What are causes of food security? Which one is the main one?
Answer:Causes for food security
Unemployment can also negatively affect a household's food security status. High unemployment rates among low-income populations make it more difficult to meet basic household food needs.
Food Insecurity
Economic Stability.
Education.
Health and Health Care.
Neighborhood and Built Environment.
Social and Community Context.
Explanation: i DIO! would like brainly for this answer
THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE
How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude
When a lake freezes over. How does the energy content of the lake change?
Answer:
Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies
Origin: lateral third of clavicle, acromion, and spine of scapula. Action: abduction, flexion and extension, medial and lateral rotation of arm * Deltoid Infraspinatus Supraspinatus Subscapularis
Answer:
The correct answer is - Deltoid
Explanation:
Deltoid muscles are thick triangular muscles that help in raising and rotating arm covers shoulder joints. It originates lateral third of the clavicle, inferiorly along the spine of the scapula to the acromion.
Deltoid muscles provide actions that include flexion and medial rotation, abduction, and extension, and lateral rotation at the shoulder joint. Deltoid means triangle or that has three sides as it has three originating sides.
In uncompetitive inhibition, data plotted on a Lineweaver-Burk plot demonstrate that... (select all that apply) Multiple answers: You can select more than one option A. the KM is different. B. the Vmax is different. C. the x-intercept is the same. D. the y-intercept is different E. The slope is different
In uncompetitive inhibition, data plotted on a Lineweaver-Burk plot demonstrate that:
A. The KM is different.
C. The x-intercept is the same.
E. The slope is different.
A. In uncompetitive inhibition, the KM value, which represents the substrate concentration at which the reaction rate is half of Vmax, is different from that of the uninhibited reaction. The KM value is decreased in the presence of an uncompetitive inhibitor.
C. The x-intercept of the Lineweaver-Burk plot, which represents -1/KM, remains the same in uncompetitive inhibition. It indicates that the affinity of the enzyme for the substrate is unchanged.
E. The slope of the Lineweaver-Burk plot is different in the presence of an uncompetitive inhibitor. The slope is steeper compared to the uninhibited reaction, indicating a change in the reaction kinetics.
Therefore, options A, C, and E are the correct choices. The Vmax (option B) and y-intercept (option D) are not affected by uncompetitive inhibition.
Learn more about uncompetitive inhibition from the given link:
https://brainly.com/question/30325095
#SPJ11
somebody help. . can someone please tell me the types of layering in root establishment in plants?.
Answer:
Layering can be used to multiply many of your favorite plants now growing around your yard and in your home. There are six common types of layering: air, simple, tip, trench, serpentine and mound. Air and simple layering are the most popular types
Explanation:
PLZ MARK AS BRAINLIEST
Answer:
The answer above me is correct
t. ahmed and m.j. semmens, use of transverse flow hollow fibers for bubbleless membrane aeration, water res., 30 (1996) 440446.
Ahmed, T., & Semmens, M.J. (1996). Use of Transverse Flow Hollow Fibers for Bubbleless Membrane Aeration. Water Research, 30, 440-446.
In the citation, the authors' names are listed in the order of last name followed by initials. The title of the research paper is enclosed in quotation marks. The journal name, Water Research, is written in italics or underlined.
The volume number, 30, is written in regular font, followed by the page numbers where the article can be found, 440-446. The citation includes the year of publication, 1996, in parentheses after the authors' names. This format follows the guidelines of the American Psychological Association (APA) citation style, which is commonly used in scientific and academic writing to provide accurate and consistent references for research papers.
learn more about Water here
https://brainly.com/question/28465561
#SPJ11
The complete question is
The proper citation format for the research paper titled "Use of Transverse Flow Hollow Fibers for Bubbleless Membrane Aeration" by T. Ahmed and M.J. Semmens, published in Water Research, volume 30 (1996), pages 440-446
You rush through your lab activity and obtain a percent error of 50 percent. Why might your percent error be so high?
Explanation: Can you be more specific with that plz?
To drive sales you need to understand the purchase process in detail. This is not merely a recitation of our lecture or the text, but application of that information to a particular purchase situation. How does the consumer behavior process apply to a customer and what are the specific influences that might or actually come into play
The consumer behavior process involves need recognition, information search, evaluation, purchase decision, and post-purchase evaluation.
The consumer behavior process consists of several stages. Firstly, customers recognize a need or desire for a product/service. They then conduct an information search, gathering details from various sources. Next, they evaluate alternatives based on features, benefits, and value. Once a decision is made, customers proceed with the purchase.
