Medicine suited to a person’s individual genetic makeup is called _[ blank ]_. Which option correctly completes this sentence?
1. practiced medicine
2. personalized medicine
3. individual medicine
4. designer medicine

Answers

Answer 1

Medicine suited to a person’s individual genetic makeup is called personalized medicine, option 2.

What is personalized medicine?

Personalized medicine is a type of medical treatment that is tailored to an individual's specific genetic makeup and medical history. The goal of personalized medicine is to improve the effectiveness of treatments by taking into account the patient's unique biological characteristics and to reduce the risk of adverse side effects.

This approach involves using genetic testing and other diagnostic tools to better understand the patient's health and to design treatment plans that are specific to their needs.

Learn more on personalized medicine here: https://brainly.com/question/13049666

#SPJ1


Related Questions

A major influence on climate is?

Answers

Answer:

that's very broad, is that the whole question?

Answer:

A major influenece is the wide and used fossil fuels

what occurs when the body responds to the environment by maintaining a stable internal environment despite changing external conditions

Answers

Answer:Answer. Responding to the environment by maintaining a stable internal environment despite changing external conditions is known as Homeostasis.

Answer:

Homeostasis

Explanation:

Which of the following are textual elements that can be included in an analysis?
Group of answer choices

Motifs

Tone

Symbolism

Plot Summary

Answers

The textual elements which can be included in an analysis from the options above is plot summary.

Option D is the correct answer

What are textual elements?

Textual elements simply refers to those the visual qualities of the typeface itself and the shape of its design.

So therefore, the textual elements which can be included in an analysis from the options above is plot summary.

Option D is the correct answer

Learn more about textual elements:

https://brainly.com/question/4843543

#SPJ1

an introduction of a new food resource into the environment may cause a new species to appear. an introduction of a new species of predator may cause the evolution of new defenses in some prey species. a predator not eating a bright colored prey again because the previous time the taste was unpleasant. an increase in temperature may select against cold-adapted genotypes. an increase in a population of one species may case the extension of another species with the same food ration.

Answers

Examples that support my reasoning are:

An increase in temperature may select against cold-adapted genotypes.A predator not eating a bright colored prey again because the previous time the taste was unpleasant.An introduction of a new food resource into the environment may cause a new species to appear.An introduction of a new species of predator may cause the evolution of new defenses in some prey species.

The answer is A, B, D and E.

Evolution is the process by which species adapt to their environment in order to survive and reproduce. Changes in an organism’s environment can select for or against certain traits, which can lead to changes in the organism’s phenotype (visible characteristics) over time. These changes help the organism to survive and reproduce in its new environment.

Choose examples to support your reasoning. Select all that apply:

A) An increase in temperature may select against cold-adapted genotypes.

B) A predator not eating a bright colored prey again because the previous time the taste was unpleasant.

C) An increase in a population of one species may case the extension of another species with the same food ration.

D) An introduction of a new food resource into the environment may cause a new species to appear.

E) An introduction of a new species of predator may cause the evolution of new defenses in some prey species.

Learn more the Evolution:

https://brainly.com/question/27748371

#SPJ4

an introduction of a new food resource into the environment may cause a new species to appear. an introduction

To determine whether regulation of gene expression by short RNAs was a naturally occurring phenomenon, researchers isolated RNA from a cell and fractionated them by size to obtain only short RNAs. The next step was to clone these molecules.
Today the cloning step would not be required. Which of the techniques below is the best reason why?
A. Because a microarray could tell if the fragments were encoded by the genome.
B. Because a PCR reaction could tell if the fragments were encoded by the genome.
C. Because an RNA-seq reaction could tell if the fragments were encoded by the genome.
D. Because a yeast 2 hybrid could tell if the fragments were encoded by the genome.
E. Because a GFP fusion could tell if the fragments were encoded by the genome.

Answers

Answer:

C. Because an RNA-seq reaction could tell if the fragments were encoded by the genome.

Explanation:

The combination of single-cell RNA sequencing (RNA-Seq) and bioinformatic tools to assemble and annotate sequence reads is currently the most common methodology used to obtain complete transcriptomes from individual cells. RNA-seq is a Next-Generation Sequencing (NGS) technology that enables the analysis of the entire transcriptome, thereby this method can be used to examine gene, allelic and ncRNA expression. In the last years, RNA-seq has become the gold standard technique for direct analysis of ncRNA expression profiles in biological samples and clinical research.

In the experiment shown below, if the temperature of the room rose, what would happen to the time taken for the litmus paper to turn blue?

