+radioactive+tritium+to+lose+76.0+%+of+its+activity.+(tritium+has+a+half-life+of+12.3+years.)
The time required for a sample of radioactive tritium to lose 76.0% of its activity is 24.6 years.
To calculate the time required for a sample of radioactive tritium to lose 76.0% of its activity, we can use the half-life formula. Tritium has a half-life of 12.3 years, which means that in 12.3 years, half of the initial amount of tritium will decay.
So, if we want to find out how long it takes for 76.0% of the tritium to decay, we can use the following formula:
time = (ln 2/ln(1/2)) x half-life x (ln(initial activity/final activity)).
Plugging in the values, we get time = (ln 2/ln(1/2)) x 12.3 x (ln(1/final activity)).
Since we want 76.0% of the activity to decay, we can set final activity = 0.24 (1-0.76), which gives us a time of approximately 24.6 years.
Learn more about tritium at https://brainly.com/question/31985379
#SPJ11
A box that is 46.83 kg is on a flat surface. The box and surface have a friction coefficient of 0.99. If the box is accelerating to the right, what is the friction force? Answer to the hundredths.
12 A car travels in a straight line at speed v along a horizontal road. The car moves
against a resistive force F given by the equation
F = 400+kv²
where F is in newtons, v in ms-1 and k is a constant.
At speed v = 15ms-1, the resistive force F is 1100 N.
a
Calculate, for this car:
i the power necessary to maintain the speed of 15ms-¹,
ii the total resistive force at a speed of 30 ms-¹,
iii the power required to maintain the speed of 30ms-¹.
Answer:
i) Power = Force * Velocity = 1100 * 15 = 16500 W = 16.5 kW(ii) Find the value of k first: F = 400 + k(15^2) k = 28/9 F = 400 +(28/9)(30^2) = 320
Explanation:
A single stranded sequence of a gene is shown below. An investigator wants to amplify and isolate this small gene using PCR. Design two PCR primers, each 15 nucleotides long, that can be used to amplify this DNA segment. (remember that DNA sequences are written 5' to 3' by convention) ACTTTCCAAACGCCCCGTGTCGATACTGAACGAATCGATGCACGCTCCC TTCCTTGAAAACGCATAAACATACAAGTGGGCAGATGATGCGTACGCCC CTCTAATACATCCAACACTCTACGCCCTCTTCAAGAGCTGGAAGGGCA CCCTGCACTTGGATAGGGGATTATCTCGTAAGGCAAGCTCGTACCGTC ATTCATGCGGAAGAGTTAACACGATTGGAAGTAGGGATAGTTTCGAA CCTCGGTTACTAGTCCTAATAAGGGAACGCTGTCTGAAGGATGAGTGT CAGCCAGTGTA Forward Primer Reverse Primer
The forward primer for PCR amplification of the given gene sequence is 5'-ACTTTCCAAACGCCC-3', and the reverse primer is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.
To design the PCR primers for amplifying the given gene sequence, we need to identify regions that flank the target segment. The primers should be complementary to the template DNA and positioned in such a way that DNA synthesis occurs in the desired direction.
Based on the provided gene sequence, the forward primer is designed to bind to the coding (sense) strand of DNA. It starts at position 1 (5'-end) and extends for 15 nucleotides. The forward primer sequence is 5'-ACTTTCCAAACGCCC-3'.
The reverse primer, on the other hand, is designed to bind to the non-coding (antisense) strand of DNA. It starts at a position near the end of the gene sequence (position 241) and extends for 15 nucleotides in the opposite direction. The reverse primer sequence is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.
These primers will anneal to their complementary sequences on the template DNA during the PCR amplification process. The resulting amplicon will span the target gene segment and can be subsequently isolated and studied further.
To learn more about amplification click here brainly.com/question/30300512
#SPJ11
Carlos ran his cross country race in 18 minutes. His goal is to finish his next one in
under 17 minutes. What skill does Carlos MOST likely need to focus on to reach this
goal?
balance
reaction time
Speed
coordination
There is a tug-o-war competition. Which direction will the rope travel if both teams are pulling in opposite direction with equal force?
