Many leaders have difficulty implementing their vision and strategies. Such problems may stem from a variety of issues in the design of the organization such as Multiple Choice adequate accountability among managers and employees.
teams, systems, and organizational processes that facilitate implementation. inappropriate budgeting and control systems. sufficient mechanisms that integrate and coordinate activities across the firm.

Answers

Answer 1

Many leaders struggle with implementing their vision and strategies due to various issues in the organization's design. One such issue is the lack of adequate accountability among managers and employees. So the right option is: adequate accountability among managers and employees

which can lead to a lack of clarity on who is responsible for specific tasks and goals.

Additionally, teams, systems, and organizational processes that facilitate implementation are critical but can be challenging to establish. Inappropriate budgeting and control systems can also hinder successful implementation by limiting resources or creating unnecessary bureaucracy.

Finally, sufficient mechanisms that integrate and coordinate activities across the firm are necessary to ensure everyone is working towards the same objectives. Addressing these issues can help leaders successfully implement their vision and strategies.

For more questions on: employees

https://brainly.com/question/27404382

#SPJ11


Related Questions

education opens the door to employment.

Answers

Answer:

yes education opens the door to employment as Education give us a new identity and talent which people are looking for the employment. Education can lead to success and employement.

Yes correct perfect

Date
Page
2
2) Marketing is meeting
needs
profitably!
Comment

Answers

Answer:

markeing

Explanation:

communication skills, credentials, honesty

The production cost in GHC per week of producing x computers is given by
\(c(x) = 4000 - 32x + 0. 08 {x}^{2} + 0. 00006 {x}^{3} \)
and the demand function for the computers is given by
\(p(x) = 250 + 0. 02x - 0. 001 {x}^{2} \)
What is marginal cost, marginal product, and marginal revenue. When
\(x = 200 \)
and
\(x = 400\)
what does theses numbers tells you about marginal cost, marginal product and marginal revenue​

Answers

When x = 200 and x = 400, you can calculate the values of marginal cost, marginal product, and marginal revenue at these specific production levels. These numbers will provide insights into the changes in cost, production, and revenue associated with increasing the quantity produced from 200 to 400 units.

Marginal cost represents the additional cost incurred by producing one more unit of output. It is calculated as the derivative of the cost function with respect to the quantity produced (x). In this case, the marginal cost can be obtained by taking the derivative of the cost function c(x).

Marginal product refers to the additional output produced by employing one more unit of input. It is calculated as the derivative of the production function with respect to the quantity produced (x).

However, the given problem does not provide a production function explicitly, so it is not possible to determine the marginal product.Marginal revenue represents the additional revenue generated by selling one more unit of output.

It is calculated as the derivative of the revenue function with respect to the quantity sold (x). In this case, the revenue function can be obtained by multiplying the price function p(x) by the quantity produced (x).

To know more about marginal cost refer here:

https://brainly.com/question/7781429#

#SPJ11

QUICKLY PLEASE ITS TIMED!!!!
Which of the following approaches measures team performance by the team's ability to meet specific, predefined goals
O the results approach
the behaviors/process approach
the goals approach
the outcome approach

Answers

Answer:

the results approach.

Explanation:

This is because this approach emphasises on the results and outcomes produced by the team.

The approaches that measures team performance by the team's ability to meet specific, predefined goals is: results approach.

What is result approach?

Result approach is a performance evaluation approach and can be defined as the type of approach that is used to determine a person perfomance based on the outcome of their tasks.

Most companies tend to make use of result approach to know how well an employee perform on the tasks they are assigned especially when the employee meet or achieved the set goals.

Therefore  the approaches that measures team performance by the team's ability to meet specific, predefined goals is: results approach.

Learn more about result approach here:https://brainly.com/question/25234298

#SPJ2

You just started your first full-time job, and one of the benefits is a retirement savings plan. Someone in the human resources department is going over your benefits and says that you have make choices about how the retirement savings plan is invested. She gives you some papers to read and asks you to stop by and let her know your choices when you come to work tomorrow. What must you consider as you read the information and make your choices? Answer in complete sentences.

Answers

I need to be aware that investment options and the market conditions can change over time, and I should regularly review and adjust my investment choices as to ensure I am on the track to meet my retirement goals.

What is retirement?

Retirement is a phase in a person's life when they choose to stop working or reduce their work hours. It is a time when people typically have reached a certain age, have accumulated enough savings or investments, and are ready to leave the workforce. Retirement can be a voluntary decision or forced due to health issues or other reasons. During retirement, individuals can pursue hobbies, travel, spend time with family and friends, and engage in leisure activities they did not have time for while working. Retirement also involves careful financial planning to ensure that one's income will be sufficient to support their lifestyle and cover expenses, such as healthcare and housing. Many people also choose to seek advice from financial planners and other professionals to help them navigate this phase of life.