Answers

The time taken will be more for the litmus paper to change its color from red to blue.

What is the use of litmus paper?

An inspector can measure the acidity or basicity of a solution by using litmus paper, which turns red at pH levels below 5 and blue at pH levels above 8. Using litmus paper, which compares minute color variations to a color chart to identify pH levels, allows for more accurate pH determinations.

The rise in temperatures favors the acidic pH of the litmus paper. A solution's molecular vibrations increase as its temperature rises, which causes the solution to ionize and produce H+ ions. Acidic behavior increases with the amount of H+ ions. The pH level of the solution alters as a result of temperature variations. As a result, the pH drops as the temperature rises.

Hence, the litmus paper takes more time to turn blue in color due to the temperature rise.

Learn more about litmus paper from the given link.

https://brainly.com/question/10711114?referrer=searchResults

#SPJ10

The correct answer is it will take some more extra time for litmus paper to turn blue.

How pH affects with temperature?

pH decreases with increase in temperature.

• It means temperature and pH value both are inversely proportion.

• Neutral is 7. Less than 7 of pH value it is acidic and more than 7 then it implies it is basic.

•  To support our answer added one image for illustration below

From above table we can conclude as temperature grows pH value will decrease.

Hence, it will take some more time for litmus paper to turn blue.

To learn more about Litmus paper and Temperature from the given link

https://brainly.com/question/2467054

#SPJ10

In the experiment shown below, if the temperature of the room rose, what would happen to the time taken

Scenario: In poison dart frogs, the allele for red skin (R) is dominant over blue skin (r) and the allele for long toes (T) is dominant over short toes (t). You cross starting two pure-breeding lineages, one that has red skin and short toes and the other that has blue skin and long toes. You then cross one of the F1 frogs to a frog that has blue skin and short toes. What are the genotypes of the parental frogs? red skinned, short toes [ Select ] blue skinned, long toes [ Select ] What is the genotype of the F1 frog? [ Select ] What is the genotype of the mate of the F1

Answers

The genotype of the parents will be RRtt rrTT. The genotype of the F1 generation will be obtained by crossing their gametes.

What is a dihybrid cross?

A mating experiment involving different individuals that are equally hybrid for two characteristics is referred to as a dihybrid cross. A heterozygous organism is one that possesses two distinct alleles at a certain genetic location, making it a hybrid. Therefore, an organism that is heterozygous at two separate genetic loci is said to be dihybrid.

The Law for Independent Assortment, a key principle of genetics, was established by Gregor Mendel in 1865 while conducting dihybrid crosses on pea plants. Mendel started his research by crossing two homozygous parental organisms with two different characteristics. When two alleles at a certain genetic location are identical, an organism is homozygous for that characteristic.

Mendel decided to cross a pea plant with round (RR), yellow (YY), dominant seeds with a plant with wrinkled (RR), green (YY), and recessive, seeds. This cross is described by the following formulae:

RRYY x rryy

Therefore the genotype of the parents will be RRtt rrTT.

Read more about dihybrid cross, here

https://brainly.com/question/1185199

#SPJ1

List down the female reproductive organs. Describe any three
of them in short.

Answers

Answer:

uterus , ovaries , fallopian tubes.

Explanation:

True or False: Plants are major producers.

Answers

Answer: True

Explanation:

Plants are primary producers

:}

Answer: True

Explanation: The ultimate source of energy is the leaf

An amino acid's unique characteristics is defined by the ________.

Answers

an amino acids unique characteristics is defined by the R-group

Which learning process occurs when the same response happens in reaction to many similar stimuli? A. acquisition B. discrimination C. extinction D. generalization Please select the best answer from the choices provided A B C D

Answers

The learning process that occurs when the same response happens in reaction to many similar stimuli is option D: generalization.

Why is generalization important in learning?

It is significant because it enhances the possibility that the learner will be successful in completing a task without the help of a specific teacher or resources that are only available in one instructional environment. The value of skill generalization is frequently undervalued.

Therefore, The idea of generalization holds that if the conditions in the settings are deemed to be similar, humans and other animals can apply knowledge from the past to learning situations in the present.

Learn more about generalization from

https://brainly.com/question/12157094
#SPJ1

Answer:

the answer is generalization

Do patterns of heating and cooling result in ocean currents

Answers

Answer:

Patterns of heating and cooling result in ocean currents. Ocean currents have no effect on the climate of landmasses.

Explanation:

Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when you reach a stop codon (UGA, UAA, or UAG). Follow the example in the box. Abbreviate the proteins using the first three letters of the amino acid name.

