Mathematical
nature of genetics

Answers

Answer 1

Answer:

the first genitic sceintists were mathmatitions

Explanation:


Related Questions

Earth's temperature has increased slightly in the last 100 years. Many scientists believe that
the increase is related to human activities, particularly the burning of fossil fuels. What gas
produced in this process has been most closely linked to rising atmospheric temperatures?
A) soot
B) chlorofluorocarbons
C) nuclear waste
D) carbon dioxide

Answers

The gas produced in the burning of fossil fuels that has been most closely linked to rising atmospheric temperatures is carbon dioxide. Option D

What is the burning of fossil fuel?

As a byproduct of combustion when fossil fuels like coal, oil, and natural gas are used to produce energy, carbon dioxide is discharged into the atmosphere.

As a greenhouse gas, carbon dioxide absorbs heat from the sun inside the Earth's atmosphere, creating the greenhouse effect, which causes global warming. The Earth's natural greenhouse effect, which keeps the globe warm enough to support life, is caused by this phenomena.

Learn more about fossil fuel:https://brainly.com/question/31522482

#SPJ1

The bond between an oxygen atom and a hydrogen atom would be categorized as:
O a hydrogen bond
O a non-polar covalent bond
O an ionic bond
O a polar covalent bond

Answers

Answer:

a polar covalent bond

Explanation:

The shared electrons spend more time near the oxygen nucleus, giving it a small negative charge, than they spend near the hydrogen nuclei, giving these molecules a small positive charge

Which type of mutation causes cystic Fibrosis
Deletion
Insertion
Silent
Substitution
I will give brainliest to best answer

Answers

I'm pretty sure the answer is Deletion :)

Answer:

I think it is deletion

Explanation:

Inside a cell, there are 30 sodium ions and 20 potassium ions. If the sodium-potassium pump uses two molecules of
ATP, determine how many ions of sodium and potassium will be left inside the cell. Explain your reasoning.

Answers

After the sodium-potassium pump uses two molecules of ATP, there will be 28 sodium ions and 22 potassium ions left inside the cell.

There were 30 sodium ions and 20 potassium ions inside the cell. With the help of the sodium-potassium pump, two cycles of ion exchange can occur, utilizing two molecules of ATP. In the first cycle, three sodium ions are transported out of the cell, and two potassium ions are transported into the cell. As a result, the number of sodium ions decreases by three to 27, and the number of potassium ions increases by two to 22.

In the second cycle, another three sodium ions are transported out of the cell, and two potassium ions are transported into the cell, which results in 24 sodium ions and 24 potassium ions. However, the total number of ions inside the cell is still 48, which is not the same as the initial number. Therefore, one more cycle is required, resulting in 28 sodium ions and 26 potassium ions inside the cell.

To learn more about ATP follow the link:

https://brainly.com/question/174043

#SPJ1

The sex of the person that you are attracted to would
determine your
sexual identification.
o gender-role attractions
sexual orientation.
sexuality​

Answers

Answer:

Gender role attraction determine your sexual identificaton.

Explanation:

Plants have specialized structures that help ensure reproduction. Which statement is an example of these structures?
A. An oak tree has thick bark.
B. A banana plant has green leaves.
C. Dandelion seeds blow in the wind.
D. Carrots grow underneath the soil.

Answers

The statement that best exemplifies specialized structures in plants is C: "Dandelion seeds blow in the wind."

This statement refers to the specialized structure of dandelion seeds, which have a feathery structure called a pappus that aids in dispersal through wind. Plants have evolved various specialized structures to ensure their reproduction and dispersal. In the case of dandelion seeds, their feathery pappus allows them to catch the wind and be carried away from the parent plant to new locations where they can germinate and grow.

This adaptation increases the chances of their survival and colonization in different areas. Specialized structures in plants can also include adaptations like bright flowers and sweet nectar to attract pollinators, thorns or spines for defense against herbivores, and underground storage organs like tubers or bulbs for nutrient storage and propagation.

These structures play crucial roles in the reproductive success and survival of plants in their respective environments, allowing them to disperse their offspring, attract pollinators, defend against threats, and establish themselves in diverse habitats. Therefore, Option C is correct.

Know more about specialized structures here:
https://brainly.com/question/18526471

#SPJ8

Photosynthesis could not occur without which of the following?