Answer:
it will not move
Explanation:
this is because newton's first law of motion states that every object will continue in its state of rest or uniform motion in a straight line unless a resultant force acts on it,
and suppose the force on right side = 5 N
and the force on the left side = 5 N
let one side be positive and the other side negative
so we get + 5N - 5N
which is 0 N
therefore, the resultant force = 0 N,
so the rope will not move if it initially wasn't.
but if it was initially moving towards the right(or the left), it would continue to move in that direction in a straight line .
but most likely not move
hope this helps
explain why balancing the forces acting on a body is not enough to establish equilibrium.
Balancing the forces acting on a body is not enough to establish equilibrium because equilibrium also requires the balancing of torques or moments acting on the body.
In physics, equilibrium refers to a state in which an object or system experiences no net force and no net torque. For an object to be in equilibrium, both the forces and the torques acting on it must be balanced.
Balancing the forces means that the vector sum of all the forces acting on the body is equal to zero. This ensures that there is no net force acting on the object, and it will not accelerate in any direction. However, even if the forces are balanced, the object can still rotate or have a tendency to rotate if the torques acting on it are not balanced.
A torque, also known as a moment, is a measure of the tendency of a force to rotate an object about a specific axis. It depends on the magnitude of the force, the distance from the axis of rotation, and the angle between the force and the lever arm. When torques are balanced, the sum of all the torques acting on the object is equal to zero.
To establish equilibrium, both the forces and the torques acting on the body must be balanced. This means that not only should the vector sum of the forces be zero, but also the algebraic sum of the torques should be zero. When both conditions are met, the object will remain at rest or continue to move with a constant rotational motion.
Balancing the forces acting on a body is not enough to establish equilibrium because equilibrium requires the balancing of both forces and torques. Simply balancing the forces ensures that there is no net force acting on the object, but it does not guarantee that the object will be in a state of complete equilibrium. To achieve equilibrium, the torques acting on the object must also be balanced, ensuring that there is no tendency for rotation.
To know more about equilibrium visit,
https://brainly.com/question/517289
#SPJ11
What is the period? Blank seconds.
Answer:
Period refers to the time for something to happen and is measured in seconds/cycle
Answer:
What is the period of time? 5.62 Seconds
What is the amplitude? 1 Centimeters
Explanation:
it just makes sense
Two flying fish have an inelastic collision while in mid-flight. One fish has a mass of 0. 650 kg and a velocity of 15. 0 m/s to the right; the other has a mass of 0. 950 kg and a velocity of 13. 5 m/s to the left. Find the change in their kinetic energy after the collision
The change of kinetic energy is -156.7 joules.
\(V1_{i}\) =15
\(V2_{i}\)= -13.5(as towards left)
V= common velocity during collision
On applying momentum conservation during the collision
\(m_{1}V1_{i} + m_{2}V2_{i} = V ( m_{1} + m_{2})\)
\(0.650 \ 15 + 0.950 \ (-13.5) = (0.625 + 0.950) \ V\)
\(\frac{3.075}{1.6}\) =V
V= -1.92 m/s
To kind change in kinetic energy we will subtract final and initial kinetic energy
ΔK=\(\frac{1\ (m_{1} + m_{2} ) \ V}{2} ^{2}\) - \(\frac{1\ (m_{1} ) \ V1_{i} }{2} ^{2}\) - \(\frac{1\ (m_{2} ) \ V2_{i} }{2} ^{2}\)
ΔK= \(\frac{1\ (0.625 + 0.950 ) \ (-13.5)}{2} ^{2}\) - \(\frac{1\ (0.625 ) \ 15 }{2} ^{2}\)- \(\frac{1\ (0.950 ) \ 13.5 }{2} ^{2}\)
ΔK= = - 156.7 J
Learn more about Kinetic energy
brainly.com/question/26472013
#SPJ4
Skeletal muscles are:
cinder block is sitting on a platform 20 m high. It weighs 79 N. The block has
energy. Calculate it.
Answer: 1580 J
Explanation:
Energy is in the form of gravitational potential energy. (GPE)
GPE = mgh , where m is the mass of the block, h is the height and g is the gravitational constant of 9.81 ms-2.
Hence,
Total energy = mass x gravitational constant x height
= Weight x height (since W = mg)
= 79 x 20 J
= 1580 J