Answers

Methionine (AUG)Amino acids can be abbreviated using the first three letters of their name.

Methionine can be abbreviated as Met.

The given RNA sequence is AUGUAACGAUGCGUCGUGGCAUCAUGCUGCGUCAGCGGCGAGUCUGACCCGUCUCUAACAGGACGGCCGGGCGUUGUCGUUGA.

We can use the codon chart to determine the amino acid sequence.

The codon chart is used to determine which amino acid is coded by a particular codon in a strand of DNA/RNA.A codon is a sequence of three nucleotides in DNA or RNA that encodes for a specific amino acid.

Each codon codes for a different amino acid.

For example, the codon AUG codes for the amino acid methionine.

To determine the amino acid sequence, we start reading the RNA strand from the start codon AUG and continue reading until we reach a stop codon (UGA, UAA, or UAG).

Then we write down the amino acid sequence for the codons we read, using the codon chart.

Here, the sequence starts with AUG, which codes for methionine.

After that, the next codon is UAA which is a stop codon, so we can stop.

The amino acid sequence is therefore Methionine. So, the answer would be Methionine (Met).

For more such questions on Methionine

https://brainly.com/question/29481268

#SPJ8

how are animal-based products contributing to Climate Change?

Answers

Answer:

Explanation:

Animal-based products, such as meat, dairy, and eggs, contribute to climate change in several ways. One major way is through the production of greenhouse gases, especially carbon dioxide, methane, and nitrous oxide. Animal agriculture is a significant source of these gases, with livestock and their manure producing methane, and fertilizer used to grow animal feed releasing nitrous oxide. Additionally, the production and transportation of animal-based products require significant amounts of energy, which often comes from fossil fuels, further contributing to greenhouse gas emissions. Finally, the deforestation and land-use changes associated with animal agriculture also release carbon dioxide and reduce the amount of carbon that can be sequestered by forests. All of these factors make animal-based products a significant contributor to climate change.

Explain the importance of using engine powered pump for irrigation works.​

Answers

Answer and Explanation:

Engine irrigation pumps are used to propel water into the irrigation channels, providing full water supply to agricultural crops. The use of the engine pump has advantages and disadvantages. Among the advantages, we can present the simplicity of operation of these pumps, being easily operated efficiently. They also save energy and are essential for irrigation with more viscous liquids, when necessary. This feature is the main reason for using this type of pump.

Among the disadvantages we can say that these pumps have a slower and less accurate work.

what are
two positive and two negative effects of land use by humans.

Answers

Answer: Positive:

1. Keep humans alive

2. Adequate food

Negative:

1. pollution

2. over population

Explanation:

How are the animals in the Kingdom Animalia classified? Your answer should include groupings from both traditional methods (based on morphology) as well as molecular phylogenies (based on genetics).

Answers

There are six additional tiers of classification for the creatures in the kingdom Animalia based on comparable traits. The phylum, class, order, family, genus, and species fall under this category.

What is meant by Kingdom Animalia?Members of the Kingdom Animalia, commonly known as the Metazoa, include all living things. The Kingdom Monera, which contains bacteria and blue-green algae, and protists do not exist in this one (Kingdom Protista, includes unicellular eukaryotic organisms).Kingdom Animalia is a taxonomic kingdom that includes both living and extinct animals. Eukaryotic, multicellular, heterotrophic, without a cell wall, and primarily motile organisms make up this kingdom's members. Non-chordates comprise the phyla Porifera, Coelenterata, Ctenophora, Platyhelminthes, Aschelminthes, Annelida, Arthropoda, Mollusca, Echinodermata, and Hemichordata. Non-Chordates have the following characteristics generally: These are cylinder-shaped, triploblastic, coelomate, or pseudocoelomate creatures.Fish, amphibians, reptiles, mammals, and birds make up the five common classes of the phylum chordata, or group of vertebrate creatures.

To learn more about Kingdom Animalia, refer to:

https://brainly.com/question/26907358

What proportion of offspring will be short and white?
A
9/16
В
3/16
c
1/16
D
4/16

What proportion of offspring will be short and white?A9/163/16 c1/16D4/16

Answers

Answer:

C

Explanation:

1/16 because all the other offsprings contain a dominant trait.

Of the four email features listed below, which is the most important?

A.
the To address
B.
the Bcc address
C.
the attachments
D.
the domain name

Answers

The most important email feature among the four listed is the To address. Therefore, the correct option is (A).