Answers

Answer: I think it’s is sunlight I hope this is right

Explanation:

Photosynthesis requires sunlight, carbon dioxide, and water as starting reactants (Figure 5.5). After the process is complete, photosynthesis releases oxygen and produces carbohydrate molecules, most commonly glucose. These sugar molecules contain the energy that living things need to survive.To perform photosynthesis, plants need three things: carbon dioxide, water, and sunlight. for photosynthesis. Carbon dioxide enters through tiny holes in a plant's leaves, flowers, branches, stems, and roots. Plants also require water to make their food.Plants use chlorophyll, usually found in their leaves, to absorb sunlight. The light energy from the sun is what fuels the reactions that transform carbon dioxide and water into glucose and oxygen. Without light, photosynthesis is impossible

Sunlight
Water
And carbon dioxide
Because photosynthesis is a process between water and carbon dioxide to produce oxygen and glucose

Would you please help need asap
The analysis of a compound gives the following percent composition by mass:
C: 56.70 percent; H: 8.419 percent; S: 11.65 percent; O: 23.24 percent. What is its molecular formula, given that its molar mass is 275.4 g?

C?H?S?O?
C atoms
H atoms
S atoms
O atoms

Answers

Answer:

C atoms= 13

H atoms= 23

S atoms= 1

O atoms= 4

Explanation:

No. of C moles=

\( \frac{56.7 0g}{12 \frac{g}{mol} } = 4.73 \: mol\)

No. of H moles=

\( \frac{8.419g}{1 \frac{g}{mol} } = 8.419 \: mol\)

No.of S moles=

\( \frac{11.65g}{32 \frac{g}{mol} } = 0.364 \: mol\)

No.of O moles=

\( \frac{23.24g}{16 \frac{g}{mol} } = 1.4525 \: mol\)

So the ratios are,

C : H : S : O

4.73 : 8.419 : 0.364 : 1.4525

13 : 23 : 1 : 4

So the empirical formula will be

\( c_{13} \: h_{23} \: s_{1} \: o_{4}\)

\(c_{13} \: h_{23} \: s_{1} \: o_{4} \times 1 = \\ c_{13} \: h_{23} \: s_{1} \: o_{4}\)

To find the final answer

\( \frac{Molar \: mass \: of \: real \: formula }{Molar mass of empriracl formula} \)

\( = \frac{274.5}{274} \)

It approximately equals 1

So,

\(c_{13} \: h_{23} \: s_{1} \: o_{4} \times 1 = \: \\ c_{13} \: h_{23} \: s_{1} \: o_{4}\)

Scientists who study evolution at or below the species level are most likely___.

Microevolutionalists

Convolutionalists

Macroevolutionalists

Answers

Ans. Microevolutionalists

Scientists who study evolution at or below the species level are most likely micro evolutionists.

What is the definition of microevolution?

Microevolution is defined as changes in the frequency of a gene in a population. These are subtle changes that can occur in very short periods of time, and may not be visible to a casual observer.

What is microevolution for example?

Pesticide resistance, herbicide resistance, and antibiotic resistance are all examples of microevolution by natural selection. The enterococci bacteria, shown here, have evolved a resistance to several kinds of antibiotics.

Learn more about microevolution here https://brainly.com/question/408991

#SPJ2

what is imminohistochemistry in breast pathology? what does it take care of?

Answers

Immunohistochemistry (IHC) is a common diagnostic tool used in breast pathology to help determine the type of breast cancer a patient has, as well as the best course of treatment. It is a technique that uses antibodies specific for certain proteins to detect the presence of those proteins in breast cancer cells. In breast pathology, IHC is typically used to examine the expression of hormone receptors (estrogen and progesterone) and human epidermal growth factor receptor 2 (HER2) in breast cancer cells.

By analyzing these markers, doctors can better determine the prognosis and the appropriate course of treatment for the patient. For example, patients whose breast cancer cells express hormone receptors may be candidates for hormone therapy, while those with HER2-positive breast cancer might benefit from targeted therapies such as trastuzumab (Herceptin).

