_____ morality is a moral decision-making strategy driven by potential rewards and punishments of the decision.

Answers

Answer 1

Consequentialist morality is a moral decision-making strategy driven by potential rewards and punishments of the decision.

Consequentialist morality, also known as teleological ethics, is an ethical framework that evaluates the morality of an action based on its consequences or outcomes. In this approach, the focus is on the overall outcome or end result, rather than the inherent nature of the action itself. Consequentialists believe that the rightness or wrongness of an action is determined by its consequences and the extent to which it maximizes overall happiness, well-being, or utility.

Consequentialist morality is often associated with the idea of maximizing rewards and minimizing punishments. Individuals who adopt this moral decision-making strategy consider the potential outcomes and consequences of their actions before making a moral choice. They weigh the expected benefits and drawbacks, and aim to make decisions that will lead to positive outcomes or avoid negative consequences. The potential rewards and punishments serve as motivational factors in guiding their moral judgments and actions.

Learn more about judgments here:

https://brainly.com/question/28344967

#SPJ11


Related Questions

in daily life, we see many cases of people who are caught misrepresenting things and who soon thereafter are excused and accepted by their contemporaries. how is this different in science? in daily life, we see many cases of people who are caught misrepresenting things and who soon thereafter are excused and accepted by their contemporaries. how is this different in science? a scientist who proposes a hypothesis that is eventually disproven is never allowed to be a scientist again. a scientist who makes a mistake is never allowed to be a scientist again. a scientist who lies in a scientific publication will suffer professional excommunication. a scientist who disagrees with current theory is never allowed to be a scientist again.

Answers

The correct answer to the given question about misrepresentation in science field is option C)  a scientist who lies in a scientific publication will suffer professional excommunication.

Scientists value honesty highly, thus a breach of it is difficult to justify. Thus scientist is exalted from the community. Excommunication is a type of ecclesiastical censure in which a person is barred from participating in a church's rituals or sacraments, receiving its rites or sacraments, and enjoying its rights, but not necessarily its membership. All Christian churches and denominations, in fact, all religious groups, must employ some form of exclusionary practice in their administration. Excommunication is a form of institutional religious censure used to cease or at least restrict the communion of a congregation member with other members of the religious institution who are in regular communion with one another. It is the intent of the institutional act to deny, suspend, or restrict membership in a religious society or to limit certain rights inside.

To learn more about scientist click here

brainly.com/question/17450573

#SPJ4

how sex and gender identity exist in the society​

Answers

Answer:

Gender identity is defined as a personal conception of oneself as male or female (or rarely, both or neither). This concept is intimately related to the concept of gender role, which is defined as the outward manifestations of personality that reflect the gender identity. Gender identity, in nearly all instances, is self-identified, as a result of a combination of inherent and extrinsic or environmental factors; gender role, on the other hand, is manifested within society by observable factors such as behavior and appearance. For example, if a person considers himself a male and is most comfortable referring to his personal gender in masculine terms, then his gender identity is male. However, his gender role is male only if he demonstrates typically male characteristics in behavior, dress, and/or mannerisms.

Explanation:

i hope this help u

Lana drew the diagram below to model asexual reproduction. Based on Lana's diagram, which statement explains the results of asexual reproduction? A. The offspring are not genetically identical to the parent, because each offspring receives only half of the chromosomes from a single parent. B. The offspring are not genetically identical to the parents, because two parents each contribute half of their chromosomes to each offspring. C. The offspring are genetically identical to the parent, because each offspring receives a complete copy of a single parent's chromosomes. D. The offspring are genetically identical to the parents, because two parents each contribute a complete copy of their chromosomes to each offspring.

Answers

Answer: B.

The offspring are genetically identical to the parent, because each offspring receives a complete copy of a single parent's chromosomes.

Explanation:

your welcome

why did hitler hate the jews?

Answers

Explanation:

According to historical records and research, Hitler's hatred for Jews was derived from his belief that they were responsible for the economic struggles of Germany and the loss of World War I. He also believed in a racist ideology that claimed Jews were a lower and inferior race that threatened the purity and strength of the Aryan race. Additionally, he saw Jews as a powerful and influential group that were corrupting German society, and he believed they were plotting against Germany and the Nazi regime. These beliefs eventually led to the persecution, torture, and genocide of millions of Jews during the Holocaust.