Finally, they assess their satisfaction with the chosen product/service, which influences future behavior. Influences on consumer behavior include personal factors like demographics and lifestyle, social factors such as culture and reference groups, psychological factors like perception and motivation, and marketing strategies that shape perceptions and influence decision-making. Understanding these influences helps businesses drive sales effectively.
To learn more about consumer follow the link:
https://brainly.com/question/31830842
#SPJ4
how is a gummy bear similar to a membrane
Answer:
Osmosis and diffusion are both forms of passive transport because they require no energy. Gummy Bears are made up of gelatin, starch and sugar. The gelatin acts like a semi-permeable membrane. Inside the membrane the gummy bear is full of starch and sugar (mostly sugar).
Explanation:
*giving brainiest to correct answer+ thank you+5 stars*
The total energy available in a food web..
A b or c??
Answer: the answer is b!
How does air pollution affect the ecosystem?
Answer:
The deposition of acidifying air pollutants causes acidification of surface waters (lakes, rivers and streams) and forest soils, leading to loss of nutrients such as potassium and magnesium from soils and the release of toxic aluminium into soils and waters, resulting in adverse effects on animals and plants.
Explanation:
mccabe and castel conducted experiments to assess whether a brain image influenced the way students perceived the quality of a scientific article. when other experimenters attempted to replicate the results of the study, they found ________.
When other experimenter's attempted to replicate the results of the study, they found that the images of the brain did not influenced the way students perceived the quality of a scientific article.
McCabe and Castle Experiment-
McCabe and Castle wrote three scientific article. He wanted to check whether the same area of the brain is active for both the TV and Arithmetic processes. One article contained brain images, other contained bar graph and last one had no illustration in it.
He asked 156 college students to read that article and asked them to rate how much they sense scientifically. The article was rated by the students based on the accuracy, quality and title.
The main reason for this hypothesis was the students should rate the article with brain image higher than that of one with bar graph and no illustration in it.
They concluded from their study that, the students rated the scientific articles higher when it contained brain images.
When other researchers tried to replicate the same experiment they found that there was no effect on people's judgement due to presence of the brain images.
Therefore, the answer is the brain images did not influenced the people's opinion.
To know more about McCabbe and Castle Experiment :
https://brainly.com/question/21692385
#SPJ12
Directions
Somebody Wanted But So Then (Summarizing Strategy) - Mr. Cook's Corner
Use bullet points to fill in each section of the chart for the short story The Man to
Send Rain Clouds.
Read: "The Man to Send Rain Clouds" 5,6 minimum sentences
Somebody:
Wanted:
But:
So:
Then:
Answer:
Somebody: Old Teofilo, a Native American man
Wanted: To have a traditional Native American burial ceremony
But: His family members were unsure of how to fulfill his wishes as they were living in a predominantly Catholic community
So: They decided to combine their Catholic beliefs with Native American traditions and perform a unique burial ceremony that incorporated elements from both cultures
Then: The family members painted Teofilo's face with red ocher, placed him on a traditional blanket, and covered him with cornmeal. They also sprinkled holy water and recited Catholic prayers, symbolizing their faith. Finally, they sent rain clouds by burning a feather and letting the ashes rise into the sky, fulfilling Teofilo's desire for rain.
Overall, the family successfully honored Teofilo's wishes and found a way to reconcile their cultural and religious identities in the process.
Explanation:
WILL AWARD 70 points help ASAPPP
Which of the following is released from ATP and therefore provides “energy”?
A) water
B) Pi
C) glucose
D) ADP and Pi
E) ADP only
Pi or inorganic phosphate is released from ATP and therefore provides energy.
What is ATP?It is the energy-carrying molecule found in the cells of all the living things. It is a nucleotide, which comprises three main parts, that is,
The nitrogenous baseAdenineRibose sugarA chain of three phosphate groups combined to riboseThe tail of phosphate is the actual source of energy, which is tapped by the cell. The accessible energy is present within the bonds between the phosphates and is discharged when the bonds are dissociated. It takes place via the supplementation of a water molecule, the process known as hydrolysis.
Generally, only the outer phosphate is withdrawn from the ATP to produce energy, when this takes place ATP get transformed to ADP or adenosine diphosphate.
Thus, the correct answer is option B, that is, Pi.
Find out more information about ATP here:
https://brainly.com/question/14376435
Which of the following is an example of an anabolic reaction?
a. Hydrogen peroxide (H₂O₂) being broken down into water (H₂O)
and oxygen (O₂)
b. Glucose being used by the mitochondrion to create ATP
c. The chemical processes of food digestion
d. Carbon dioxide (CO₂) and water (H₂O) combined to form glucose
d. Carbon dioxide (CO₂) and water (H₂O) combined to form glucose is an example of an anabolic reaction. Anabolic reactions are those that build up complex molecules from simpler ones, while catabolic reactions break down complex molecules into simpler ones. In this case, glucose is a complex molecule that is being built up from simpler molecules (CO₂ and H₂O).