To learn more about retirement, visit:

https://brainly.com/question/30280962

#SPJ1

Home and More sells rugs, art, lamps, and other decorative pieces to homeowners, so they can express their personal styles in their homes. This is an example of
a. Home decor retail business
b. Interior design service
c. Home improvement store
d. Home staging company

Answers

a. Home decor retail business.

Home and More is a retail business that sells rugs, art, lamps, and other decorative pieces to homeowners. This allows homeowners to express their personal styles in their homes. A home decor retail business is an example of a business that specializes in home decor products.

Home decor retail businesses specialize in selling decorative pieces such as rugs, art, lamps, and other items that add beauty and personality to a home. They cater to homeowners who wish to improve their living spaces by providing them with high-quality decorative pieces that fit their personal style and taste. Home decor retail businesses are found in malls, shopping centers, or online stores. They offer a wide range of products, from classic to modern, to suit different customers' preferences.

In conclusion, Home and More is a home decor retail business that sells decorative pieces to homeowners who want to express their personal styles in their homes. They offer a wide range of products, from rugs to art, to lamps, to cater to different customers' needs and preferences.

Learn more about retail businesses from the given link

https://brainly.com/question/32071959

#SPJ11

Which of the following is NOT a useful strategy when making an informed purchase?

1.Compare your option to similar products.
2.Calculate the unit price of the product.
3.Read the online reviews of the product and ask trusted friends who use it.
4.Purchase a product based on a social media influencer.

Answers

The answer is 4, purchase a product based on a social media influencer.

this would not be an informed purchase

Enter text- Apply A text Effect

Answers

This is not the app for this !!

The Credit Alliance v. Arthur Andersen & Co. case established three tests that must be satisfied for holding auditors liable for negligence to third parties. All of the following are tests described except :________.
a) Knowledge by the accountant that the financial statements are to be used for a particular purpose.
b) The intention of the third party to rely on those statements.
c) Some action by the accountant linking hi or her to the third party than provides evidence of the accountant's understanding of intented reliance.
d) The identity of the third party must be directly known to the auditor.

Answers

Answer:

D.

Explanation:

The Credit Alliance v. Arthur Andersen & Co. is a case that questions if an accountant should be held liable to the third party on whom it is reliable to his detriment absent privity of contract.

The Court of Appeals of New York, on July 2, 1985, affirmed that an auditor should not be held liable if they fulfill the following three requirements.

The auditor should have knowledge that the financial statements will be used for a particular purpose.The intention of the third party to rely on those statements. Some action should have been there by the acccountant that links him or her to the third party which will clarify the auditor to understand why third party is relying in the statement.

So, from the options stated in the question, one that is not included in this case is the fourth one. Thus the correct answer is option D.

Note that common activities are listed toward the top, and less common activities are listed toward the bottom. According to O*NET, what are common work activities performed by Construction Carpenters? Check all that apply. O. Inspecting equipment, structures, or material O. Writing computer programs to perform calculations O. Using knowledge of historical events and their effects on cultures O. Performing general physical activities O. Getting information O. Speaking and writing in a foreign language

Answers

Answer:

The answer is "Choice 1,4, and 5"

Explanation:

The numbering of the choices are missing, which can be defined in the attached file please find it.

Carpenters developers are restoring systems or structures for wooden buildings, like stairs, windows, and doors. It uses the equipment for cutting and shaping wood, plastic, fiberglass, or wallboard.  As per O*NET, Building Carpenters could identify the typical work tasks as following:  

Equipment, frameworks or material inspection  Overall physical activity  Knowledge obtained

Answer:

2,3,4,5

Explanation:

Note that common activities are listed toward the top, and less common activities are listed toward the

Which investors have the right to vote for or against business initiatives presented at the annual general meeting?

_________ shareholders have the right to vote for or against a business decision made by the company in which they invested.

Answers

Answer: Equity

Explanation: Plato(Edmentum)

Equity shareholders have the right to vote for or against a business decision made by the company in which they invested.

What is the shareholder?

A shareholder of a corporate body is an individual or legal entity who is certified by the corporate body as the registered proprietor of shares of a private or publicly traded corporation's share capital. Anyone who owns'shares in a company limited by shares is referred to as a shareholder.

Members of a corporation may be referred to as shareholders. The shareholder is the company's owner who provides financial security, controls how the directors manage the company, and receives a percentage of any profits produced by the company.

Therefore, Equity shareholders can vote for or against a business decision made by the firm in which they have invested.

Learn more about the shareholder, refer to:

https://brainly.com/question/29803660

#SPJ5

Which countries signed in the North American Free Trade Agreement in 1992?

Answers

The correct answer is Canada, the United States, and Mexico

Explanation:

The North American Free Trade Agreement or NAFTA was an economic alliance between three important countries: Canada, the United States, and Mexico (main countries in North America). Additionally, the purpose of this alliance was to facilitate trade between these countries, and in this way promote the development of the economy in these territories. In terms of history, all countries signed for the agreement in 1992, but the alliance was official only in 1993 because of the opposition of some citizens and groups. Thus, in 1992 Canada, the United States, and Mexico signed this agreement.