Hitler's antipathy for Jews was rooted in his racial ideology as well as his conviction that they were to blame for Germany's economic woes and its defeat in World War I.

Who is Hitler?

Additionally, he believed that Jews had corrupted German society and were planning to overthrow the country and the Nazis, which resulted in the persecution, torture, and mass murder of hundreds of thousands of Jews during the Holocaust.

He held them accountable for the nation's high jobless rate. Hitler favored eradicating all Jews. In Germany, Hitler made them the targets of hatred. In order to accomplish this, he created the impression that Jews were to blame for anything that went erroneous especially the Treaty of Versailles to the development of Communist rule in Germany. Obama even attributed the nation's employment to them.

Learn more about Hitler, here:

https://brainly.com/question/17661494

#SPJ2

how do investigators package dangerous sharp items

Answers

Answer:

Wrapping & Packing: Each article packaged separately and identified on outside of package. Place in cardboard box or paper bags, packed to prevent shifting of contents. Always use paper bags, never use plastic bags or containers that do not allow air flow. ..

Explanation:

i hope it helps to much i know this kinds because my father is an teacher

under the articles of confederation, how did the powers of the state government differ from that of the national government?​

Answers

Answer:

Under the Articles of Confederation, the powers of the state governments were much stronger than those of the national government. The national government, which was made up of a unicameral Congress, was primarily responsible for conducting foreign affairs and declaring war. However, it did not have the power to tax or regulate commerce, which were seen as the domain of the state governments. This led to a number of problems, including a lack of economic unity and the inability of the national government to effectively address national issues. As a result, the Articles of Confederation were eventually replaced by the more powerful federal government established by the Constitution.

Archaeologists find pottery useful for (check all that apply): observing cultural changes filling gaps in ancient ruins establishing relative dates tracing trade routes

Answers

Archaeologists find pottery useful for the following purposes as mentioned below.

Observing cultural changes: Pottery can provide valuable insights into changes in cultural practices, artistic styles, and technological advancements over time. By examining the characteristics and styles of pottery from different periods, archaeologists can track and analyze cultural changes within a specific region or society.

Establishing relative dates: Pottery can be used as a relative dating tool. Archaeologists often rely on the principle of stratigraphy, which states that the deeper layers of an archaeological site are older than the upper layers. By analyzing the pottery found in different layers, archaeologists can establish a relative chronology, determining the sequence and order of the different occupation periods or cultural phases at a site.

Tracing trade routes: Pottery can provide evidence of ancient trade networks and interactions between different societies. Archaeologists can study the composition, style, and distribution of pottery to trace trade routes, identify exchange networks, and understand patterns of cultural exchange and contact between different regions or civilizations.

While pottery is valuable for these purposes, it is important to note that it is just one of many tools and artifacts that archaeologists use in their research. Multiple lines of evidence, including other artifacts, structures, and historical records, are often combined to develop a comprehensive understanding of the past.

To learn more about Archaeologists, here:

https://brainly.com/question/31720195

#SPJ11

Complete question:

Archaeologists find pottery useful for (check all that apply): observing cultural changes filling gaps in ancient ruins establishing relative dates tracing trade routes?

PLS HELP ASAP!!! I WILL GIVE BRAINLIEST!!!!

What causes us to see different moon phases throughout the month? *

1. Earth's revolution around the sun while the moon revolves around the Earth.
2. The moon disappearing and reappearing throughout the month.
3. The moon's orbit and our point of view from Earth as Earth rotates.
4. The amount of sunlight shining on the moon changes throughout the month.

Answers

Answer:

A) Earth's revolution around the sun while the moon revolves around the Earth.

Explanation:

The phases occur because the Sun lights different parts of the Moon as the Moon revolves around the Earth. That means the reason we see different phases of the Moon here on Earth is that we only see the parts of the Moon that are being lit up by the Sun.

Hope this helps!