Which of the following is NOT a common problem associated with inorganic fertilizers?
O They are often subject to leaching
O They can dry out, or desiccate, seedlings and young plants
O They may release insufficient nutrients and can deplete nitrogen in the soil
They can cause toxic residues to appear in conventionally grown fruits and vegetables

Answers

Answer:

They can cause toxic residues to appear in conventionally grown fruits and vegetables

Explanation:

Since inorganic fertilisers are made with chemical and such, they should not produce toxins.

Overuse of inorganic fertilizer destroys the physical characteristics of soil, hence, option d toxic more in conventionally grown vegetables and fruits is correct.

What are the problems associated with inorganic fertilizers?

Many, such as anhydrous ammonia, urea, urea-ammonium nitrate solutions, triple superphosphate, ammonium phosphates, and potash muriate, can be administered directly (potassium chloride).

Compound fertilizers are chemical or physical blends of pure ingredients. As a result, excessive use of inorganic fertilizers has resulted in soil and air.

Water pollution due to nutrient leakage, soil physical features deterioration, toxic chemical buildup in water bodies, and so on, as well as serious environmental concerns and biodiversity loss.

Therefore inorganic fertilizers can cause toxic residue to appear in fruits and vegetables, hence option d is correct.

Learn more about problems associated with inorganic fertilizers, here:

https://brainly.com/question/29240864

#SPJ2

3 marks) Compare the ingredients in D5NS to plasma in real blood. List 3 ingredients that are present in real blood plasma that are not present in D5NS.

Answers

Answer: The D5NS is a fluid used for maintaining the blood glucose level whereas plasma is a liquid matrix in which red blood cells, platelets, and white blood cells are suspended.

Explanation:

The D5NS is a solution of 5% of dextrose in the normal saline in addition it also contains saline 0.9% NaCl. It is used for intravenous glucose treatment. It is used for patients that have low blood glucose level and to maintain the electrolytic balance. Plasma on the other hand has a composition of water, hormones ,electrolytes,  lipids, salts, proteins, fibrinogen, clotting factors, and immunoglobulins.

The blood plasma is a liquid matrix which comprises of proteins, fibrinogen, clotting factors, and immunoglobulins (antibodies) which are not present in the D5NS.

HELP ! 50 POINTS !
A). 3 is the nucleus; 5 is a ribosome

B). 1 is the rough endoplasmic reticulum: 2 is a chloroplast

C).4 is a ribosome; 1 is the smooth endoplasmic reticulum

D).2 is a mitochondrion: 6 is a Golgi apparatus (Golgi body)

HELP ! 50 POINTS !A). 3 is the nucleus; 5 is a ribosomeB). 1 is the rough endoplasmic reticulum: 2 is

Answers

Answer:

The answer should be I think D) 2 is a mitochondrion: 6 is a Golgi apparatus (Golgi body)

Explanation:

I'm not to sure though so wait until somebody else also answers

but I'm pretty sure D is the answer

Jose wants to measure his fingernail, what unit is he going to use?​

Answers

Answer: you can measure in metric

Explanation:

here is a file

Suppose in a strain of soybeans, high oil (H) content in the seeds is dominant to low oil content and four seeds (E) in a pod is dominant to two seeds in a pod. A farmer crosses two soybean plants, both with (High oil / four seeds: High oil / two seeds: Low oil / four seeds: Low oil / two seeds). What genotype were the parent plants?​

Answers

The genotype of the parent plants in this cross is HhEe.

Based on the given information, we can determine the genotypes of the parent plants by examining the phenotypes of their offspring.

Let's denote the high oil content allele as H and the low oil content allele as h. Similarly, let's denote the four seeds allele as E and the two seeds allele as e.

The given parent plants have the following phenotypes:

- High oil / four seeds (unknown genotype)

- High oil / two seeds (unknown genotype)

- Low oil / four seeds (unknown genotype)

- Low oil / two seeds (unknown genotype)

From this information, we can deduce the possible genotypes of the parent plants by analyzing the inheritance patterns observed in their offspring.

If we cross two plants with the genotype HhEe (High oil / four seeds), we would expect the following ratios in their offspring:

- High oil / four seeds: 9/16

- High oil / two seeds: 3/16

- Low oil / four seeds: 3/16

- Low oil / two seeds: 1/16

Since the observed ratio matches the given phenotypes of the parent plants, it is likely that both parent plants have the genotype HhEe (High oil / four seeds).