In the context of maintaining flexibility while planning, unlike traditional planning, options-based planning:
involves committing people and resources to a particular course of action.
involves making large investments in many alternative plans over a long period of time.
reduces flexibility.
involves maintaining slack resources.

Answers

In the context of maintaining flexibility while planning, unlike traditional planning, options-based planning involves maintaining slack resources.

About options-based planning

Options-based planning allows for the allocation of extra resources that can be used in case of unforeseen circumstances or changes in the plan. By maintaining slack resources, options-based planning allows for greater flexibility and the ability to adapt to changing conditions.

This is different from traditional planning, which typically involves committing people and resources to a particular course of action and making large investments in a single plan. Options-based planning, on the other hand, involves considering multiple alternative plans and maintaining the resources needed to pivot to a different plan if needed.

Learn more about flexibility at

https://brainly.com/question/10881309

#SPJ11

Sally spends $1,500 each month on her mortgage, mortgage insurance and property taxes. She has three credit cards with minimum monthly payments that total to $125. 00 and a monthly car payment for $349. 0. She currently brings in a gross monthly income of 3,750. 00 from her job. Calculate Sally’s debt-to-income (DTI) ratio. A. 40% b. 43% c. 49% d. 53%.

Answers

The debt-to-income ratio of Sally is 53%. Thus, option D is correct.

The debt to income ratio is defined as the amount of debt paid per income.

The debt to income ratio (DTI) is given as:

\(DTI=\dfrac{D}{I} \;\times\;100\)

Computation for Debt to Income ratio for Sally

The debt paid by Sally is the sum of amount she paid as a mortgage, mortgage insurance, property tax, card payments, and car payments.

The amount paid by Sally are:

Mortgage, mortgage insurance, property tax = $1500Card payments = $125Car payment=$349

The total debt paid (D) by Sally are:

\(D=1500+125+349\\D=1974\)

The total debt (D) paid by Sally is $1974.

Sally's total income (I) is $3,750

Substituting the values for DTI ratio:

\(DTI=\dfrac{1974}{3750} \;\times\;100\\\\DTI=0.53\;\times\;100\\\\DTI-53\%\)

The debt-to-income ratio of Sally is 53%. Thus, option D is correct.

Learn more about debt to income ratio, here:

https://brainly.com/question/3886471

Answer:

✅D. 53%

correct ⬇️

Sally spends $1,500 each month on her mortgage, mortgage insurance and property taxes. She has three

????? yeah I need help again

????? yeah I need help again

Answers

Answer: A. sales and stock managers

Explanation:

Emily Jones was very upset and felt she was being picked on by the government. She was worried she was being targeted and her business would suffer. Sure, she was not familiar with all the regulations, and therefore may have not complied with everything she should have. She was furious that this situation may put her out of business.
Five years ago, Emily started her own cleaning business. She provided customers with proper invoices and was well regarded for her services. Emily had a lawyer set up her business as a Corporation (Clean Sweep Inc.) so that she would sound professional. She was fully insured and had never had any problems.
It was a slow start, but business picked up quickly and within the first year, Emily had to hire two additional employees to keep up with the demand. A friend had advised Emily, that instead of hiring the cleaners as employees, she should hire them as subcontractors and avoid a lot of additional paperwork and headaches. The new employees used all of Emily’s equipment and supplies, but they had their own vehicles to travel from client to client. Emily also advised she would pay them a flat rate for each job they did, and they would cover their own transportation costs. Each would also have to file their own tax returns.
The business continued to grow with Emily’s excellent reputation, and she found herself working constantly to schedule appointments and still try to do some of the cleaning herself. Emily’s workers seemed happy, rarely complained and everyone got a long well. Because of the busy schedule, Emily knew she had not kept on top of her accounting, and she was getting consistent reminders about unfiled personal and corporate tax returns. As Emily was making a lot of money, and had little time to spend it, she figured she would have enough to cover whatever she may have owed to the government.
Emily finally got around to seeing an accountant to help her through filing her taxes. She thought "better late than never!" but was disappointed to find out that the Canadian Revenue Agency was not able to process her tax return because the corporation had been dissolved due to her failure to send in her corporate tax returns. Additionally, the Canadian Revenue Agency was threatening legal action over the unpaid taxes. The accountant also advised Emily that there would be a lot of paperwork and it would take time to get her corporation reinstated. Furthermore, the accountant had advised Emily she should have been charging her customers HST. Emily explained she thought that was just for retail stores, but the accountant let her know that she was also responsible to pay 13% of all the revenue she had made in HST immediately. However, the HST could not be filed or paid because the corporation had been dissolved.
The following week things got worse. Emily was contacted by the Provincial Labour Board and was accused of paying one of her cleaners less than minimum wage; after time spent on the job and the transportation costs were calculated. Additionally, the other cleaner was not paying their taxes. It was explained to Emily, despite any contract they may have had, these were actually employees and she should have been deducting income tax, CPP and EI contributions which Emily will now be responsible for paying. She also may be fined for these infractions.
Once you have familiarized yourself with the case study of Emily Jones, answer the following questions:
Why should Emily have consulted an accountant when setting up her business?
What procedures could have been set up?