All the love, Ya boi Fraser :)

Select the adjective to correctly complete this sentence.
The couch was
O comfortable
O comfortablest
O more comfortable
most comfortable
than the chair.

Select the adjective to correctly complete this sentence.The couch wasO comfortableO comfortablestO more

Answers

Answer:

the couch was more comfortable than the chair is the correct answer

Explanation:

More Comfortable

When you're comparing things you use more than/less than

This is true of the American electorate:
a. More Americans vote in off-year elections
B. 50% of the electorate votes during Presidents elections
c. 33% of the electorate votes during off-year elections
d. The 26th Amendment further expanded the electorate

Answers

Answer:

D

Explanation:

The 26th amendment gave everyone 18 years or older to vote which obviously expanded voters drastically

What type of gravity erosion is most dangerous to humans?​

Answers


TORRENT EROSION is the gravity erosion this most dangerous to humans. ex. landslides

Which event influenced the Mexican War of Independence?

Answers

In the early 19th century, Napoleon's occupation of Spain led to the outbreak of revolts all across Spanish America. Miguel Hidalgo y Costilla—“the father of Mexican independence”—launched the Mexican rebellion with his “Cry of Dolores,” and his populist army came close to capturing the Mexican capital.

IF CORRECTTTTTT I WILLLL MARKKKKKKK YOUUUUUUU BRAINLIST IF THE OPTION IS THERE

IF CORRECTTTTTT I WILLLL MARKKKKKKK YOUUUUUUU BRAINLIST IF THE OPTION IS THERE

Answers

Answer:

Its the second option

Explanation:

yep.

The Mopan Maya came to Belize around the year of ?

Answers

Answer:

in 1886

Explanation:

The Mopan Maya moved to Belize in 1886 from the Petén region of Guatemala to escape taxation and forced labour. Mopan Maya settlements are located in San Antonio village in Toledo District and there are also other villages in the Cayo District.

savage love! brainliest please?

Read the following poem:

The Eagle by Alfred Lord Tennyson



--------->He clasps the crag with crooked hands;
Close to the sun in lonely lands,<-------
Ring'd with the azure world, he stands.

The wrinkled sea beneath him crawls;
He watches from his mountain walls,
And like a thunderbolt he falls.

Which type of figurative language is used in the bolded lines?

Alliteration
Metaphor
Personification
Simile

Answers

Answer:

The type of figurative language used in the bolded lines is a metaphor.

After the attack on Pearl Harbor, President Franklin Delano Roosevelt proclaimed that “December 7, 1941, a date which will live in infamy the United States of America was suddenly and deliberately attacked by naval and air forces of the Empire of Japan.” What do you think was the significance of his speech?

After the attack on Pearl Harbor, President Franklin Delano Roosevelt proclaimed that December 7, 1941,

Answers

Answer: His speech means and why it's important, The bombing that happened was

to say that America was not expected this attack to happen because during the first years of World War 2, America wanted to stay out and not do anything about it until this attack happened and therefore after, is now involved. In conclusion, Franklin Delano Roosevelt really meant that this won't happen again, and we will be better next time.

Explanation:

Answer:

His speech means and why it's important, The bombing that happened was

to say that America was not expected this attack to happen because during the first years of World War 2, America wanted to stay out and not do anything about it until this attack happened and therefore after, is now involved. In conclusion, Franklin Delano Roosevelt really meant that this won't happen again, and we will be better next time.

Explanation:

corey teaches his students geometry by first explaining common geometry terms, then explaining geometry proofs, and finally using the terms to construct their own geometry proofs. this breakdown of a complex behavior is known as a. social facilitation. b. the matching law. c. partial reinforcement. d. chaining.

Answers

Terms to construct own geometry proofs breakdown of a complex behaviour is known as social facilitation.

Social facilitation is a mental idea connecting with the inclination for the presence of others to work on an individual's presentation on an errand. While this could appear as though a direct definition, it is really an exceptionally mind-boggling idea with numerous subtleties.

Theories on Social Facilitation

We've previously addressed the different speculations of social assistance; however we can survey these again here across the board place.

