Need help ASAP. Due soon! Please and thank you:

The chemical equation for photosynthesis suggests that blowing on a glass of water placed in a sunbeam will produce glucose and oxygen. Compare the chemical equation to actual photosynthesis and explain why no reaction occurs. Explain your answer in 1–2 sentences

Answer:

Mid-Atlantic Ridge

Explanation:

This is because they are deep down, near the earth's crust .

Answer:

70 °C

Explanation:

Since heat lost by 200 g of water = heat gained by 100 g of water

-mc(T - T') = m'c(T - T")

where m = 200 g,T' = 90°C, m' = 100 g,T" = 30°C and T = final temperature of mixture, c = specific heat capacity of water = 4.2jkg-1 k-1​.

Substituting the values of the variables into the equation, we have

-mc(T - T') = m'c(T - T")

-200 g(T - 90 °C) = 100 g(T - 30 °C)

(T - 90 °C) = 100 g(T - 30 °C)/-200 g

(T - 90 °C) = -0.5(T - 30 °C)

T - 90 °C = -0.5T + 15 °C

collecting like terms, we have

T + 0.5T = 90 °C + 15 °C

1.5T = 105 °C

T = 105 °C/1,5

T = 70 °C

Specific and latent heat of water influence land-sea breeze systems by causing temperature differences, leading to air pressure changes and wind circulation.

The specific and latent heat of water play a vital role in the formation of land-sea breeze systems. During the day, land heats up faster than water due to its lower specific heat capacity, creating a temperature difference.

This results in a pressure gradient, causing air to flow from the sea to the land as a sea breeze.

At night, the land cools down faster, reversing the pressure gradient and creating a land breeze.

Latent heat released during condensation further contributes to temperature differences, affecting the strength and development of land-sea breezes.

For more such questions on influence, click on:

https://brainly.com/question/4390843

#SPJ11

The initial bundle (A) is represented by the consumption combination (A, I0) with an income of y. Consumer surplus and compensating variation are both concepts in microeconomics that relate to the study of consumer behavior.

The initial indifference curve (I0) is a curved line that slopes upward to the right, indicating that as the individual consumes more of the good, their preference for that good increases, but their preference for the other good remains constant.

The new indifference curve (I') is a curved line that slopes upward to the right, indicating that as the individual consumes more of the good, their preference for that good increases, but their preference for the other good remains constant.

The new indifference curve (I') is plotted on the any type of graph as a curved line starting from the origin, with the vertical axis representing wolf count and the horizontal axis representing income.

Learn more about consumption Visit: brainly.com/question/30155938

#SPJ11

Correct Question:

At the end of Chapter 5, Berck and Helfand find compensating variation (CV) and equivalent variation (EV) for wolves in Yellowstone Park - a publicly provided good. Assume wolves are a good to the individual whose preferences we are modeling, i.e., the individual wants more wolves in the wild, all else equal. Suppose there exists 5 wolves in Yellowstone Park, and the average individual has income of y. The individual's consumption bundle is A, and the initial indifference curve is I0. What is the difference between consumer surplus and compensating variation?

Answer: Sediment. Hope this helps :^)

Answer:

An actual computer virus is a malicious software, often known as malware, that can harm a computer and its users.

Virus hoaxes are false or misleading information about viruses that circulate through various communication channels.

They can be more dangerous than actual viruses due to their ability to spread quickly, cause panic, and undermine effective public health measures.

Virus hoaxes are deceptive messages or claims that often exaggerate the severity or impact of a particular virus. They can be spread through social media, email chains, or word of mouth. These hoaxes may include misinformation about symptoms, transmission methods, or false remedies, leading people to take ineffective or even harmful actions.

What makes virus hoaxes particularly dangerous is their potential to create panic and misinformation at a rapid pace. The viral nature of social media and other communication platforms allows these hoaxes to reach a wide audience within a short period. As a result, people may make decisions based on false information, such as avoiding necessary medical treatment, taking unnecessary precautions, or spreading fear and misinformation to others.

Moreover, virus hoaxes can undermine public health efforts by diverting attention and resources from legitimate preventive measures. They can erode trust in healthcare authorities and disrupt the dissemination of accurate information, making it harder for individuals to make informed decisions and follow recommended guidelines.