At the time that Yellowstone National Park was created, there was a crucial factor that the park managers did not fully understand. What was that factor?
Answer:
How the organisms depended on each other
Explanation:
there are some ways that savannas and temperate grasslands are similar and some ways that they are different. Explain the similarities and differences between the two on the lines below.
1. Temperate grassland and savanna have grasses as the predominant plant form.
2. Both temperate grassland and savanna mostly have animals that feed on grass [grazer] as the primary consumers.
Also, the two vegetation are prone to fire incident and both have been impacted by agriculture.
1. Temperate grassland and savanna have grasses as the predominant plant form.
2. Both temperate grassland and savanna mostly have animals that feed on grass [grazer] as the primary consumers.
Also, the two vegetation are prone to fire incidents and both have been impacted by agriculture.
A triglyceride is a type of lipid that stores energy for the body. What aspect of a triglyceride molecule's structure helps it fulfill this role?
OA. Its highly branched structure helps the molecule spread its carbon bonds over a large area.
OB. It contains two hydrocarbon chains that repel water and a phosphate group that attracts water.
OC. It contains many phosphate groups, five-carbon sugars, and nitrogen-containing bases in a long chain.
OD. Its unbranched structure helps the molecule pack many chemical bonds into a compact space.
Answer: D. Its unbranched structure helps the molecule pack many chemical bonds into a compact space.
Explanation: A triglyceride molecule consists of three fatty acid chains that are each attached to a glycerol molecule. The fatty acid chains are long, unbranched hydrocarbon chains that are nonpolar and insoluble in water. The three fatty acid chains are joined to the glycerol molecule by ester bonds, which are high-energy bonds that can be broken to release energy when needed. The unbranched structure of the fatty acid chains allows them to pack tightly together, which increases the number of chemical bonds that can be stored in a small space. This compact packing of chemical bonds is what makes triglycerides an efficient way to store large amounts of energy in a small space.
plz don't just take my pons help me if u take my ponts i will report u
Answer: how am I supposed to answer this.
plant life cycle. animal life cycle.
flower larva, pupa, egg, and spore
fruit
seed
Explanation:
Which is not a stage of cellular respiration?
A) glycolysis
B) Krebs cycle
C) electron transport chain
D) Lactic and fermentation
Answer:
d?
Explanation:
choline is also a component of , compounds that make up cell membranes. one example of this type of compound is , which is often used as a food additive. Exceeding choline's UL of 3.5 g/d may lead to a fishy body odor and low blood pressure.
Additionally, phospholipids, which make up cell membranes, include choline. Lecithin, a substance that is frequently used as a food additive, is an illustration of this kind of substance.
What is the purpose of choline?A vitamin called choline can be found in a variety of meals. It regulates memory, mood, muscular control, and other activities in your brain and neurological system. Choline is also necessary for forming the membranes that enclose the cells in your body.
Which of the following elements plays a crucial role in the transfer of fatty acids?Carnitine, The growth of mealworms depends on carnitine. The transport of fatty acids from the bloodstream to the active sites of fatty acid oxidation within muscle cells is a key function of carnitine in all living things.
To more about Choline visit:-
https://brainly.com/question/29111383
#SPJ4
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
. If energy is the ability to cause change, then what evidence is there that energy is produced in the interaction between the wind and the blades of the wind turbine?
Answer:
Explanation:
Wind is considered to be kinetic energy. As the kinetic energy of the wind hits the fans of the wind turbine it causes the fans to spin. This then causes the blades to spin a rotor which is connected to the main shaft of the turbine itself. This rotor spins and generates electricity. Therefore, the kinetic energy that was initially introduced into the system goes through a process and gets converted into electrical energy which we can use.
______ is an increasingly popular method of specifically treating organic waste such as food and yard waste.
Composting is an increasingly popular method of specifically treating organic waste such as food and yard waste.
Composting is a natural process that involves the decomposition of organic materials, such as food scraps, yard waste, and other biodegradable materials, into a nutrient-rich soil amendment called compost.
It is an environmentally friendly and sustainable method of managing organic waste.
During the composting process, organic waste is collected and placed in a composting system, such as a compost bin or pile. The waste is then broken down by microorganisms, such as bacteria, fungi, and worms, in the presence of oxygen.
These microorganisms break down the organic matter, converting it into humus, a dark and crumbly substance rich in nutrients.
Composting offers several benefits. Firstly, it helps divert organic waste from landfills, reducing greenhouse gas emissions and minimizing the environmental impact of waste disposal.