Initiation Hypothesis

This is the hypothesis proposed by Zajonc, which makes sense of social help as the aftereffect of excitement that is set off by the presence of others (or the apparent assessment of others).

Sharpness Theory

Connected with the Initiation Hypothesis is the Readiness Speculation, which suggests that you become more ready when you have onlookers and consequently perform better.

Assessment Worry Speculation

The Assessment Worry Speculation (or Assessment Approach) sets that the assessment of others matters as opposed to only their simple presence.

Self-Show Hypothesis

Self-Show Hypothesis states that individuals are roused to establish great connections with others and keep a positive mental self-view. All in all, your exhibition will possibly improve when you feel like the crowd is assessing you.

Social Direction Hypothesis

This hypothesis states that individuals with a positive direction to social circumstances will encounter social help, while those with a negative direction will encounter weakness.

Learn more about social facilitation here:

https://brainly.com/question/28083981

#SPJ4

what type of rights do citizens have?

Answers

Answer:

Right to a prompt, Fair trial by jury.Right to vote in elections for public officials. Right to apply for federal employment requiring U.S. citizenship.

    5. Right to run for elected office.                                                                    

In addition...

Speech, Religion, press, assembly, and the right to petition the government.

Explanation:

"We have any rights, but many are being taken too seriously and many aren't even being allowed based people's background, when it's supposedly a "free country"  from our background!"

               

         - roseyimari

Over the course of a night, polaris moves less than any other visible star in the sky.

a. true

b. false

Answers

Over the course of a night, polaris moves less than any other visible star in the sky is true.  The correct option is A.

Polaris, also known as the North Star or the Pole Star, is located very close to the North Celestial Pole. Due to its close proximity to the celestial pole, Polaris appears to move very little in the night sky compared to other stars. While other stars appear to rise and set as the Earth rotates on its axis, Polaris remains nearly stationary, making it a useful navigational reference point for finding the north direction. Therefore, the statement that Polaris moves less than any other visible star in the sky over the course of a night is true.

Thus, the ideal selection is option A.

Learn more about Polaris here:

https://brainly.com/question/30355236

#SPJ4

hi just answer this question for brainliest

hi just answer this question for brainliest

Answers

I do not understand the question may I have more to work with or is that it?

Answer:

It is telling you citizens elect the legislature branch and the legislature branch selects the executive branch

Which change occurs when lemon juice is mixed with water

Answers

Answer:

When you add lemon juice to water, the water changes color. Then, when you add sugar to the mixture and stir, the sugar dissolves and is no longer solid white. Lemonade is an example of a solution: a mixture of one or more substances dissolved evenly into another substance.

Explanation:

A second-grade teacher seats students in partners according to ability levels. Each pair receives one of three differentiated fictional texts. After they have had an opportunity to read the story, each pair completes the sentence stems below. Then, the teacher holds a whole group discussion in which the students share their findings. This story reminds me of a time when ___________. I felt like that character when ____________. If I were that character I would _____________. I am like_________(character name) because we both _________. If ___________ happened to me I would __________. These sentence stems prompt students to:

Answers

Answer:

Make text connections, specifically text to self connections: relate the fictional text with their own lives.

Explanation:

In the situation described in the exercise, the teacher asks the students to relate what they have read to their own lives. Making text connections help the students comprehend the texts better, and relate the texts to their own personal experiences could be helpful to get the students to connect with the stories.

What are healthy decisions?

Answers

People believe that in order to make healthy lifestyle changes, they need to have good intentions, perseverance, and willpower.

Living with any type of mental health challenge (Depression and Indecision) can make it challenging to make healthy decisions. Each of these factors, which have an impact on our decisions, is influenced by mental illness.

We rely on our logical, well-organized thought processes, emotionally stable states, and decisions that are supported by our actions to make healthy decisions. Making the Big Decisions When You Have Bipolar, however, can be challenging and overwhelming when mental illness is present. But despite this, people with mental health issues can still make decisions.

These are some strategies that many people have found to be effective for making healthy decisions.

