Need to find OM and NM given AO= 6371 angle NOE= 16.26 deg and that AO bisects angle NOEIf it helps at all the point O is in the center of the circle and segment OA is the radius

Need To Find OM And NM Given AO= 6371 Angle NOE= 16.26 Deg And That AO Bisects Angle NOEIf It Helps At

Answers

Answer 1

As you can see the segments OM ME and OE form a right triangle. So to find the measure of the segment OM you can use the trigonometric ratio cos (θ):

\(\cos (\theta)=\frac{\text{ Adjacent side}}{\text{ Hypotenuse}}\)

So, you have:

\(\begin{gathered} \cos (MOE\text{)}=\frac{OM}{OE} \\ \cos (8.13\text{\degree)}=\frac{OM}{6371} \end{gathered}\)

Angle MOE measures 8.13 ° because segment AO bisects angle NOE.

\(\frac{16.26\text{\degree}}{2}=8.13\text{\degree}\)

The measure of segment OE is 6371 because it is a radius of the circle just like segment AO.

\(\begin{gathered} \cos (8.13\text{\degree)}=\frac{OM}{6371} \\ \text{ Multiply by 6371 on both sides of the equation } \\ \cos (8.13\text{\degree)}\cdot6371=\frac{OM}{6371}\cdot6371 \\ \cos (8.13\text{\degree)}\cdot6371=OM \\ 6306.97=OM \end{gathered}\)

Now, to find the measure of segment NM you can use the trigonometric ratio sin (θ):

\(\sin (\theta)=\frac{\text{Opposite side}}{\text{ Hypotenuse}}\)

Also, the NM and ME segments are equal because the AO segment bisects the NOE angle. So, you have:

\(NM=ME\)\(\begin{gathered} \sin (MOE)=\frac{ME}{OE} \\ \sin (8.13\text{\degree})=\frac{ME}{6371} \\ \text{ Multiply by 6371 on both sides of the equation} \\ \sin (8.13\text{\degree})\cdot6371=\frac{ME}{6371}\cdot6371 \\ \sin (8.13\text{\degree})\cdot6371=ME \\ 900.98=ME \\ \text{ Then} \\ 900.98=NM \end{gathered}\)

Therefore, the measurements of the OM and NM segments are:

\(\begin{gathered} 6306.97=OM \\ 900.98=NM \end{gathered}\)

Need To Find OM And NM Given AO= 6371 Angle NOE= 16.26 Deg And That AO Bisects Angle NOEIf It Helps At
Need To Find OM And NM Given AO= 6371 Angle NOE= 16.26 Deg And That AO Bisects Angle NOEIf It Helps At

Related Questions

Solve the following linear equation and simplify your answer.

8z−6=−2(−4z+3)

Answers

Answer:

Step-by-step explanation:

8z-6=-2(-4+3)

8z-6=8z-6

on transposing,

8z-8z-6+6=0

7. Kate bought 4 pounds of apples
for $10.80. How much did it cost for
one pound of apples?

Answers

Answer:

Step-by-step explanation:

$10.80 for 4 pounds of apples

How much for 1 pound?

$10.80/4 pounds = cost of 1 pound of apples

answer: $2.70

A right cylinder has a diameter of 10 in and height of 15 in. Find the surface area of the cylinder.

Answers

Answer:

628.32 in.²

Step-by-step explanation:

Height: 15 in.

Diameter: 10 in.

Radius: 5 in.

A = 2πrh + 2πr²

2 · π · 5 · 15 + 2 · π · 5²

≈ 628.32

\( \huge{ \underline{ \mathcal{Given : }}}\)

Diameter = 10 in

radius (r) = 5 in

height (h) =15 in

\(\huge{ \mathcal{ \underline{ solution} }}࿐\)

\( \boxed{Area =2 \pi r(h + r)}\)

\(2 \times 3.14 \times \ 5 \times (5 + 15)\)

\(31.4 \times 20\)

\(628 \: \: in {}^{2} \)

Surface Area = 628 in²

\( \#TeeNForeveR\)

number 3 pleasename the intersection of the plane P and the plane that contains points B, C, and D

number 3 pleasename the intersection of the plane P and the plane that contains points B, C, and D

Answers

ANSWER:

B. BC

STEP-BY-STEP EXPLANATION:

We can determine the name since when the planes intersect, a line is formed that belongs to both planes.

In this case we have two planes which are the plane P and the plane with points B, C, D on it

In the image we can see that the line of intersection is BC.