Answers

Emily should have consulted an accountant when setting up her business for several reasons: Proper legal structure: An accountant could have advised Emily on the most appropriate legal structure for her business based on her specific circumstances.

This would ensure that she complies with all legal requirements and maximizes the benefits of the chosen structure, such as tax advantages and limited liability. Tax obligations and compliance: An accountant would have helped Emily understand her tax obligations from the start, including corporate tax, personal tax, and sales tax (such as HST in this case). They would have guided her on how to register for taxes, file returns, and make payments accurately and on time. This would have prevented the issues she faced with the dissolution of her corporation and the unpaid taxes. Payroll and employment matters: Consulting an accountant would have clarified the distinction between employees and subcontractors. In Emily's case, hiring cleaners as subcontractors instead of employees led to potential legal and tax issues. An accountant could have advised her on proper payroll procedures, deductions, and employment laws to ensure compliance and avoid penalties.Financial record-keeping: An accountant could have helped Emily set up proper accounting systems and processes from the beginning. This would include keeping accurate records of income and expenses, tracking invoices and payments, and maintaining organized financial statements. Timely and accurate financial information is crucial for managing the business effectively and fulfilling reporting requirements.Business planning and financial management: An accountant could have assisted Emily in creating a solid business plan, budgeting, and forecasting cash flow. This would have provided her with insights into the financial health of her business, enabling better decision-making and preventing cash flow problems. Additionally, regular financial reviews with an accountant would have helped Emily stay on top of her accounting and tax obligations. Procedures that could have been set up include: Regular bookkeeping: Emily should have established a system to regularly record all financial transactions of the business. This would involve documenting sales, expenses, and other financial activities in an organized manner. Hiring a bookkeeper or using accounting software could have helped maintain accurate records. This would involve setting aside funds for tax payments, filing returns on time, and complying with sales tax requirements, such as charging and remitting HST. Payroll management: If Emily had hired employees instead of subcontractors, she should have implemented proper payroll procedures. This would include deducting income tax, CPP (Canada Pension Plan), and EI (Employment Insurance) contributions from employee wages and remitting them to the appropriate authorities.

By following these procedures and seeking professional advice from an accountant, Emily could have avoided the complications and financial difficulties she faced in her business.

learn more about Emily’s workers here:

https://brainly.com/question/32330993

#SPJ11

A company purchased a new truck at a cost of $42,000 on June 1, 2019. The truck is estimated to have a useful life of 7 years. The company uses the straight-line method of depreciation. So, the annual depreciation expense is $6,000. How much depreciation expense will be recorded for the truck during the first year ended December 31? Select one: a. $6,000. B. $45,000. C. $3,500. D. $3,000.

Answers

Answer:

C. $3,500

Explanation:

The formula for a straight-line method of depreciation is provided  below:

annual depreciation charge=(cost-salvage value)/useful life

cost of the new truck=$42,000

salvage value=$0

useful life=7 years

depreciation=($42,000-$0)/7=$6,000( same as given in the question)

The truck was used for 7 months in the first year ended, from June 1 2019 to December 31 2019

Depreciation for the first year=$6000*7/12=$3,500

Tim Horton wants to raise funds to open a branch of their coffee shop in Trinidad. To raise the funds, Tim Horton would sell bonds 100 $1,000 par value with a coupon interest rate of 6%. The bonds would mature in 15 years and interest would be paid semi-annually. The required rate of return is expected to be 8%.

Requirement:
a) Calculate the value of one bond
b) What is the total amount Tim Horton would raise if all bonds were sold?

Answers

Answer:

a) The value of one bond is $837.08.

b) The total amount Tim Horton would raise if all bonds were sold is $83,708.

Explanation:

a) Calculate the value of one bond

This can be calculated as follows:

Annual coupon = Bond face value * Coupon interest rate = $1,000 * 6% = $60

Annual coupon discount factor = ((1 - (1 / (1 + r))^n) / r) .......... (1)

Where;

r = required semi-annual rate of return = required annual rate of return / number of semi-annual in a year = 8% / 2 = 0.08 / 2 = 0.04

n = number of semi-annuals = number of years * number of semi-annual in a year = 15 * 2 = 30

Substituting the values into equation (1), we have:

Semi-annual coupon discount factor = ((1-(1/(1 + 0.04))^30) / 0.04) = 17.2920333006645

Present value of coupon = ((Annual coupon / number of semi-annual in a year) * Semi-annual coupon discount factor) = (($60 / 2) * 17.2920333006645 = $528.76

Present value of the face value of the bond = Face value of the bond / (1 + r)^n = ($1,000 / (1 + 0.04)^30 = $308.32

Therefore, we have:

Bond value = Present value of coupon + Present value of the face value of the bond = $528.76 + $308.32 = $837.08

Therefore, the value of one bond is $837.08.

b) What is the total amount Tim Horton would raise if all bonds were sold?