This can have severe consequences, especially during outbreaks or pandemics, where timely and accurate information is crucial for public safety. Therefore, it is essential to verify the credibility of information and rely on trusted sources to mitigate the risks associated with virus hoaxes.

Learn more about viruses :

https://brainly.com/question/29156932

#SPJ11

The full hydrogenation of unsaturated fats results in production of saturated fats.

Hydrogenation is defined as the artificial addition of hydrogen molecules to fats and oil substances in order to solidify it into saturated fats.

When fats are incompletely hydrogenated, it will lead to the formation of trans fats.

Trans fats are considered risky to consume as they are able to increase bad cholesterol in the blood.

Full hydrogenation of unsaturated fatty acids is defined as the complete hydrogenation of fatty acids such that saturated fatty acids are formed.

Saturated fatty acids are different from trans fats because they have the ability to increase both low density and high density lipoproteins in the blood.

Examples of foods that contain trans fat include:

Examples of foods that contain Saturated fats include the following:

Learn more about fatty acids here:

https://brainly.com/question/26353151

#SPJ1

Answer:

I want to say option D: right to review their medical records. Sorry if my answer is wrong

Right to review their medical records is not guaranteed to workers by the Occupational Safety and Health Administration Act. Hence option 4 is correct.

Health administration is defined as the administration of all non-clinical tasks necessary to run a healthcare facility, including daily management, staffing, budgeting, and financial management as well as long-term strategic planning to assure the success of the healthcare provider or system. With an MBA, students can get the knowledge and abilities necessary to succeed as business managers.

All employees are granted three essential rights under the Occupational Health and Safety Act: the right to information about health and safety issues. the right to take part in choices that can influence their health and safety. the ability to decline tasks that would endanger their health, safety, and the welfare of others.

Thus, right to review their medical records is not guaranteed to workers by the Occupational Safety and Health Administration Act. Hence option 4 is correct.

To learn more about health administration, refer to the link below:

https://brainly.com/question/17895647

#SPJ2

Spliceosome disruption by a substance would have an immediate effect on how mRNA is processed.

The precise elimination of introns from pre-mRNA by the spliceosome results in mature signals through pre-mRNA splicing (mRNA). The spliceosome is essential for cellular function, and incorrect pre-mRNA splicing causes disease. During spliceosome assembly, snRNPs and pre-mRNA interact in a certain order. The NTC is bound after U1 and U4 have been released from the spliceosome. After the two catalytic steps, the spliceosome was initially disassembled by releasing the mature mRNA, and it is subsequently destroyed. The third important RNA processing process that occurs in your cells is RNA splicing. The spliceosome, a protein and RNA complex, recognises and excises

(Which process would be directly affected by a substance that interferes with spliceosomes?mRNA processing

translation

replication

transcription)

Learn more about mRNA

https://brainly.com/question/12903143

#SPJ4

Answer:

Well to begin with, the thermal energy is mostly provided by the energy contained in warm water, when mixed with the other two components the chemical units are modified to form a composite solution that will result in an energy release, this energy release generate a movement, which in this case is the eruptive movement simulating the eruption of a volcano.

Explanation:

By mixing the vinegar (which is an acid) with the baking soda (which is a base), they react and transform into water, sodium acetate (a salt), and carbon dioxide (a gas). Carbon dioxide (CO2) is the gas that causes bubbles to form from the eruption of the volcano and balloons to swell.

Answer:

Ion-dipole forces are generated between polar water molecules and a sodium ion. The oxygen atom in the water molecule has a slight negative charge and is attracted to the positive sodium ion. These intermolecular ion-dipole forces are much weaker than covalent or ionic bonds.

The given statement "Avery et al. (1944) determined that DNA is the genetic material in T2 bacteriophage" is false. Avery et al. (1944) determined DNA is the genetic material in bacteria, not T2 bacteriophage.

The statement is false because Avery, MacLeod, and McCarty's 1944 experiment demonstrated that DNA is the genetic material in bacteria, specifically Streptococcus pneumoniae.

They showed that the transformation principle, which allowed non-virulent bacteria to become virulent, was due to the presence of DNA.

The discovery that DNA is the genetic material in the T2 bacteriophage was made by Hershey and Chase in their famous 1952 experiment using radioisotopes to track the transfer of genetic material.

They found that only DNA, and not protein, entered the bacterial host cell, confirming its role as genetic material.