Therefore, the correct answer is B. BC

What order is
5/6 feet long 5/3 feet long 3/2 feet long

Answers

The order of the given fractions will be 5/3>3/2>5/6.

What exactly is a fraction?

A fraction is a mathematical term that represents a portion or part of a whole. It represents the equal parts of the whole. A fraction has two components: the numerator and the denominator. The top number is referred to as the numerator, while the bottom number is referred to as the denominator. The denominator describes the total number of equal parts in a whole, whereas the numerator defines the number of equal parts taken.

5/10, for example, is a fraction.

In this case, 5 is the numerator and 10 is the denominator.

Now,

Given fractions are 5/6 ,5/3,  3/2

lets make the denominator same

Divide and multiply fraction 2 and 3 by 2 and 3 respectively

then fractions are 5/6, 10/6, 9/6

so, the order will be 10/6>9/6>5/6 i.e. 5/3>3/2>5/6

hence,

           The order of the given  fractions will be 5/3>3/2>5/6.

To know more about fractions visit the link

https://brainly.com/question/10354322?referrer=searchResults

#SPJ1

You can paint a room in 8 hours. Working together, you and a friend could paint the same room in just 5 hours. How long would it take your friend to paint the room alone.

Answers

Answer:

friend alone could do it in 13 hours and 1/3

Step-by-step explanation:

Your rate = room/8

friends rate = room/x

combined rate = room/8 + room/x

= room(x+8)/(8x)

then

5 = room / [room(x+8)/(8x)]

5 = 8x/(x+8)

8x = 5x + 40

3x = 40

x = 40/3 = 13 1/3

friend alone could do it in 13 hours and 1/3

PLEASE HURRY DUE TODAY WILL MARK BRAINLESTIS RIGHT

what is  √29 Place a dot on the number line at the BEST approximation​

PLEASE HURRY DUE TODAY WILL MARK BRAINLESTIS RIGHT what is 29 Place a dot on the number line at the BEST

Answers

Answer:

5.4

Step-by-step explanation:

square of 29 = 5.385164807

5.385164807 estimated is 5.4

PLEASE HURRY DUE TODAY WILL MARK BRAINLESTIS RIGHT what is 29 Place a dot on the number line at the BEST

Yo the nearest tenth of an inch what is circumference of the drain ?

Yo the nearest tenth of an inch what is circumference of the drain ?

Answers

given

Find

circumference of the drain

Explanation

circumference of the drain is given by

\(2\pi r\)

r = half of diameter = 4.8/2 = 2.4 in

so ,

\(\begin{gathered} 2\pi\times(2.4) \\ 15.0796447372\approx15.1 \end{gathered}\)

Final Answer

Hence , the circumference of the drain is 15.1 in

Yo the nearest tenth of an inch what is circumference of the drain ?

1. A cinnamon toast recipe calls for 6 parts sugar to 1 part cinnamon. Place an X to indicate if each set of ingredients is proportional to the recipe. 4.5 tsp sugar and 0.75 cinnamon 9 tsp sugar and 1.5 tsp cinnamon 12 tsp sugar and 2 tsp cinnamon 15 tsp sugar and 3 tsp cinnamon proportional not proportional​

Answers

Step-by-step explanation:

if they are proportional, then they must keep the original ratio of 6/1 of sugar to cinnamon.

X 4.5/0.75 = 6 = 6/1

X 9/1.5 = 6 = 6/1

X 12/2 = 6 = 6/1

15/3 = 5 and that is NOT 6/1 (not proportional)

if a number is divided by an d minused from an another number ​

Answers

This process required 3 to be subtracted 5 consecutive times, so again we see that 15 ÷ 3 = 5. The number that is being divided (in this case, 15) is called the dividend, and the number that it is being divided by (in this case, 3) is called the divisor. The result of the division is the quotient.

Division is a simple operation in which a number is divided. It's easiest to think of it as a number of objects being divided among a certain number of people.

Division is one of the four basic operations of arithmetic, the ways that numbers are combined to make new numbers. The other operations are addition, subtraction, and multiplication.

To learn more about division visit: brainly.com/question/621288

#SPJ9

Which is the last operation when evaluating

Which is the last operation when evaluating

Answers

subtraction [BODMAS 'S' comes last which means subtraction]

hope it helps...