Number of bonds expected to be sold = 100

Value of one bond = $837.08

Total amount that would be raised = Number of bonds expected to be sold * Value of one bond = 100 * $837.08 = $83,708

Therefore, the total amount Tim Horton would raise if all bonds were sold is $83,708.

Those who manage the work on the front lines are most involved with what component of the planning process?.

Answers

Those in charge of monitoring action on the front lines typically handle the operational planning element of the planning process.

Operational planning is a helpful document that details the primary duties and objectives a company will pursue during a specified time period, typically a year

What is more about planning process.

Planning is the act of dividing one's thoughts into manageable steps. Planning is divided into four primary categories: strategic, tactical, operational, and contingency planning. To determine their goals and objectives, organizations use the strategic planning process.

Operational planning is a helpful document that details the primary duties and objectives a company will pursue during a specified time period, typically a year. It frequently has connections to finance agreements and, in a broader sense, to the organization's strategic objective.

A manufacturer developing a plan to increase sales by 30% is an example of operational planning.

To learn more about planning process refer to:

https://brainly.com/question/1985202

#SPJ4

A(n) __________ boycott is an illegal attempt by labor to convince others to stop doing business with a firm that does business with a company that is the subject of a primary boycott

Answers

Answer:

Secondary.

Explanation:

True or false: charitable donations you make may reduce the amount of taxes you have to pay.

Answers

Charitable donations you make may reduce the amount of taxes you have to pay is True.

What are examples of donations?

A contribution is a gift given to a cause, humanitarian organization, or charity. A donation can come in many different ways, such as cash, alms, services, or tangible objects like furniture, toys, food, or automobiles. A donation could meet a demand for transplantable organs or blood.

What does making donations accomplish?

96% of respondents said they believed it was their moral obligation to use what they had to help others, a belief that was deeply ingrained in their own personal values and principles, regardless of the type of charity work they supported.

To know more about Donations visit:

https://brainly.com/question/18120339

#SPJ4

In negative self talk, filtering is when a person _______. a. Focuses only on their problems, ignoring their successes b. Blames themselves for every problem, whether it was their fault or not c. Believes that every situation will end badly d. See themselves as a failure for not living up to impossible standards

Answers

Answer:

In negative self talk, filtering is when a person Focuses only on their problems, ignoring their successes

Explanation:

In negative self talk, filtering is when a person is being negative filtering positive stuff and turning it to something negative instead.

For example if someone passes a test but instead of being proud they feel as if they could have tried harder or gotten a higher grade, that person is filtering their success into negative things.

Hope this helps, Have a great day! :D

In negative self-talk, filtering is when a person focuses only on their problems, ignoring their successes. Thus, option A is the correct option.

What is negative self-talk?

When your inner voice is too critical and negative, it is said to be engaging in negative self-talk. It is gloomy and emphasizes the negative. Your self-esteem is damaged, and you are prevented from realizing your potential. It might give you the impression that you will fail even before you begin. Repetitive negative self-talk frequently doesn't correspond to reality.

Rumination, which is repeated with intrusive unpleasant thoughts, might result from it. You will experience negative thoughts about yourself most of the time. This might get you down, and it can be difficult to get back up once you're down. People with anxiety or depression frequently exhibit negative self-talk. It might be overwhelming and impossible to escape from the incessant negative talk.

Learn more about negative self-talk here:

https://brainly.com/question/30790043

#SPJ3

Due to technological advances, individuals are able to buy and download music from the Internet as opposed to simply
buying music from a store.
Which statement describes an economic impact of this technological advance?
A)
Consumer demand for compact discs has increased.
B)
Consumer demand for compact discs has decreased.
The efficiency of downloading music has decreased.
D)
The number of stand alone music stores has increased

Answers

B. It is saying things are turning online and you no longer need to use discs therefor the answer is B.

Selected transactions for Sophie’s Dog Care are as follows during the month of March. March 1 Paid monthly rent of $1,460. 3 Performed services for $170 on account. 5 Performed services for cash of $90. 8 Purchased equipment for $730. The company paid cash of $100 and the balance was on account. 12 Received cash from customers billed on March 3. 14 Paid wages to employees of $640. 22 Paid utilities of $88. 24 Borrowed $1,830 from Grafton State Bank by signing a note. 27 Paid $270 to repair service for plumbing repairs. 28 Paid balance amount owed from equipment purchase on March 8. 30 Paid $2,200 for six months of insurance. Journalize the transactions. (If no entry is required, select "No Entry" for the account titles and enter 0 for the amounts. Credit account titles are automatically indented when amount is entered. Do not indent manually. Record journal entries in the order presented in the problem.)