Of the four email features listed, it is subjective to determine which one is the most important as it depends on the context and purpose of the email. However, in general, the most important feature would be the To address (option A). The To address is essential because it specifies the intended recipient(s) of the email. Without a valid and accurate To address, the email may not reach the intended recipients, defeating the purpose of communication. It ensures that the message is directed to the right individuals or groups.While other features like the Bcc address, attachments, and domain name are also important, they serve different purposes. The Bcc address allows for discreet or blind copies to be sent, attachments provide additional information or files, and the domain name identifies the sender's organization or email service provider.Overall, the To address holds primary importance in ensuring effective and targeted communication within the email platform.

For more such questions on Email feature:

https://brainly.com/question/19545414

#SPJ8

Brown hair is dominant and blonde hair is recessive.

The parents have the following alleles.

Bb

Bb

What color hair do the parents have?

A. One has blonde and the other has brown

B. Brown

C. Blonde

d. unable to determine

Answers

Given what we know, we can confirm that the parents have brown hair.


Why do the parents have brown hair?

This has to do with how dominant alleles work. When an allele is dominant, it is because, in the presence of mixed alleles, this trait will always be the one reflected in the phenotype of the individual. Since the parents possess an allele for brown hair and one for blonde, but brown hair is dominant, both parents will have brown hair.

Therefore, we can confirm that both parents will have brown hair due to the dominant nature of the brown hair allele.

To learn more about genetics visit:
https://brainly.com/question/12985618?referrer=searchResults

Compared to the offspring of sexual reproduction in animals, the
þffspring of asexual reproduction will
A) show greater variety
B) be more resistant to disease
C) be genetically identical to the parent
D) grow larger

Answers

Answer:

C: Genetically identical.

Explanation:

Offspring are usually going to look like it's parents. Asexuals produce offspring that's supposed to look like them. I hope this helps :) and if it's wrong please know that I am very sorry for the mistake :(

Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.

Answers

Answer:

B.) Can lead to new species that share common ancestors

Explanation:

Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).

HELP HELP HELP!!!
Which BEST describes how the process identified in Part A changed the frequency of alleles?
A
Finches with mutations were unable to survive to reproductive age and did not produce offspring.
B
Finches that mated with individuals with desired traits were better able to survive to reproductive age.
С
Finches that were able to change their genotype to match the environment were most likely to survive.
D
Finches with traits better suited for survival were able to reproduce and pass these traits to their offspring

HELP HELP HELP!!! Which BEST describes how the process identified in Part A changed the frequency of

Answers

Answer:

Explanation:

c?

what is located outside the cell wall in a prokaryotic cell

Answers

Answer:

capsule

Explanation:

Answer:

The Prokaryotic Cell

Therefore, they do not have a nucleus, but, instead, generally have a single chromosome: a piece of circular, double-stranded DNA located in an area of the cell called the nucleoid. Most prokaryotes have a cell wall outside the plasma membrane.

Explanation:

Brainliest?

Match the following terms and definitions.
1. Anther 2.pistil 3.angiosperm 4.gymnosperm

The part of the stamen that bears the pollen.
The female part of the flower.
Flowering plant.
Cone bearing plant.

Answers

Answer:

Anther: is the Part of Stemen where pollen is produced.

pistil: the ollule producing part of a flower.

Angio sperms: are also known as flowering Plants and Having Seed enclosed within their fruit-

Gymno Sperms: have No flowers or fruits and have nacked Seed on the Surface of their leaves.

Help please how does bacteria get around? What does it remind you off?

Answers

Answer:

corona

Explanation:

Question 20 of 26
How many daughter cells does mitosis produce?
A) 2.
B) 4
C) 23
D) 46

Answers

The answer is 4. Hope this helps

Answer:

A) 2.

I hope it helps :)

Explanation:

During mitosis, a eukaryotic cell undergoes a carefully coordinated nuclear division that results in the formation of two genetically identical daughter cells. Mitosis itself consists of five active steps, or phases: prophase, prometaphase, metaphase, anaphase, and telophase.

List the two vascular tissues that transport materials throughout a plant AND describe what they each transport.

Answers

Answer:

xylem and phloem

Explanation:

Xylem is a vascular tissue that transports water to the leaves of the plant , while phloem tranporsts the food or the glucose made by the leaves to all parts of plant

how are organisms organized from simple to complex

Answers

Answer:

organelle, cells, tissues, organs, organ systems, organisms, populations, communities, ecosystem, and biosphere.

Explanation:

think from small to large

25. How does a forest fire impact all of the other spheres?

Answers

A forest fire could affect the biosphere by less oxygen in the air and that would make it hard for humans to breath affecting the climate. Also many homes to wildlife that live in the forest would lose their homes. The climate would be very bad and bad to take in. The Geosphere is all matter.