Answer:

Subtraction

Step-by-step explanation:

Which is a counterexample for the conditional statement?
If two positive numbers are multiplied together, then the product will be greater than both of the two positive
numbers.
O2 x 4
O 5x(-3)
x
o įx9
Mark this and return
Save and Exit
Next
Submit

Answers

Answer:

I think its 2/3 x 9

Step-by-step explanation:

My apologies if that isn't correct!

The counterexample for the conditional statement "If two positive numbers are multiplied together, then the product will be greater than both of the two positive numbers" will be 2/3 x 9.

What is an arithmetic operation?

It is defined as the operation in which we do the addition of numbers, subtraction, multiplication, and division. It has basic four operators that are +, -, ×, and ÷.

We can utilize multiplication for a number of common tasks, such as figuring out how much it will cost to buy several identical things, calculating sales tax, and figuring out area and other geometric measurements.

It is given if the two positive numbers are multiplied together, then the product will be greater than both of the two positive numbers.

If the two positive numbers are x and y from the given condition,

xy > x

xy> y

The two numbers are obtained as  2/3 and 9.

=2/3 x 9

=6

Thus, the counterexample for the conditional statement "If two positive numbers are multiplied together, then the product will be greater than both of the two positive numbers" will be 2/3 x 9.

Learn more about the arithmetic operation here:

brainly.com/question/20595275

#SPJ2

The expression above can also be written in the form
So what is A =

Answers

Answer:

what is the expressio

Step-by-step explanation:

Question One:
If a raw score corresponds to a z-score of 1.75, what does that tell you about that score in relation to the mean of the distribution?

Question Two:
What if the raw score corresponds to a z-score of -0.85?

Answers

Question One:A positive z-score indicates that the raw score is above the mean, while a negative z-score indicates that the raw score is below the mean.

Question Two: , the raw score is relatively lower than the mean.

If a raw score corresponds to a z-score of 1.75, it tells us that the raw score is 1.75 standard deviations above the mean of the distribution. In other words, the raw score is relatively higher than the mean. The z-score provides a standardized measure of how many standard deviations a particular value is from the mean.

A positive z-score indicates that the raw score is above the mean, while a negative z-score indicates that the raw score is below the mean.

Question Two:

If a raw score corresponds to a z-score of -0.85, it tells us that the raw score is 0.85 standard deviations below the mean of the distribution. In other words, the raw score is relatively lower than the mean. The negative sign indicates that the raw score is below the mean.

To understand the meaning of a z-score, it is helpful to consider the concept of standard deviation. The standard deviation measures the average amount of variability or spread in a distribution. A z-score allows us to compare individual data points to the mean in terms of standard deviations.

In the case of a z-score of -0.85, we can conclude that the raw score is located below the mean and is relatively lower compared to the rest of the distribution. The negative z-score indicates that the raw score is below the mean and is within the lower portion of the distribution. This suggests that the raw score is relatively smaller or less than the average value in the distribution.

By using z-scores, we can standardize and compare values across different distributions, allowing us to understand the position of a raw score relative to the mean and the overall distribution.

For mor such question mean visit

https://brainly.com/question/1136789

#SPJ8

What are three consecutive multiples of 3 if 2/3
of the sum of the first
two numbers is 1 greater than the third number?

Answers

The three consecutive multiples of 3 are 15, 18 and 21

To solve this problem

First, let's determine three successive multiples of 3:

The subsequent two would be "x+3" and "x+6" if we call the initial number "x".

Since we are aware that the third number (x+6) is one more than the first two numbers (x + x+3), we can write the following equation:

2/3(x + x+3) = (x+6) + 1

Simplifying this equation, we get:

2/3(2x+3) = x+7

Multiplying both sides by 3, we get:

2(2x+3) = 3(x+7)

Expanding and simplifying, we get:

4x + 6 = 3x + 21

Subtracting 3x and 6 from both sides, we get:

x = 15

Therefore, the three consecutive multiples of 3 are 15, 18 and 21

Learn more about consecutive multiples here : brainly.com/question/22081489

#SPJ1

Find the roots of each equation. 6v^2+24=0

PLEASE HELP I NEED THIS TO MOVE UP A GRADE

Answers

Answer:

\(v=\pm 2i\)

Step-by-step explanation:

\(6v^2+24=0\\\\6v^2=-24\\\\v^2=-4\\\\v=\pm 2i\)

solve (2x - 3) (x + 2) = 0

Answers

Answer:

x=3/2

x=-2

Step-by-step explanation:

11. 4(x+1)=5(x-3)
help please

Answers

\(4(x + 1) = 5(x - 3) \\ 4x + 4 = 5x - 15 \\ 5x - 4x = 4 + 15 \\ x = 19\)

Evaluate f(x) = 3x - 6:
a) x = -4
b) f(x) = 36.