For more such questions on bacteria , click on:

https://brainly.com/question/8695285

#SPJ11

(A) The answer to the initial value problem is given by \(\(y = (x^2 + 1)e^x\)\), where \(\(y' - y = 2xe^{2x}\)\) and \(\(y(0) = 1\)\).

(B) The resolution to the initial value problem can be expressed as \(\(y = \frac{2x - (\pi - 1)}{\sin(x)}\)\), where \(\(y' + \cot(x)y = 2\csc(x)\)\) and \(\(y\left(\frac{\pi}{2}\right) = 1\)\).

(A) To solve the initial value problem:

\(\[y' - y = 2xe^{2x}, \quad y(0) = 1\]\)

We can use an integrating factor method. To begin, let us express the equation in its standard form:

\(\[y' - y - 2xe^{2x} = 0\]\)

The integrating factor \(\(I(x)\)\) is given by \(\(I(x) = e^{\int -1 \, dx} = e^{-x}\)\).

To obtain the solution, apply the integrating factor to both sides of the equation and perform the multiplication.

\(\[e^{-x}(y' - y) - 2xe^{2x}e^{-x} = 0\]\)

This simplifies to:

\(\[e^{-x}y' - e^{-x}y - 2x = 0\]\)

Now, observe that the expression on the left-hand side represents the derivative of \(\((e^{-x}y)\)\) with respect to \(\(x\)\).

Using this observation, we can rewrite the equation as:

\(\[\frac{d}{dx}(e^{-x}y) - 2x = 0\]\)

Integrating both sides with respect to \(\(x\)\), we get:

\(\[e^{-x}y - \int 2x \, dx = C\]\)

where \(\(C\)\) is the constant of integration.

Integrating \(\(\int 2x \, dx\)\), we have:

\(\[e^{-x}y - x^2 + C = 0\]\)

To find the constant \(\(C\)\), we use the initial condition \(\(y(0) = 1\)\).

Substituting \(\(x = 0\)\) and \(\(y = 1\)\) into the equation, we get:

\(\[e^{0} \cdot 1 - 0^2 + C = 0\]\)

\(\[1 + C = 0\]\)

\(\[C = -1\]\)

Substituting \(\(C = -1\)\) back into the equation, we have:

\(\[e^{-x}y - x^2 - 1 = 0\]\)

Finally, we can solve for \(\(y\)\) by isolating it:

\(\[e^{-x}y = x^2 + 1\]\)

\(\[y = (x^2 + 1)e^x\]\)

(B) To solve the initial value problem:

\(\[y' + \cot(x)y = 2\csc(x), \quad y\left(\frac{\pi}{2}\right) = 1\]\)

We can use an integrating factor method. To begin, we will rewrite the equation in standard form:

\(\[y' + \cot(x)y - 2\csc(x) = 0\]\)

The integrating factor \(\(I(x)\)\) is given by:

\(\(I(x) = e^{\int \cot(x) \, dx} = e^{\ln(\sin(x))} = \sin(x)\).\)

Apply the integrating factor to both sides of the equation and perform the multiplication.

\(\[\sin(x)(y' + \cot(x)y) - 2\csc(x)\sin(x) = 0\]\)

This simplifies to:

\(\[\sin(x)y' + \cos(x)y - 2 = 0\]\)

Now, observe that the expression on the left-hand side represents the derivative of \(\((\sin(x)y)\)\) with respect to \(\(x\)\). Using this observation, we can rewrite the equation as:

\(\[\frac{d}{dx}(\sin(x)y) - 2 = 0\]\)

Integrating both sides with respect to \(\(x\)\), we get:

\(\[\sin(x)y -\)\(\int 2 \, dx = C\]\)

where \(\(C\)\) is the constant of integration. Integrating \(\(\int 2 \, dx\)\), we have:

\(\[\sin(x)y - 2x + C = 0\]\)

To find the constant \(\(C\)\), we use the initial condition \(\(y\left(\frac{\pi}{2}\right) = 1\).\)

Substituting \(\(x = \frac{\pi}{2}\)\) and \(\(y = 1\)\) into the equation, we get:

\(\[\sin\left(\frac{\pi}{2}\right) \cdot 1 - 2\left(\frac{\pi}{2}\right) + C = 0\]\)

\(\[1 - \pi + C = 0\]\)

\(\[C = \pi - 1\]\)

Substituting \(\(C = \pi - 1\)\) back into the equation, we have:

\(\[\sin(x)y - 2x + (\pi - 1) = 0\]\)

Finally, we can solve for \(\(y\)\) by isolating it:

\(\[\sin(x)y = 2x - (\pi - 1)\]\)

\(\[y = \frac{2x - (\pi - 1)}{\sin(x)}\]\)

\(\(y = \frac{2x - (\pi - 1)}{\sin(x)}\).\)

To learn more about initial value problem follow the link

https://brainly.com/question/30503609

#SPJ4

The complete question is:

Find The Solution Of The Given Initial Value Problem:

(A) \(\(y' - y = 2xe^{2x}\)\), and \(\(y(0) = 1\)\)

(B) \(\(y' + \cot(x)y = 2\csc(x)\)\), and \(\(y\left(\frac{\pi}{2}\right) = 1\)\)

Metabolic regulation of PDH is important for controlling metabolic flux through the citrate cycle because PDH is the key regulatory enzyme that controls the entry of pyruvate into the citrate cycle.

The citrate cycle is a central metabolic pathway that generates ATP and precursor molecules for biosynthesis. However, it is also a highly regulated pathway because an imbalance in its activity can lead to the accumulation of toxic intermediates and energy wastage. Therefore, it is essential to tightly regulate the flux through the citrate cycle to maintain metabolic homeostasis.
PDH is regulated by several factors, including phosphorylation, allosteric regulation, and substrate availability. Phosphorylation of PDH by PDH kinase inhibits its activity, while dephosphorylation by PDH phosphatase activates it. Allosteric regulation of PDH by citrate, ATP, and NADH also affects its activity.

To know more about pyruvate dehydrogenase:

https://brainly.com/question/29312833

#SPJ11

Indicator species are organisms that are particularly sensitive to changes in their environment and can be used to assess the health of an ecosystem. In water, indicator species can be used to assess pollution levels.

For example, certain species of fish and macroinvertebrates are known to be sensitive to changes in water quality, such as changes in pH or dissolved oxygen levels. If these species are found in low numbers or absent from a water body, it may indicate that the water quality is poor due to pollution.

Similarly, changes in the abundance or diversity of aquatic plants can also indicate changes in water quality. Some species of plants may be more tolerant to pollution than others and their presence or absence can give an indication of the pollution levels.

By monitoring the presence and abundance of indicator species, scientists can assess the impact of pollution on aquatic ecosystems and make informed decisions about strategies for reducing pollution and restoring the health of the ecosystem.

To learn more about species refer to:

brainly.com/question/30766242

#SPJ4

Answer:

Anaphase

Explanation:

After anaphase, a cleavage furrow forms in the equatorial cortex in typical animal mitosis. To divide the two daughter cells, this furrow then progresses inwards.

The sister chromatids differentiate from each other in anaphase and are pulled toward opposite ends of the cell. The "glue" of protein that binds together the sister chromatids is broken down, causing them to separate. Each one now has a chromosome of its own. 

No, lysosomes are not the control center of the cell.

Lysosomes are membrane-bound organelles found in animal cells that contain hydrolytic enzymes involved in the breakdown of macromolecules and waste materials. They act as the "stomach" of the cell, digesting and recycling unwanted materials.

The nucleus is the control center of the cell, as it contains genetic material (DNA) that directs cell activity through the transcription and translation of genes.

The endoplasmic reticulum and Golgi apparatus are also involved in protein synthesis and transportation, while the mitochondria produce energy for the cell through cellular respiration. Each organelle in the cell has a specific function and works together to maintain the overall health and activity of the cell.

To know more about lysosomes, refer here:

https://brainly.com/question/31608740#

#SPJ11

The anterior direction is the most common location in which the shoulder commonly dislocates, which means option A is the right answer.

Anterior dislocation is the most common shoulder dislocation which is caused due to the arm being positioned in an excessive amount of abduction and external rotation. Shoulder dislocation refers to the injury in the shoulder which is caused due to the displacement of the arm bone out of the ball and socket joint. It can cause high swelling and pain in the region. The displacement of bone can be fixed through some physical treatments such as splinting, and surgery, along with medications which is used to provide relief from the pain. Anterior shoulder dislocation can cause direct trauma/ compression to the axillary nerve.