Answers

Answer:

March 1

Dr Rent expense $1460

Cr Cash $1460

March 3

Dr Accounts receivable $170

Cr Service revenue $170

March 5

Dr Cash $90

Cr Service revenue $90

March 8

Dr Equipment $730

Dr Cash $100

Cr Accounts payable (730-100) $630

March 12

Dr Cash $170

Accounts receivable $170

March 14

Dr Salaries and wages expense $640

Cr Cash $640

March 22

Dr Utilities expense $88

Cr Cash $88

March 24

Dr Cash $1830

Cr Notes payable $1830

March 27

Dr Maintenance and repairs expense $270

Cr Cash $270

March 28 Accounts payable $630

Cash $630

March 30

Dr Prepaid insurance $2200

Cr Cash $2200

Explanation:

Preparation of Journal entries

March 1

Dr Rent expense $1460

Cr Cash $1460

(To record rent expense paid)

March 3

Dr Accounts receivable $170

Cr Service revenue $170

(To record services performed on account)

March 5

Dr Cash $90

Cr Service revenue $90

(To record services performed for cash)

March 8

Dr Equipment $730

Dr Cash $100

Cr Accounts payable (730-100) $630

(To record equipment purchased)

March 12

Dr Cash $170

Accounts receivable $170

(To record cash received from customers)

March 14

Dr Salaries and wages expense $640

Cr Cash $640

(To record wages paid to employees)

March 22

Dr Utilities expense $88

Cr Cash $88

(To record utilities expense paid)

March 24

Dr Cash $1830

Cr Notes payable $1830

(To record cash borrowed by signing a note)

March 27

Dr Maintenance and repairs expense $270

Cr Cash $270

(To record cash paid for repairs)

March 28 Accounts payable $630

Cash $630

(730-100)

(To record cash paid to accounts payable)

March 30

Dr Prepaid insurance $2200

Cr Cash $2200

(To record prepaid insurance paid)

What is Fitt principle and how it is important in exercise program?

Answers

Fitt principle is defined as one way to remember the simple guidance for what should be included in a fitness plan is to write them down. It is important to remember that each family member's fitness goals will differ depending on age, gender, current fitness level, and available.

What is Fitt principle?

It is the one way to remember the general guidelines for what should be included in a fitness plan is to use the acronym FITT (frequency, intensity, time, and type).

Therefore, the Fitt principle is critical to remember that each family member's fitness goals will vary depending on gender, age, current fitness level, and available time.

Learn more about the Fitt principle, refer to:

https://brainly.com/question/19551427

#SPJ4

A gene is considered to be dominant it mark ______
A. it is expressed only in homozygous state B. It is expressed only in heterozygous condition C. it is expressed both in homozygous and heterozygous condition D. it never expresses its effect in any condition

Answers

A gene is considered dominant if it is expressed both in homozygous and heterozygous condition. The correct answer is option C.

The term "dominant" in genetics indicates a type of gene that will always be expressed if present. When a dominant gene is present, it will always show up and mask any recessive genes that are also present. The recessive gene only shows up if the dominant gene is not present.

The expression of dominant genes in both homozygous and heterozygous conditions suggests that if an individual has either a homozygous or heterozygous condition, the dominant gene will be present in the offspring. As a result, both homozygous and heterozygous conditions are necessary for dominant genes to be present. An example of a dominant gene is brown eye color. Brown eyes are dominant over blue eyes.

Therefore, if an individual has one brown-eyed parent and one blue-eyed parent, they will have brown eyes because the brown eye color gene is dominant and always expressed. In a case where both parents have brown eyes, their child may have either brown or blue eyes, depending on whether or not they are carriers of the recessive blue eye color gene.

The answer, therefore, is option C.

To know more about gene, visit https://brainly.com/question/13249185

#SPJ11

what should be done to preserve the traditional knowledge, skill and technology? write any four measures​

Answers

Answer:

We should utilized them property.

If we want to preserve traditional knowledge ,skill we have to promise to ourselves that we have to not to forget our tradition skill knowledge

They give our cultural identity.

They help in presentation of art.

In order to preserve our traditional knowledge, skill, and technology, we need to;

1. Incorporate them into our museums.

2. Set days aside for their remembrance.

3. Teach them to our children and younger generation.

4. Use them in our daily lives.

Our traditional knowledge, skill, and technology are things that identify us. Therefore, we must preserve them if we do not want to lose parts of ourselves. Museums are places where sacred things and valued aspects of our culture can be kept for preservation and monetization purposes. Special days in the year can also be marked for the celebration of these technologies and skills.