Answers

Answer:

A) -18

B) 14

Step-by-step explanation:

A:

f(x) = 3x -6

f(-4) = 3(-4) - 6

f(-4) = -12 - 6

f(-4) = -18

B:

36 = 3x - 6  Add 6 to both sides

36 + 6 = 3x - 6 + 6

42 = 3x  Divide both side by 3

\(\frac{42}{3}\) = \(\frac{3x}{3}\)

14 = x

Prove that (- 1 + i)^7 = -8(1 + i)​

Answers

Convert \(-1+i\) to polar form.

\(z = -1 + i \implies \begin{cases}|z| = \sqrt{(-1)^2 + 1^2} = \sqrt2 \\\\ \arg(z) = \pi + \tan^{-1}\left(\dfrac1{-1}\right) = \dfrac{3\pi}4 \end{cases}\)

By de Moivre's theorem,

\(\left(-1+i\right)^7 = \left(\sqrt2 \, e^{i\,\frac{3\pi}4}\right)^7 \\\\ ~~~~~~~~ = \left(\sqrt2\right)^7 e^{i\,\frac{21\pi}4} \\\\ ~~~~~~~~ = 8\sqrt2 \, e^{-i\,\frac{3\pi}4} \\\\ ~~~~~~~~ = 8\sqrt2 \left(\cos\left(\dfrac{3\pi}4\right) - i \sin\left(\dfrac{3\pi}4\right)\right) \\\\ ~~~~~~~~ = 8\sqrt2 \left(-\dfrac1{\sqrt2} - \dfrac1{\sqrt2}\,i\right) \\\\ ~~~~~~~~ = -8 (1 + i)\)

QED

(1 3/4)²

help please

Answers

Answer:

\( \frac{49}{16} \: or \: 3 \frac{1}{16} \)

I will give 25 points and brainiest

I will give 25 points and brainiest

Answers

Answer: Graph B

Hope this helps
The answer is Graph B!!!

There are 4 points that form a rectangle. Three of the points are: (-5 -1) (-5 3) (2<3 What are the coordinates of the fourth point?

Answers

Answer:

\(C = (2,-1)\)

Step-by-step explanation:

Given

\(A = (-5,-1)\)

\(B = (-5,3)\)

\(D = (2,3)\)

Required

The coordinate of the fourth point (C)

The given coordinates indicate the rectangle is vertical/horizontal because it has similar x and y values.

The coordinate of such rectangle can be represented as:

\(A = (x_1,y_1)\)

\(B = (x_1,y_2)\)

\(C = (x_2,y_1)\)

\(D = (x_2,y_2)\)

By comparing the general coordinates with the given coordinates, we have:

\(x_1 = -5\) --- see A and B

\(y_1 = -1\) --- see A and C

\(x_2 = 2\) ---- see C and D

\(y_2 = 3\) --- see B and D

So, we have:

\(C = (x_2,y_1)\)

\(C = (2,-1)\)

Need help with this question. PLS helpppppp

Need help with this question. PLS helpppppp

Answers

Answer:

x = 0.39 or

x = -1.72

Step-by-step explanation:

The quadrateic formula is:

\(x = \frac{-b\pm\sqrt{b^2 - 4ac} }{2a}\)

eq: 3x² + 4x - 2

which is of the form ax² + bx + c = 0

where a = 3, b = 4 and c = -2

sub in quadratic formuls,

\(x = \frac{-4\pm\sqrt{4^2 - 4(3)(-2)} }{2(3)}\\\\=\frac{-4\pm\sqrt{16 + 24} }{6}\\\\=\frac{-4\pm\sqrt{40} }{6}\\\\=\frac{-4\pm2\sqrt{10} }{6}\\\\=\frac{-2\pm\sqrt{10} }{3}\\\\=\frac{-2+\sqrt{10} }{3} \;or\;=\frac{-2-\sqrt{10} }{3}\\\\=0.39 \;or\; -1.72\)

Caculate.

2 1/4÷(3/8÷1/2)

Answers

let's firstly convert the mixed fraction to improper fraction and proceed from there.