To know more about healthy decisions here

https://brainly.com/question/27004710

#SPJ4

when someone dies, the people for whom that individual was a major source of reinforcement are essentially experiencing . a. classical conditioning b. intermittent reinforcement c. extinction d. habituation

Answers

When someone dies, the people who were majorly reinforced by that individual are essentially experiencing extinction. Extinction occurs when a previously reinforced behavior no longer results in reinforcement. In this case, the person who provided reinforcement (the deceased individual) is no longer present, so the reinforcement stops. The people who were previously reinforced by that individual will likely feel a sense of loss and sadness as a result of the lack of reinforcement.

This process can be difficult and painful, but it is a natural part of the grieving process. It is important to remember that people who are experiencing grief need support and understanding from those around them.it is essential to understand that extinction is a normal and natural process that occurs when a previously reinforced behavior is no longer reinforced. It can be difficult and painful, but it is an important part of the grieving process. The people who were reinforced by the deceased individual may need support and understanding as they navigate this process.

To know more about reinforcement visit -

brainly.com/question/25918932

#SPJ11

The Panama Canal crossword puzzle

Answers

Consider the development of the Panama Canal, tourism, and the cuisine and music of the Caribbean. This City Is The Atlantic Port For The Panama Canal's crossword puzzle clue has the most likely dictionary word and crossword puzzle definitions.

Why is the Panama Canal located where it is?

The idea of the Panama Canal dates back to 1513, when Vasco Núñez de Balboa first crossed the isthmus of Panama. The narrow land bridge between North and South America was a fine location to dig a water passage between the Atlantic and Pacific Oceans.

To know more about Panama Canal visit:

https://brainly.com/question/1309615

#SPJ1

What was the controversial part about the us role.in panama canal treaties?
a . the us did not include panama in the treaty negotiations.

b. the us tried to install its own government in panama so to control the outcome

c. the us threatened to abandon building a canal , which would hurt the panamanian economy.

d. the us threatened to invade panama if it did not agree to the treaties.

Answers

The controversial part about the US role in Panama Canal treaties was the fact that the US tried to install its own government in Panama in order to control the outcome. Hence, statement b explains the controversial part about the U.S. role in Panama canal treaties.

This move by the United States was seen as a violation of Panama's sovereignty and an attempt to dominate the country's political landscape. The US had a significant interest in the construction and control of the Panama Canal, as it would provide a faster and more efficient route for naval and commercial vessels between the Atlantic and Pacific Oceans. In order to achieve this, the US government engaged in actions that were perceived as imperialistic and intrusive by Panama and other countries.

As a result, the US involvement in the Panama Canal treaties became a contentious issue and led to diplomatic tensions between the two countries. It also raised concerns about the balance of power in the region and the role of powerful nations in determining the fate of smaller countries. These controversies highlighted the importance of respecting the sovereignty and self-determination of nations while engaging in international projects and agreements.

Know more about  Panama Canal here:

https://brainly.com/question/29739549

#SPJ11

Which steps are part of the process of choosing a topic for an informative essay?

Answers

Answer:

3

Explanation:

Answer:

Brainstorm: Start by brainstorming a list of topics that interest you or that you are knowledgeable about. You can use techniques like mind mapping, freewriting, or listing to generate ideas.

Research: Once you have a list of potential topics, conduct research to gather more information about each one. You can use online resources, books, journals, or any other sources that are relevant to your topic.

Evaluate: After researching, evaluate each topic based on its relevance, importance, and level of interest. Consider your target audience and the purpose of your essay while evaluating topics.

Narrow down: From the list of topics, narrow down your choices to a few that meet your criteria. You can also eliminate topics that are too broad or too narrow for the scope of your essay.

Refine: Once you have a shortlist of potential topics, refine them further by developing a thesis statement and an outline for each topic. This will help you determine which topic has the most potential for an informative essay.

Finalize: Finally, choose the topic that you are most passionate about and that aligns with your purpose and target audience. Make sure that the topic is feasible and has enough research material available for you to develop a well-written essay.

what is the government's response to the water scarcity in yemen?

Answers

Answer:One year on, the situation remains dire, particularly for Yemen, where the weaponization of water has brought the conflict to a critical stage in which the UN now estimates that 14 million people, or half of Yemen’s population, are facing “pre-famine” conditions. Water is one among several complex facets of the conflict and it remains difficult to determine the extent to which it has driven the violence. However, it is clear that for both sides, the struggle for access to water and control of its provision continues to be a strategic imperative, with the effect of mass civilian suffering.

