losing fluids (water) through sweat and urine is called what?

Answers

Answer 1

Losing fluids (water) through sweat and urine is called excretion.

Excretion is the process by which waste products and excess substances, including fluids, are eliminated from the body. Sweating and urine formation are two important mechanisms through which the body gets rid of excess water.

Sweating: When the body temperature rises, sweat glands produce sweat, a mixture of water, electrolytes, and waste products. Sweating helps regulate body temperature by evaporating from the skin's surface, cooling the body. This process helps maintain the body's internal temperature within a narrow range.

Urine Formation: The kidneys play a vital role in maintaining the body's fluid balance by filtering waste products, excess water, and other substances from the blood. The kidneys produce urine, a liquid waste product that contains water, electrolytes, and metabolic waste products. Urine formation involves filtration, reabsorption, and secretion processes within the kidneys, ultimately leading to the elimination of excess water and waste products from the body.

Overall, the processes of sweating and urine formation are essential for excreting fluids, primarily water, from the body. These mechanisms help maintain homeostasis and ensure proper hydration levels in the body.

Learn more about excretion here:

https://brainly.com/question/32274304

#SPJ11


Related Questions

When large amounts of carbohydrates have been digested and absorbed, what process will happen first?

Answers

When large amounts of carbohydrates have been digested and absorbed, the first process that occurs is the increase in blood glucose levels.

Carbohydrates are broken down into glucose during digestion, and glucose is then absorbed into the bloodstream through the small intestine. As a result, the concentration of glucose in the blood rises.

To maintain stable blood glucose levels, the body initiates a series of processes to regulate glucose utilization and storage. The first response to elevated blood glucose levels is the release of insulin from the pancreas. Insulin acts as a hormone that facilitates the uptake of glucose by cells, primarily in the liver, muscle, and adipose tissue. This process allows glucose to be used as an immediate energy source or stored as glycogen (in the liver and muscle) or converted into triglycerides and stored as fat in adipose tissue.

So, after the digestion and absorption of carbohydrates, the initial response is an increase in blood glucose levels, followed by the release of insulin to regulate glucose utilization and storage in the body.

know more about carbohydrates here

https://brainly.com/question/19624432#

#SPJ11

The Hawaiian Islands are examples of ______________ volcanoes.

Answers

Answer:

shield

Explanation:

trust me

known as a ‘ shield ‘ volcanoes.

which of the following represent the process of acclimation (select all that apply)? group of answer choices carnivorous species have sharp teeth that allow them to tear flesh and subdue prey. global temperature increases in response to increased carbon dioxide in the atmosphere from the burning of fossil fuels a plant transplanted to a warmer from a cooler climate develops thicker, waxier coatings on its leaves. native aleutians have barrel-shaped bodies with shorter arms and legs relative to their height to reduce heat loss. humans native to temperate latitudes tan in the summer months when exposure to the sun is greatest

Answers

The process of acclimation is represented by: a plant transplanted to a warmer climate developing thicker, waxier coatings on its leaves, and humans native to temperate latitudes tanning in the summer months with increased sun exposure.

Acclimation is the process by which an organism adjusts to a new environment or changes in its environment to improve its chances of survival. In the case of the plant, it adjusts to the warmer climate by producing thicker, waxier coatings on its leaves to reduce water loss and protect against high temperatures. For humans, exposure to increased sunlight in the summer months triggers the production of melanin in the skin, resulting in a tan, which provides some protection against the harmful effects of ultraviolet radiation.

It is important to note that acclimation is different from adaptation, which involves genetic changes over many generations. Acclimation occurs during an organism's lifetime and can be reversed if the organism is returned to its original environment.

Learn more about sun exposure here:

https://brainly.com/question/30891025

#SPJ11

How many cells are estimated to be in
the human body?

Answers

In humans ,cell are many ,in each section of our body,its estimated to millions of cells found in our body.

Which of the following was NOT a goal for building a closed ecological system like Biosphere 2? To build a potential refuge on Earth if conditions deteriorated. Learn how to grow food for free. To provide a habitat for living on Mars. To learn more about Biosphere 1.

Answers

The goal for building a closed ecological system like Biosphere 2 was multi-faceted and included several objectives. However, of the options you have provided, the goal that was NOT a primary objective for building Biosphere 2 was "To provide a habitat for living on Mars."

While the possibility of colonizing Mars has been a topic of interest for scientists and researchers, it was not a primary goal for building Biosphere 2.

The main goals for Biosphere 2 were to create a closed system that could sustain human life, to study the interactions between living organisms and the environment, and to develop technologies and techniques for future space exploration. The project aimed to test the viability of a self-sustaining ecosystem and to provide insight into the challenges of creating and maintaining such a system.