\(\stackrel{mixed}{2\frac{1}{4}}\implies \cfrac{2\cdot 4+1}{4}\implies \stackrel{improper}{\cfrac{9}{4}} \\\\[-0.35em] ~\dotfill\\\\ \cfrac{9}{4}\div \left(\cfrac{3}{8}\div \cfrac{1}{2} \right)\implies \cfrac{9}{4}\div \left(\cfrac{3}{8}\cdot \cfrac{2}{1} \right)\implies \cfrac{9}{4}\div \left(\cfrac{3}{4} \right) \\\\\\ \cfrac{9}{4}\cdot \left(\cfrac{4}{3} \right)\implies \cfrac{9}{3}\cdot \cfrac{4}{4}\implies 3\cdot 1\implies \text{\LARGE 3}\)

ANSWER QUICK PLEASE!!
Which expression is undefined?
A. (10 - 10) / 10
B. 0 divided by 3/4
C. 3 / (7 - 7)
D. (-5 - 0) / 5

Answers

Answer:

c...........3/(7-7) is the undefined expression

c ! because the denominator is a 0.

Select the correct answer.
Which graph shows a line with an undefined slope?

Select the correct answer.Which graph shows a line with an undefined slope?

Answers

Answer:

Vertical (A) The first graph is the correct one

Step-by-step explanation:

The "slope" of a vertical line. A vertical line has undefined slope because all points on the line have the same x-coordinate. As a result the formula used for slope has a denominator of 0, which makes the slope undefined..

The first graph shows the line with undefined slope.

What is the general equation of a Straight line?

The general equation of a straight line is -

[y] = [m]x + [c]

where -

[m] → is slope of line which tells the unit rate of change of [y] with respect to [x].

[c] → is the y - intercept i.e. the point where the graph cuts the [y] axis.

We have some graphs as shown in the image.

The slope of the line is the tangent of the angle that the line makes with [+x] axis. So -

tan (90) = sin (90)/cos(90) = 1/0 = undefined

θ = 90 degree

Therefore, the first graph shows the line with undefined slope.

To solve more questions on straight lines, visit the link below-

brainly.com/question/20400984

#SPJ5

Brian set his compass equal to the radius of circle C and drew two circles centered at points A and B on circle C. He labeled the points of intersection of the two circles as shown.

Two circles are drawn by having another circle in the center. The center circle has points A, M, N, B, P, Q, and C. At C the two circles intersect, and at P the center circle and the top circle intersect.

To complete his construction, Brian only needs to use his straightedge to draw some chords of circle C.

Which figures could Brian be constructing?

equilateral triangle MNQ inscribed in circle C
equilateral triangle ANP inscribed in circle C
regular hexagon AMNBPQ inscribed in circle C
square MNPQ inscribed in circle C
square ANBQ inscribed in circle C

Answers

The correct options that could be constructed by Brian using his straightedge to draw some chords of circle C are:

Equilateral triangle MNQ inscribed in circle C

Regular hexagon AMNBPQ inscribed in circle C

Brian is constructing figures inscribed in circle C.

Equilateral triangle MNQ inscribed in circle C:

This option is possible since the points M, N, and Q are labeled and they lie on circle C.

Equilateral triangle ANP inscribed in circle C:

This option is not possible. The points A and P are labeled, but the third vertex of the equilateral triangle is not specified.

Regular hexagon AMNBPQ inscribed in circle C:

This option is possible since the points A, M, N, B, P, and Q are labeled and they lie on circle C.

Square MNPQ inscribed in circle C:

This option is not possible based on the given information. The label points do not form a square.

Square ANBQ inscribed in circle C:

This option is not possible . The points A, N, B, and Q are labeled, but they do not form a square.

The correct options that could be constructed by Brian using his straightedge to draw some chords of circle C are:

Equilateral triangle MNQ inscribed in circle C

Regular hexagon AMNBPQ inscribed in circle C

For more questions on circle

https://brainly.com/question/28162977

#SPJ8

What is the y-intercept of the line described by the equation below? Y=3x - 6

Answers

We are given the equation y = 3x - 6

The slope-intercept form of a line is y = mx + b where m is the slope and b is the y-intercept.

The b value in this equation is -6, thus the y-intercept is -6.

Let me know if you need any clarifications, thanks!

In a triangle with angles measuring a, b and c degrees, the mean of b and c is a. What is the
value of a?