Therefore, the genotype of the parent plants in this cross is HhEe.

for more questions on genotype
https://brainly.com/question/30460326
#SPJ8

Why is eating pizza an external source of energy for the body? Why is ATP an internal source of energy?

Answers

Answer:

Eating pizza provides the body with an external source of energy because it contains nutrients such as carbohydrates, fats, and proteins that can be broken down by the body's digestive system to release energy. Once these nutrients are absorbed into the bloodstream, they are transported to the body's cells where they are used as fuel to generate ATP (adenosine triphosphate), the primary energy currency of the body.

On the other hand, ATP is an internal source of energy because it is produced by the body's own metabolic processes. ATP is synthesized through cellular respiration, a series of chemical reactions that occur within the cells of the body. During this process, nutrients such as glucose are broken down to release energy, which is then used to synthesize ATP. Once formed, ATP can be used by the body's cells to power a wide range of biological processes such as muscle contraction, protein synthesis, and nerve impulse transmission.

In summary, external sources of energy such as food provide the raw materials that the body needs to synthesize ATP internally, which is then used as the primary source of energy for various cellular processes.

Explanation:

Along with the nervous system, the ___ system coordinates the various activities of body parts.

Answers

Along with the nervous system, the endocrine system coordinates the various activities of body parts.

The endocrine system is a network of glands that produce and release hormones that help regulate many important body functions. These hormones travel through the bloodstream and affect different tissues and organs in the body.

The endocrine system plays a vital role in regulating many important body functions, including:

• Metabolism - the process by which the body converts food into energy

• growth and development

• reproduction

• mood and behavior

Endocrine disorders can occur when the body produces too much or too little of a hormone. For example, diabetes mellitus is a condition that occurs when the body does not produce enough insulin, a hormone that helps regulate blood sugar levels.

Learn more about diabetes mellitus at : https://brainly.com/question/28272600

#SPJ4

A barista is asked to make a customer an iced tea. They pour a cup of cold
water, add ice cubes and a teabag. Fifteen minutes later the brew is not yet
ready, and the customer is getting annoyed. They fetch their boss who tells
them that iced tea is made by adding the teabag to hot water first and then
cooling it down. Why is this?

Answers

One must use hot water because the temperature allows to extract the flavour in a more efficient way.

Why we must use hot water?

The process of making iced tea by adding the teabag to hot water first and then cooling it down is a common practice for several reasons:

Extraction of Flavor: Hot water helps to extract the flavor compounds from the tea leaves more efficiently. When tea is steeped in hot water, the heat causes the compounds responsible for flavor and aroma to dissolve into the water more readily, resulting in a stronger and more flavorful brew.

Infusion of Tea Leaves: The hot water allows the tea leaves to fully infuse and release their flavors, oils, and other components into the water. This process contributes to a more robust and well-rounded taste profile.

Dilution and Consistency: When iced tea is made with hot water first, it is usually brewed to be slightly stronger than desired. This is because the ice added later will dilute the brew to the desired strength. By initially brewing the tea with hot water, the dilution caused by adding ice cubes ensures that the final drink is not weak or watery.

Learn more about temperature:

https://brainly.com/question/27988898

#SPJ1

phương pháp cố định mẫu

Answers

Answer:

phuong phap co dinh mau

I don't know Spanish

sry

compare community conservation area and protected area


Answers

Answer:

Explanation:

Biosphere Reserves are areas of terrestrial and coastal ecosystems which are internationally recognized within the framework of the Man and the Biosphere ( MAB) programme of the UNESCO and are not formed according to the guidelines of the Wildlife (protection) Act, 1972 and may have one more national parks or wildlife.hus, protected areas are geographical space, recognized, dedicated and managed, through legal or other effective means, to achieve the long term conservation of nature and cultural values. In protected areas human occupation and exploitation of resources is limited.

BRAINLIEST!!!
YOU HAVE 5 MINUTES!!!!
Design an easy do-it-yourself compost bin that can be put (exnfe ffpao)
together at home. You can describe it, draw and label it, or both!
Include the following in your design:
• drawing or description of design
• materials used for the bin
• size of the bin
• substances used to fill it
• household items that can go in it
• how long it takes before it is ready
• how you use the compost
2)
Compost bin design: Add these household items to
your compost bin:
Compost is ready to use in this
much time:
Use your compost this way:

Answers

A description of the compost bin that can be used for this experiment is that the bin is a rectangle-shaped container that is made of wood. This container is 150 cm wide and 30 cm deep. It can hold up decaying materials for up to one month.