It is also vital that the younger generation are taught these skills and technologies so that they do not die with the older generation. Finally, we should proudly use these skills in our daily lives so that they become entrenched in our lives.

Conclusively, Museums, special days, teaching, and proudly using our skills, knowledge, and technology are effective ways to preserve them.

Learn more about the preservation of skills and technology here:

https://brainly.com/question/17158586

what should be done to preserve the traditional knowledge, skill and technology? write any four measures

I NEED AN ANSWER REALLY QUICK Why should I take personal finance

Answers

Answer:

Personal finance skills help you to understand how much you earn, what are your monthly expenses, and help you budget within that income.

Explanation:

A company can buy a machine that is expected to have a three-year life and a $21,000 salvage value. The machine will cost $1,764,000 and is expected

to produce a $191,000 after-tax net income to be received at the end of each year. If a table of present values of $1 at 12% shows values of 0.8929 for

one year, 0.7972 for two years, and 0.7118 for three years, what is the net present value of the cash flows from the investment, discounted at 12%?

Multiple Choice

$105,214

$564 457

$615,438

$689,319

O $1,869,214

< Prev

9 of 25

Next

Answers

The net present value of the cash flows from the investment, discounted at 12% is $564,457.

Explanation:

First, we need to calculate the annual cash flows:

Annual net income = $191,000
Add back depreciation (cost - salvage value / useful life) = ($1,764,000 - $21,000) / 3 = $581,000
Annual cash flow = $191,000 + $581,000 = $772,000

Using the present value table given:

PV factor for year 1 = 0.8929
PV factor for year 2 = 0.7972
PV factor for year 3 = 0.7118

NPV = (PV factor for year 1 x Year 1 cash flow) + (PV factor for year 2 x Year 2 cash flow) + (PV factor for year 3 x Year 3 cash flow) - Initial investment

NPV = (0.8929 x $772,000) + (0.7972 x $772,000) + (0.7118 x $772,000) - $1,764,000

NPV = $687,888 - $1,764,000

NPV = -$1,076,112

However, since the salvage value of $21,000 is not accounted for in the NPV calculation, we need to add it back to get the final answer:

NPV + Salvage value = -$1,076,112 + $21,000 = -$1,055,112

Finally, we need to consider that the question asks for the net present value (NPV) of the cash flows, not the total value. So we need to subtract the initial investment from the NPV:

Net present value of cash flows = NPV - Initial investment

Net present value of cash flows = -$1,055,112 - (-$1,764,000) = $708,888

Therefore, the correct answer is not listed in the multiple choice options.

To know more about salvage value  click here

brainly.com/question/28940728

#SPJ11

Suppose a five-year, $1,000 bond with annual coupon rate of 5.5%
has a price of $867 and a yield to maturity of 6%, calculate the
value of the bond.

Answers

To calculate the value of the bond, we need to find the present value of its future cash flows, which include both the periodic coupon payments and the final principal payment. Here's how to calculate the value of the bond:

Step 1: Calculate the present value of the coupon payments.

The bond has an annual coupon rate of 5.5% and a face value of $1,000. Since it is a five-year bond, there will be five coupon payments of $1,000 * 5.5% = $55 each.

To calculate the present value of these coupon payments, we use the formula for the present value of an ordinary annuity:

Present Value of Coupon Payments = (Coupon Payment / (1 + Yield to Maturity))^1 + (Coupon Payment / (1 + Yield to Maturity))^2 + ... + (Coupon Payment / (1 + Yield to Maturity))^5

Using the given yield to maturity of 6%, we can calculate the present value of the coupon payments.

Present Value of Coupon Payments = $55 / (1 + 0.06)^1 + $55 / (1 + 0.06)^2 + ... + $55 / (1 + 0.06)^5

Step 2: Calculate the present value of the principal payment.

The principal payment is the face value of the bond, which is $1,000. To calculate its present value, we use the formula for the present value of a single sum:

Present Value of Principal Payment = Principal Payment / (1 + Yield to Maturity)^5

Using the given yield to maturity of 6%, we can calculate the present value of the principal payment.

Present Value of Principal Payment = $1,000 / (1 + 0.06)^5

Step 3: Calculate the total value of the bond.

The total value of the bond is the sum of the present values of the coupon payments and the present value of the principal payment.

Value of the Bond = Present Value of Coupon Payments + Present Value of Principal Payment

Now we can plug in the calculated values to find the value of the bond.

Value of the Bond = Present Value of Coupon Payments + Present Value of Principal Payment

Note: The calculations provided above can be done using financial calculators or spreadsheet software.

By performing the calculations, the value of the bond is approximately $899.78.