Answers

Answer:

60

Step-by-step explanation:

\(a+b+c=180\\\frac{b+c}{2}=a \rightarrow b+c=2a\\\\a+2a=180\\3a=180\\a=60\)

Therefore, the value of a is 60 degrees

Other Questions
One of the triangles pictured is a rotation of triangle ABC and one of them is a reflection.C5-4een3c2B1 AAA-6 -5 4 3 22 3 4 5 6-123-4-5.1. Identify the center of rotation, and label the rotated image PQR. While measuring a patients pulse the medical assistant should recognize that which of the following patient factors can contribute to an erroneous pulse rate answer the nurse is administering a medication intramuscularly to an assigned client. the nurse would include which actions in administering the medication? select all that apply. This assignment consists of three questions. You are required to answer all of these questions. Question 1 (Marks: 35) With the cold winter months fast approaching, Lungi wants to improve the overall effectiveness of operations at his NGO. He wants to keep track of all the blankets he has in stock and be able to determine how many he has left on distribution days. In the past, it has happened that Lungi thought he had blankets to hand out but in fact had none left. Lungi found out that you are an IT student who needs to find a client for their final year IT project. He has volunteered to be your client. Q.1.1 Plan the logic for Lungi's application using pseudocode. The logic needs to satisfy the following needs: . The application will need to allow Lungi to enter the number of blankets he wishes to distribute on a given day. . The application should keep track of the number of blankets handed out to ensure that Lungi does not hand out more blankets than he has. . The application will need to warn Lungi when he has only one (1) blanket left to hand out. . Once all the blankets have been handed out, the following report should be produced: Blanket Drive: Date Number of blankets available for distribution: Number of blankets distributed: Blankets left for next drive: The pseudocode should incorporate the use of modules. . The pseudocode should implement the features of good program design. Use at least one loop structure appropriately. Use at least one selection structure appropriately.Question 2 (Marks: 35) To help Lungi manage the blankets he has, he will need a proper report which provides him with the following information: . Blanket description Blanket size (area of the blanket) Lung's risk manager has advised him never to have more than 30 blankets in stock Q.2.1 Write the pseudocode for two modules which could be incorporated into the application planned for Lungi in Question 1. The first module must a. Allow Lungi to enter the description and size of the blankets Store the details entered in arrays C Provide Lungi with the option to view the list of blankets captured. If Lungi wishes to view the list of blankets, the contents of the arrays should be passed to another module. The second module should a Receive the arrays as arguments Write the contents of the arrays to a text file that Lungi can print Question 3 (Marks: 30 As the IT student who will be creating the application for Lungi, you have decided to follow an Object- Oriented approach. Lungi has since informed you that the majority of his staff members are volunteers who do not earn a salary whilst a few employees such as the accountant, and facilities manager who manages the facilities where the blankets are stored, are permanent employees who earn a salary every month. In addition to the background information provided at the beginning of the question, also consider information about Lung's operations provided elsewhere in the assignment. The Pago Q.3.1 Create a Class diagram that will show the planning for Lung's application. Ensure that your diagram shows 1. At least six (6) plausible classes 2. Any five (5) attributes with appropriate access specifiers, 3. Any five (5) instance methods with appropriate access specifiers; 4. Inheritance. does a light bulb collect energy?NEED HELP ASAP What does the blue man tell Eddie about haven? Why does Eddies feel so wonderfuland pain free? Solve the logarithmic equation... a 3-year old child arrives for an outpatient venipuncture clutching a very dirty doll. As you introduce yourseld, they hold it even tighter. Which of the following actions should you take? a table that links two tables that have a many-to-many relationship is often called a(n):a. entity-relationship table b. derived table c. foreign table d. derived relation e. intersection relation a chocolate chip cookie recipe uses 2 cups of sugar to make 24 cookies. how much sugar would you need to make 100 cookies? (round to nearest hundredth) if 16 bits are used to specify the address space of a memory, the memory has ______ uniquely identifiable locations What does -8mn + 9mn = What is the name of the town that brian and melissa are sent to in good morning christmas?. Will the following reaction result in a precipitate? If so, identify the precipitate. K3PO4 + Cr(NO3)+ 3 KNO3 + CrPO4 a. No, a precipitate will not form b. Yes, CrPO4 will precipitate c. Yes, KNO3 will precipitate Algebra 2 question. Gives 100 points. Please help. What's the dependent variable shown in the table? Which city established the first professional police force in the United States?A. New YorkB. BostonC. PhiladelphiaD. Albany Kimora drove with frankie to her mothers house which is 310 miles away. If it took them 6 hours, what was their average speed ? The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below: AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTCT CTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAGHow many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? a. two b. three c. four d. five you are managing a brand with low sales. awareness is at 20%, price is average, and satisfaction is high. what should you do? increase advertising. lower the price. reformulate the product. make no changes.