How to use the compost

The compost can be used to store decaying materials that will be used in a nearby farm for manure. Composting is the act of storing up decomposable materials that remain in a container until they are ready for use.

The compost so obtained can be used to improve the fertility of the soil where crops will be planted.

Learn more about composting here:

https://brainly.com/question/25342752

#SPJ1

A biochemist has discovered a new membrane protein in a eukaryotic cell. To determine the type of membrane protein, she decides to perform laboratory tests on the cell. She discovers that the protein is an integral membrane protein. Select the experimental scenarios that correctly support the finding that the protein is an integral membrane protein? Try to dissolve the protein out of the membrane with an aqueous buffer, then try to dissolve the protein with a nonpolar solvent. If the protein is solubilized in the nonpolar solvent but not in the aqueous buffer, it is probably an integral protein. Try to dissolve the protein out of the membrane with an aqueous buffer, then try to dissolve the protein with a detergent solution. If the protein is solubilized in the detergent solution but not in the aqueous buffer, it is probably an integral protein. Try to dissolve the protein out of the membrane with an aqueous buffer at low pH, then try to dissolve the protein with an aqueous buffer at neutral pH. If the protein is solubilized in the buffer at low pH but not in the buffer at neutral pH, it is probably an integral protein. Try to dissolve the protein out of the membrane with an aqueous buffer containing a chelating agent that removes Ca²+, then try to dissolve the protein in an aqueous buffer without the chelating agent. If the protein is solubilized in the buffer with the chelating agent but not in the buffer without the chelating agent, it is probably an integral protein. Try to dissolve the protein out of the membrane with an aqueous buffer containing urea, then try to dissolve the protein in an aqueous buffer without urea. If the protein is solubilized in the buffer with urea but not in the buffer without urea, it is probably an integral protein.

Answers

Try to dissolve the protein out of the membrane with an aqueous buffer, then try to dissolve the protein with a nonpolar solvent. If the protein is solubilized in the nonpolar solvent but not in the aqueous buffer, it is probably an integral protein.

Large macro- and biomolecules consisting of one or more extended chains of amino acid residues are known as proteins. In living things, proteins perform a number of functions, such as catalysing metabolic processes, replicating DNA, reacting to stimuli, giving cells and organisms structure, and transporting substances. The primary way that proteins differ from one another is the arrangement of their amino acids, which is determined by the nucleotide sequence of their genes and typically allows a protein to fold into a certain 3D structure that controls its function.

The complete question is:

A biochemist has discovered a new membrane protein in a eukaryotic cell. To determine the type of membrane protein, she decides to perform laboratory tests on the cell. She discovers that the protein is an integral membrane protein. Select the experimental scenarios that correctly support the finding that the protein is an integral membrane protein?

To learn more about protein click on the given link: https://brainly.com/question/29776206

#SPJ4


Label the 4 Layers of the Food Web by placing the correct organism in the correct location using the word bank provided to you
1.
Bass Fish


Perch Fish


Zooplankton


Water Lilly


Plz help me out and hurry thank you

Label the 4 Layers of the Food Web by placing the correct organism in the correct location using the

Answers

Bottom layer: Zooplankton
Second bottom layer: Water Lilly
Third bottom layer: Perch fish
Top layer: Bass fish

Explain the following statement using evidence from the DNA sequences:

Mutations in the DNA change how proteins are made which leads to new and different forms of phenotypes.

Answers

A missense mutation is a Genetic alteration that causes the protein produced to encode a different amino acid at a specific location. Certain missense mutations change how the resulting protein functions.

Why do some changes in an organism's DNA sequence cause change, while others do not?

While mutations always result in a change in the DNA sequence, they do not necessarily have a noticeable impact on the organism or alter the resulting protein. Since most amino acids can be encoded by two or more distinct codons, this is possible.

Can mutations be found using DNA sequencing?

The ability to properly identify and characterise the majority of sequence changes makes direct DNA sequencing, in theory, the method for mutation identification with the highest degree of accuracy.