Learn more about dislocation at:

brainly.com/question/30708693

#SPJ4

Answer:

GACCAAAUGGUAGCUAACUUUUGCAAUUUAGGUCAAAGGUA

Explanation:

I assume you want to transcribe the DNA sequence into mRNA. To do that, you need to replace each T with a U and keep the other bases the same. The mRNA sequence would be:

GACCAAAUGGUAGCUAACUUUUGCAAUUUAGGUCAAAGGUA

Congratulations, you have just performed transcription, the process of copying a segment of DNA into RNA. You have also created a messenger RNA (mRNA) molecule, which can encode a protein. But don't get too excited, because your mRNA is not ready for translation yet. You still need to process it by adding a 5' cap and a poly-A tail, and splicing out any introns. And even then, you might not get the protein you want, because there are many factors that affect gene expression, such as transcription factors, RNA interference, and epigenetic modifications. So don't think that transcription is a piece of cake. It's actually a complex and highly regulated process that involves many enzymes and molecules. But hey, at least you got the first step right!

The anatomical description that is true of the parasympathetic division of the autonomic nervous system is that it has short preganglionic fibers and long postganglionic fibers.

The parasympathetic division of the autonomic nervous system is responsible for the body's "rest and digest" response. It is activated during times of relaxation and is involved in functions such as digestion, urination, and sexual arousal. The parasympathetic nervous system has a distinct anatomical organization, with the preganglionic fibers originating from the brainstem or sacral region of the spinal cord and synapsing with postganglionic fibers located within or near the target organs. The preganglionic fibers are relatively short and release the neurotransmitter acetylcholine, which binds to nicotinic receptors on the postganglionic fibers. The postganglionic fibers are long and release the neurotransmitter acetylcholine, which binds to muscarinic receptors on the target organ cells. This anatomy allows for precise and localized control of organ function.

Learn more about preganglionic fibers here:

https://brainly.com/question/30320925

#SPJ11

Answer:

Negative feedback control

Answer:

Yeast cells are eukaryotic which means that they have a membrane-bound nucleus that holds their genetic information.

Eukaryotic cells also contain membrane-bound organelles such as:

It also means that their cellular complexity is different from Prokaryotic organisms which lack membrane-bound structures for example the nucleus. Prokaryotic cells are mostly small and simple and Eukaryotic cells are typically a lot bigger and more complex.

Examples of other Eukaryotic cells:

You can learn more about Eukaryotic cells here:

https://brainly.com/question/20112378

Answer:

a

Explanation:

Paleontology is the study of the history of life on Earth as based on fossils. Fossils are the remains of plants, animals, fungi, bacteria, and single-celled living things that have been replaced by rock material or impressions of organisms preserved in rock.]

When oxygen is bound to hemoglobin, it occurs in arterial blood, and it does not prevent the binding of carbon dioxide. Multiple oxygens can bind to the same hemoglobin molecule, allowing for efficient oxygen transport in the blood.

When oxygen is bound to hemoglobin in the blood, it occurs in arterial blood, which carries oxygen-rich blood from the heart to the body's tissues. This binding of oxygen to hemoglobin happens in the lungs, where oxygen from inhaled air diffuses into the blood and attaches to hemoglobin molecules in red blood cells.
However, this binding of oxygen to hemoglobin does not prevent carbon dioxide (CO2) from being bound to hemoglobin. CO2 can bind to a different spot on the hemoglobin molecule, forming a compound called carbaminohemoglobin. This allows for the transportation of both oxygen and carbon dioxide in the blood.
In addition, each hemoglobin molecule can bind up to four oxygen molecules. So, in a fully oxygenated state, there can be four oxygens bound to a single hemoglobin molecule. This allows for efficient oxygen delivery to the body's tissues.
In summary, when oxygen is bound to hemoglobin, it occurs in arterial blood, and it does not prevent the binding of carbon dioxide. Multiple oxygens can bind to the same hemoglobin molecule, allowing for efficient oxygen transport in the blood.

To know more about hemoglobin visit:

https://brainly.com/question/31765840

#SPJ11

The WISC-IV (Wechsler Intelligence Scale for Children, 4th edition) would be the best-suited test for an 8-year-old child.

WAIS-IV: This test is designed for individuals aged 16 to 90 years and is not appropriate for an 8-year-old child.

MBTI: This test is not suitable for children as it assesses personality type and requires a certain level of self-awareness and cognitive maturity that an 8-year-old child may not possess.