Answer:

From my point of view ... firstly, forests are home to many animals, and this will lead to displacement of animals ... Secondly, forest fires lead to the loss of trees, which are the source of oxygen gas, and an increase in the proportion of carbon dioxide

Other Questions
Pick a topic related to The Restless dark by Erica waters Pick a main theme/idea a place where the book is set. Then conduct research on the topic using at least three reliable sources. Write a paragraph about what you learned and how it relates to the book. One thing that the federal government pays for with your tax dollars is O A. defense O B. food O C. cigarettes D. property Before the advent of solid-state electronics, vacuum tubes were widely used in radios and other devices. A simple type of vacuum tube known as a diode consists essentially of two electrodes within a highly evacuated enclosure. One electrode, the cathode, is maintained at a high temperature and emits electrons from its surface. A potential difference of a few hundred volts is maintained between the cathode and the other electrode, known as the anode, with the anode at the higher potential.Suppose a diode consists of a cylindrical cathode with a radius of 6.200102 cm, mounted coaxially within a cylindrical anode with a radius of 0.5580 cm. The potential difference between the anode and cathode is 320 V . An electron leaves the surface of the cathode with zero initial speed (vinitial=0). Find its speed (vfinal) when it strikes the anode.Express your answer numerically in meters per second. a 9.8% 14.0% b 6.7% 9.8% c 11.2% 18.5% refer to the table above. suppose risk-free rate is 4%. which of the three portfolios are most likely to be the market portfolio? a. portfolio a b. portfolio b c. portfolio c d. all of the portfolios are equally likely to be the market portfolio e. there is insufficient information to differentiate between the three portfolios which of the following is not a phase in the testing process? making sure the programmer commented their code appropriately. check the user interface to make sure that it works correctly test the program with valid input data test the program with invalid data or unexpected user actions. If Tori is a proponent of dynamic systems theory, then you know that she is most interested inSelect one:a. crawling and stepping.b. the cerebral cortex.c. language development.d. temperament. Which switching technology would allow each access layer switch link to be aggregated to provide more bandwidth between each Layer 2 switch and the Layer 3 switch?- HSRP- PortFast- trunking- EtherChannel Solve the equation for x. The total water volume of a healthy adult male is approximately 42 liters, or between 50-65% of his body weight. The total water volume of a healthy adult female is approximately 45-60% of her body weight. Generally, this lower percentage in females is due to a higher fat percentage or a larger fat compartment. Which of the following consequences can occur in female patients taking fat-soluble drugs compared to male patients? (Select all that apply.)1 It will take more time for the drug to leave the fat compartment.2 More of the drug will move into the fat compartment.3 The drug will stay in the body for longer.4 The drug effects will last longer. Andrew has $90 in a savings account. The interest rate is 10% per year and is not compounded. How much interestwill he earn in 2 years? mario a self-employed baseball coach. during 2019, his net earnings from self-employment were $175,000. what is mario's total self-employment tax (oasdi and hi) for 2019? please help me is importe you suggest that the managers spend some time brainstorming on other strengths, weaknesses, opportunities, and threats impacting the business. they come up with the following list. consider each of the factors identified by the management team and identify it as a strength, weakness, opportunity, or threat. then drag the statement into the appropriate quadrant of the swot analysis. you are considering creating your own startup business and are weighing the advantages and disadvantages of doing so. according to the author, what would be your most important consideration before making the decision? responses Learning Task 2: On your answer sheet, answer the your project plan on the improvised musical instrument. 1. Are the majority of the materials of the improvised musical instrument in your project plan indigenous or be found in your home? CAased on a 2. Did you achieve the sound or the tone that you desired for your performance? An engineer is building a new steel skyscraper in a area with a lot of Earthquakes, Compare two systems (fixed based system and base isolated system) and choose which one would be better. which of the following is allowed to actually introduce a bill on the federal level? Representative of the House.A) State Legislator.B) Supreme Court Justice.C). Local Mayor.PLS HELP!!!!! Sixth gradeR.Are the ratios 5:10 and 2:4 equivalent? Please help me with this really easy 6th grade civics which descriptions are true about a civilization? select all correct answers. residents have no need for the herding of domesticated sheep, cattle, or goats. residents have no need for the herding of domesticated sheep, cattle, or goats. a few people are able to produce enough food for everyone. a few people are able to produce enough food for everyone. people organize large projects such as levee-building. people organize large projects such as levee-building. farming becomes unimportant in the economy.