To know more about Genetic alteration visit:-

brainly.com/question/2211559

#SPJ1

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Answers

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1

When four hydrogen atoms bond with oxygen and four electrons what molecule is created?

Answers

Hey the answer to this question is Covalent bond.

Answer: The answer is H20

Explanation:

The equation is 4Hplus+O2+4e- -------> 2H20

Question 3 (5 points)
How many centimeters are in 5.7 meters?

Answers

Answer:570

Explanation:

There are 100 centimeters in one meter so if we have 5.7 meters we would multiply that by one hundred to get our answer of 570.

How would you explain the key concepts for the CWA in less than two minutes?

Answers

Answer:

Explanation:

vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.

Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from  a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.

Navigable Waters of the United States  For the purposes of the Clean Water Act, the term "navigable waters" includes:

all waters used in commerce, including groundwater;

all interstate waters including wetlands, mudflats, and sand-flats; and

all other waters such as lakes, rivers, streams, wetlands and sloughs.

EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters."  The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect.  In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.

Additional executive orders were issued 2015 in 2019.  Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.

Could the requirement for one or more NPDES Discharge Permit apply to my campus?

If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.

Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.

Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.

What do I have to do related to NPDES Discharge Permits?

Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.

French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.

Details of NPDES


What is the reason that a water molecule is polar?
it is neutral
it is an ion
the hydrogens lose their electrons to the environment
the electrons are unequally distributed among the atoms
Previous

Answers

Answer:

C) hydrogens lose their electrons to the environment.

Explanation:

I think

i think its c like he said aboveee

following are the types of functions performed by proteins in the human body
Storage
Support
Regulation
Defence

Select the appropriate type of function of proteins for each of the given descriptions
Description Type of Function
1. Recognition of foreign molecules ????
2. Receptors of extracelluar signals ????

Answers

Answer:

1. Recognition of foreign molecules - Defense

2. Receptors of extracellular signals - Regulation

Explanation:

Other Questions
What is the annihilator of y=10-x+4sin 3x? PLEASE HELP !!!the local bakery made a profit of $210 for each day for five days .what was the total profit for five days ? Who played the new york knicks in the first-ever nba game?. Explain difference between an internal auditor and an externalauditor ( 7 DIFFERENCE ) Here is information about two savings account. Savemore compound interest 1.25%each year. Highbrook compound interest 2.1% for first year 0.95%for each extra year. Abi is going to invest 5000 in one of these saving accounts for 3years. She wants to have as much money as possible in the account at the end of 3years. Which saving account should Abi choose What is la cucurbitace in English? HELP what types of events are logged by windows and can be viewed using the event viewer? Lin and Kal's ages add up to 41 Lin is 5 years older than Kal. Use the equation from the to find their ages. If your original network address with prefix is 172.16.0.0/16, what should your new network address with prefix be if you need 16 subnets? Select the correct answer.Liz's colleague shares a hidden network share with her. How is Liz able to tell that it is hidden?A.has the $ signB.is grayed outC.is hiddenD.is present in the sys folder In five to eight sentences, describe the achievements of the Tang Dynasty. strontium-90 (9038sr) is a particularly dangerous fission product of 23592u because it is radioactive and it substitutes for calcium in bones. what other direct fission products would accompany it in the neutron-induced fission of 23592u if three neutrons are released? Explain why liberals think ameritocratic society is socially justand fair? To change the number of entries in the memory from 4 to 16, how many extra address lines would be needed The question is in the image Which crop is called the "the poor person's staple" in China, but was not a native plant in Asia despite the belief it was? Choose 1 answer: Beans Sweet Potatoes Avocados Maize Report a problem B In __________, the U. S. Supreme Court struck down sentencing guidelines in the State of Washington, holding that the Sixth Amendment gives juries the power to make a finding of fact beyond a reasonable doubt. Which of the following examples of Aztec technology best demonstrates an understanding of complex mathematics?A: CalendarsB: BloodlettingC: AdobeD: Craftsmen how would you define the actual score and theoretical score on an exam, and how would you calcutre the percent success Un conejo da un salto de 2 metros y luego uno de 3 metros hasta atravesar un Puente de 32 metros de longitud Cuantos saltos de 2 metros y 3 metros realiza