DSM-IVR: This is not a test but rather a diagnostic manual used by mental health professionals to classify and diagnose mental disorders.

WISC-IV: This test is specifically designed for children between the ages of 6 and 16 and measures cognitive abilities such as intelligence, reasoning, and problem-solving skills. It is age-appropriate and provides a comprehensive assessment of a child's intellectual functioning.

In conclusion, the WISC-IV is the most appropriate test for assessing the cognitive abilities of an 8-year-old child. The results can help parents and teachers to tailor their approach to the child's learning and development needs.

To learn more about WISC-IV, visit
https://brainly.com/question/14595782

#SPJ11

Answer:

1) Prophase: chromatin into chromosomes, the nuclear envelope break down, chromosomes attach to spindle fibres by their centromeres 2) Metaphase: chromosomes line up along the metaphase plate (centre of the cell) 3) Anaphase: sister chromatids are pulled to opposite poles of the cell 4) Telophase: nuclear

(◠‿・)—☆

Having a shock-absorbing skull causes the dissipation of head kinetic energy, which means woodpeckers have to work more to drill into the trunk of a tree.

The front of a woodpecker's skull is made of spongy bone as an adaptation to absorb or disperse shocks from its pecks, safeguarding its soft brains.

A woodpecker's skull is made up of bones that protect the brain and prevent concussions.

But having a shock-absorbing skull is a disadvantage for woodpeckers because it dissipates the kinetic energy in the head, due to which they have to work more to drill into the trunk of a tree.

Learn more about woodpeckers, here:

https://brainly.com/question/12830367

#SPJ1

Answer: they consist of sugar molecules in RNA or you could define it as the deoxyribose that consists in DNA

Explanation: my answer be original

CAN I PLEASE HAVE BRAINLIEST

The theory of inheritance that would best describe this type of outcome is Mendelian genetics. This is because the number of petals in the offspring is a clear example of a single-gene trait that is inherited from each parent. The parent flowers had different numbers of petals, but the offspring inherited one allele for petal number from each parent. In this case, the alleles for 10 petals and 6 petals were both dominant, resulting in the offspring having 8 petals. This follows the principles of Mendelian genetics, which state that traits are inherited in a predictable manner through the transmission of genes from one generation to the next. Therefore, the offspring having 8 petals is a result of the combination of genetic information from the parent flowers in a way that is consistent with Mendelian inheritance.

The best theory of inheritance to describe the outcome of a flower with 10 petals reproducing with a flower that has 6 petals, and their offspring having 8 petals, is Mendelian genetics.

Mendelian genetics is based on the principles discovered by Gregor Mendel, who studied the inheritance of traits in pea plants. This theory proposes that traits are inherited as discrete units, called genes, and follow specific patterns of inheritance.
In this case, the parent flowers may have different alleles (forms of a gene) for the number of petals. One might have an allele for 10 petals (A) and the other for 6 petals (a). If both parents are heterozygous (Aa) for the trait, they could produce offspring with 8 petals, which would be an intermediate phenotype. This outcome suggests that the alleles exhibit incomplete dominance, where the heterozygous offspring show a phenotype that is a blend of the parental traits.
So, Mendelian genetics best explains this type of outcome, with the specific mechanism being incomplete dominance.

To know about Mendelian inheritance visit

https://brainly.com/question/29526798

SPJ11

Option D is correct. Mendelian genetics theory of inheritance would be the best that describe this type of outcome.

The foundation of Mendelian genetics, commonly referred to as classical genetics, are the theories put out by Gregor Mendel. Mendel's rules state that genes, which are discrete heritable units that are transmitted from parents to offspring, are what determine traits.

Each gene can have several alleles, and during gamete production, these alleles segregate and assort independently. The characteristic (number of petals) of the flower petals in this instance seems to follow a straightforward Mendelian pattern.

There may be separate alleles for petal number as evidenced by the presence of 10 petals in one parent and 6 petals in the other parent. The offspring of these parents inherit one allele from each parent during reproduction, leading to the observable phenotype of eight petals.

Learn more about Mendelian genetics

https://brainly.com/question/30164819

#SPJ4

Complete question

A flower with 10 petals reproduces with a flower that has 6 petals. The offspring each have 8 petals. Which of the theories of inheritance would best describe this type of outcome?

A. Acquired characteristics

B. Blending

C. True Breeding

D. Mendelian genetics