Secondly, compost can be used as a nutrient-rich soil amendment in gardening, landscaping, and agriculture, improving soil fertility, water retention, and plant growth.
Due to its numerous advantages and environmental benefits, composting has gained popularity as a method of specifically treating organic waste, including food scraps and yard waste. It is a sustainable solution that promotes waste reduction and resource conservation.
Learn more about organic matter here:
https://brainly.com/question/31228791
#SPJ11
Which of the following movements is not considered a fundamental movement of the wrist? a. flexion b. ulnar deviation c. radial deviation d. circumduction.
Circumduction is a movement that combines flexion, extension, abduction and adduction, and is not considered a fundamental movement of the wrist. The correct answer is d.
Flexion is the movement of bending the wrist, ulnar deviation is the movement of bending the wrist towards the small finger side of the hand, and radial deviation is the movement of bending the wrist towards the thumb side of the hand.
The movement that is not considered a fundamental movement of the wrist is circumduction.
The movement is often referred to as a combination of flexion, extension, radial deviation, and ulnar deviation of the wrist.Circumduction is a type of movement that happens at a synovial joint. A synovial joint is a joint that is surrounded by a synovial capsule filled with synovial fluid.
It's made up of 2 distinct movements, specifically flexion and extension. Flexion is the act of bending a joint, whereas extension is the act of straightening a joint. Additionally, the movement includes radial deviation and ulnar deviation of the wrist.Circumduction is often described as a combination of these 4 fundamental movements of the wrist.
However, the movement that is not considered a fundamental movement of the wrist is circumduction. It is a combination of other movements, such as flexion, extension, radial deviation, and ulnar deviation of the wrist, which results in a circular motion of the joint. The joint, as a result, performs a cone-shaped movement.
Learn more about wrist here:
brainly.com/question/27104471
#SMJ11
What kind of tissues may we find in: Larynx, trachea, alveoli, pharynx, lungs, bronchioles, bronchi, diaphragm, pleura.
Answer:
connective tissue
Explanation:
which is/are not involved in the construction of the basal transcription apparatus?
The factors that are not involved in the construction of the basal transcription apparatus are :
Optional general transcription factors andTranscriptional activator proteins Basal transcriptionBasal transcription involves the factors which are necessary for the proper functioning of the RNA polymerase at a transcription site in eukaryotes.the factors are basically a set of proteins such as TFIIA
Hence we can conclude that the factors that are not involved in the construction of the basal transcription apparatus are Optional general transcription factors and Transcriptional activator proteins.
Learn more about Basal transcription : https://brainly.com/question/1048150
Calculate the doubling time for
India with its growth rate of 1.13%.
Doubling time = 70/growth rate
A. 0.619 years
B. 619 years
C. 61.9 years
The doubling time for India at 1.13 growth rate is 0.619years
What is doubling time?The doubling time is the time it takes for a population to double in size/value. It is applied to population growth, inflation, resource extraction, consumption of goods, compound interest, and many other things that tend to grow over time.
Doubling time is given as 70/ percentage growth rate. The percentage growth rate is 1.13%.
Therefore the doubling time will be calculated as
doubling time = 70/1.13
doubling time= 0.619 years
therefore the doubling time for India is 0.619 years at a growth rate of 1.13%
learn more about doubling time from
https://brainly.com/question/13893164
#SPJ1
What is DNA is it a carbohydrate,protein,lipid,nucleic acid
Answer:
nucleic acid.
Explanation:
thanks me later
Which experimental approach(es) can be used to analyze the effect of ros on the lifespan of yeast?
Experimental approaches to analyze the effect of ROS on yeast lifespan include manipulating ROS levels and enhancing ROS scavenging capabilities, providing insights into the impact of ROS on longevity.
What are the Experimental Approaches to analyze the effect of ROS on the lifespan of yeast?Two experimental approaches that can be used to analyze the effect of ROS (Reactive Oxygen Species) on the lifespan of yeast are:
ROS Manipulation: This approach involves manipulating the levels of ROS within yeast cells by either increasing or decreasing ROS production or by enhancing the cellular defense mechanisms against ROS. The lifespan of yeast can then be measured and compared between the manipulated groups and control groups to assess the impact of ROS on lifespan.
ROS Scavenging: This approach focuses on the scavenging or removal of ROS from yeast cells using antioxidants or ROS-scavenging enzymes. By measuring the lifespan of yeast cells with enhanced ROS scavenging capabilities compared to control groups, the influence of ROS on lifespan can be determined.
Learn more about lifespan of yeast on:
https://brainly.com/question/14299642
#SPJ1