Explanation:

pls mark brainliest

Answer:

One year on, the situation remains dire, particularly for Yemen, where the weaponization of water has brought the conflict to a critical stage in which the UN now estimates that 14 million people, or half of Yemen’s population, are facing “pre-famine” conditions. Water is one among several complex facets of the conflict and it remains difficult to determine the extent to which it has driven the violence. However, it is clear that for both sides, the struggle for access to water and control of its provision continues to be a strategic imperative, with the effect of mass civilian suffering.

...

What is a major factor in the decline of some occupations, such as those in the textiles and clothing industries?

A) shifting consumer tastes
B) overseas labor costs
C) changing technologies
D) aging populations
I think it's C but I don't know

Answers

Answer:

The answer is C you are correct

how might the spanish armada attempt to invade england have ended if a storm had not destroyed the spanish fleet

(please i need it quick!!)​

Answers

Any maritime or imperial ambitions that England and its future trading corporations may have then had would have most likely been destroyed by a Spanish Armada victory. There will be no British Empire, East India Company, or imperial colonization. Our current world would be radically different if this were the case.

A massive naval fleet of 130 ships known as the Spanish Armada was sent by Spain in 1588 with the intention of invading England. King Philip II of Spain organized the armada in an effort to depose Protestant Queen Elizabeth I and reinstate the Roman Catholic religion in England after years of conflicts between Spain and England. The "Invincible Armada" of Spain set sail that May, but it was outwitted by the English and pounded by storms as it made its way back to Spain with at least a third of its ships sunk or damaged.

One of the most important episodes of the Anglo-Spanish War was the annihilation of the Spanish Armada, which caused a surge of national pride in England.

Learn more about the History of Conquest here: https://brainly.com/question/544935

#SPJ9

Other Questions
5.0 mL of 1.0M NaOH solution is added to 200.0 mL of a 0.150M formate buffer at a pH of 4.10. Calculate the new pH after the NaOH has been added. pKa formic acid Match each standard form equation to its slope-intercept form :) Question 15 (1 point) (04.04 MC) What is the length of the line segment PQ on the coordinate grid? (1 point) Question 15 options: 1) 10 units 2) 20 units 3) 30 units 4) 40 units Please 10 points for one question Please dont answer if you dont know QUESTION 6Solve for a. (round to tenths)8a14 why is family life education essential for quality of life? Give reason. True or False. the accountant at zepha consulting works with the manager authorized to make purchases in order to steal cash from the company. this is an example of collusion. Transcribe the following dna strands into mrna strands: ATTCGACGTCGATAGCTAGG on the statement of cash flows, the payment of dividends to shareholders is a.a financing activity. b.an operating activity. c.an investing activity. d.not reported. HELPPP 24 points !!! How did the cotton mills revolutionize how Americans dress? Help plz. 3:5=____% If the points A, B, and C are clinear with B between A and C, and if AC = 21 and AB = 7, what is thelength of line segment BC?BC= Nicotine gets its "kick" from A) ephedrine B) caffeine C) tar D) epinephrine An experiment consists of selecting a card at random from a 52-card deck. Refer to this experiment and find the probability of the event. (Enter your answer as a fraction.) A red face card is not drawn___ A patient states, i cant catch my breath and the paramedic responds you say you cant catch youre breath maam? Greek gods were thought to be *A.polisB.tyrantsC. epics (long story or poem)D. immortal solve the Matrix. [tex]x - 4y + 5z = 10 \ 2x + y + z = 2 \ - 3x + 3y - 4z = 10[/tex] _____ knowledge is hard to measure and document and typically is not objective or formalized.a. Tacitb. Sharedc. Technicald. Explicit A computer that is part of the workgroup can exist on the same network but is not authorized to access the domain resources. True or false?. The value of S for the catalytic hydrogenation of acetylene to etheneC2H2 (g) + H2 (g) C2H4 (g)is ________ J/Kmol.