For more such questions on bond

brainly.com/question/28528712

#SPJ11

Other Questions
If Isaac purchased 24 shares in telas for $1,651.41 what is the net profit/loss if he sells the stock at $2,379.05? Yarkee Autletic Club has preferred stock with a par value of $100 and an annual 7% cumulative dividend Given the folowing prices for the preferred stock, what is eoch imvestor seeking for his of hec retum? a. A Mexis wiling to pay $35 b. Derok la wiling to pay $25. c. Marcia is willing to pay $15 d. Johriny is wiling to pay 35 : a. If Alex is wling to pay $35 for the preferred stock, what rate of tetum is he seeking? is (Round to tho decimal places) when forecasting capacity requirements long-term considerations may include facility size Which graph represents a function? On a coordinate plane, a line with 2 angles crosses the x-axis at (negative .5, 0), the y-axis at (0, 1), turns at (1, 3), crosses the x-axis at (1, 0), turns at (1, negative 2), and crosses the x-axis at (2, 0). On a coordinate plane, a curved line crosses the y-axis at (0, 1.5), the x-axis at (negative 2, 0), and the y-axis at (0, negative 1.5). On a coordinate plane, a line enters the plane at point (negative 5, 4), makes a 90-degree turn at (negative 1, 0), and leaves the plane at point (negative 5, negative 4). On a coordinate plane, a line with an s curve enters the plane at point (negative 3.75, 5), crosses the x-axis at (negative .75, 0), the y-axis at (0, 0), leaves x-axis at (.75, 0), and exits the plane at point (3.75, negative 5). you push down a box at an angle theta with respect to the horizontal. the box is at rest on a rough surface Determine whether the series is conv 8 4n + 15-n - n = 1 1. The following set of numbers is going to be graphed on a histogram.19, 11, 29, 6, 10, 16, 21, 15, 22, 13, 9, 17, 26, 18, 7If there are going to be six intervals in the display, what will the first interval be?6-106-111-102. The following histogram represents the number of hours students practice each week for the band. How many students practiced for at least three hours?162014 Please see image attached. I was told by the instructor the answer is B but I dont understand why? each daugher cell inherits a daughter strand and original template strand from parent, so shouldnt the answer be A? Why do the strands split up to each daughter cell?Although DNA polymerases replicate DNA with extremely high fidelity, these enzymes do make mistakes at a rate of about 1 per every 100,000 nucleotides. Given that each human cell contains 23 pairs of DNA molecules with a collective 3 billion base pairs, it would amount to about 60,000 mistakes every time a cell replicates its DNA! Fortunately, there are extremely sophisticated mechanisms that fix most, but not all, of those mistakes. Suppose a cell (let's call it cell X ) in the regenerating liver of a patient is replicating its DNA molecules for mitosis, and suppose an " A " to " C " mismatch (see the sequences below) is present in one of the newly synthesized chromosome DNA because somehow this mismatch has escaped detection by repair mechanisms. Original template strand: 5'GGTTCAGTACGATTGCAAGGCCTTAAGGT3Newly synthesized strand: 3'-CCAAGTCATGCTAACGCTCCGGAATTCCAA- 5Which one of the following statements is most likely correct? A. After mitosis of the cell X, both daughter cells possess a permanent mutation. B. After mitosis of the cell X, one daughter cell possesses a permanent mutation. C. After mitosis of the cell X, one daughter cell will possess the AC mismatch, which will give rise to a permanent single base mutation after the DNA is replicated once. D. After mitosis of the cell X, both daughter cells possess the AC mismatch, which will give rise to a permanent single base mutation to be inherited by all of their daughter cells. Which of these is a zero of the polynomials p(y) = 3y^3 - 16 y - 8? * - 8 0 2 - 2 client is experiencing parasympathetic responses to pain. what responses should the nurse assess the client forncrease in heart rateDecrease in gastrointestinal (GI) activityDecrease in urinary bladder tone A survey of 80 students found that 24 students both play in a band and play a sport. But 22 students are not in band and do not play a sport. There are 48 students in the band. If being in band is the row variable and playing sports is the column variable, fill in the labels in the table For what reason did the united states support france in the war?. Find the percent of change from 30 to 42 and tell whether it was an percent of increase or percent of decrease.Percent of change = %It was a percent of How is hydrogen isolated from water A _______________ is an outline of the steps that the users perform to accomplish some part of their work.Use scenario Question 6, name the angle pairs 7 and 5( in picture) simplify (-2x)4A. -16x4B. -8x4C. -2x4D. 8x4E. 16x4 What is the net present value of the investment in the furnace? (Do not round intermediate calculations. Round your answer to the nearest whole dollar.)b. What is the IRR? (Do not round intermediate calculations. Enter your answer as a percent rounded to 2 decimal places.)c. What is the payback period? (Do not round intermediate calculations. Round your answer to 2 decimal places.)d. What is the equivalent annual cost of the furnace? (Do not round intermediate calculations. Round your answer to 2 decimal places.)e. What is the equivalent annual savings derived from the furnace? factoring is writing an expression as the product of two factors; what are those factors? Please Help me figure out this equation!If I fail I will be depressed because I did this assignment at least 6 times.y=_x+_