The project also focused on studying the role of plants in the ecosystem, including their ability to produce oxygen and food, as well as the effects of carbon dioxide levels on the environment. Additionally, Biosphere 2 aimed to provide an opportunity for scientists and researchers to learn more about Biosphere 1 (Earth) by studying the similarities and differences between the two systems.

In conclusion, while providing a habitat for living on Mars has been a topic of interest, it was not a primary objective for building Biosphere 2. The project focused on creating a self-sustaining ecosystem, studying the interactions between living organisms and the environment, and developing technologies for future space exploration.

To know more about ecological system, refer

https://brainly.com/question/214971

#SPJ11

16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe

Answers

The phenotype is affected by mutations 1 and 2 because in the first, the complete protein is altered, and in the second, the new amino acid may cause the protein to have altered or no function.

What is Mutation?

Mutations can happen naturally or as a result of UV rays, congenital conditions, ionic radiations, or specific free radicals.

Even with the point mutation, there is no alteration to the amino acid sequence, hence the protein will not be affected.

In mutation 1, a new nucleotide is added at codon 9, changing the whole sequence of amino acids and codons in the process,  mutation frameshift.

Because a new codon was created as a result of the substitution of one nucleotide by another in mutation 2, produced a new amino acid, so Point mutation.

Therefore, in mutation 3, one nucleotide is swapped out for another, and the resulting codon codes the same amino acid as the one before it, so point mutation.

Learn more about mutation, here:

https://brainly.com/question/17130462

#SPJ4

Please tell us two things that PAL does to develop human
resources.

Answers

The Program for Alternative Learning (PAL) develops human resources through vocational training and skills development programs.

PAL offers vocational training programs that equip individuals with practical skills and knowledge in various fields, enabling them to pursue employment opportunities and contribute to the workforce. Additionally, PAL provides opportunities for personal and professional growth through workshops, seminars, and mentoring, fostering the development of essential skills and qualities required in the job market.

PAL's focus on vocational training and skills development programs demonstrates its commitment to nurturing and enhancing human resources. By equipping individuals with valuable skills and providing them with opportunities for personal and professional growth, PAL plays a vital role in empowering individuals, enhancing employability, and contributing to the development of human resources in the community.

To know more about The Program for Alternative Learning click here:

https://brainly.com/question/31261482

#SPJ11

what is a turgid cell

Answers

Answer:

turgid refers to cells or tissues that are swollen from water uptake. Many cell types in many different organisms can become turgid due to water uptake. Some cells will lyse, or split open if they become too turgid.

Answer:

Explanation: turgid refers to cells or tissues that are swollen from water uptake. Many cell types in many different organisms can become turgid due to water uptake. Some cells will lyse, or split open if they become too turgid.

Under the influence of FSH, the androgens are taken up by the ________________ of the follicle and then are converted into estrogens.

Answers

Under the influence of FSH, the androgens are taken up by the granulosa cells of the follicle and then are converted into estrogens. Granulosa cells are the primary cells found in the follicles of the ovary.

They are responsible for producing and secreting estrogen in response to the follicle-stimulating hormone (FSH) released by the pituitary gland.Follicles in the ovaries are hormone-responsive structures that house the immature egg. When the egg is released (ovulation), the follicle ruptures and is transformed into the corpus luteum. The corpus luteum secretes progesterone, which supports the uterine lining in preparation for implantation. The granulosa cells in the follicle have the ability to convert androgens, such as testosterone, into estrogen. This conversion process is called aromatization, and it requires an enzyme called aromatase.

The estrogen produced by the granulosa cells plays a vital role in the development of the female reproductive system, as well as in the regulation of the menstrual cycle.

To know more about Endrogen visit-

https://brainly.com/question/31674074

#SPJ11

The 'awakening that colonists underwent during the Great Awakening involved
A
a renewed dedication to intellectual pursuits.
B)
finding new personal meaning in religion.
a drive to achieve social justice.
D)
devoting oneself to civil service.

Answers

Answer:

B) finding new personal meaning in religion

Explanation:

• In your own words, discuss the role of each of the following structures in the whole process: cell membrane, vesicles (at two points in the process), ribosomes, Golgi apparatus, and endoplasmic reticulum

Answers

Answer:

1:to allow movement of small molecules in and out of cell

2

What is the relationship between the cancer rates and the different species? Please give a detailed and long answer

Answers

Different species and cancer rates have a complicated and nuanced relationship.

All multicellular organisms, including people, animals, and plants, are susceptible to cancer. The prevalence of cancer varies greatly between species, and a variety of factors play a role in this difference.

The relationship between the cancer rates and the different speciesThe longevity of a species is one factor that influences cancer rates. In general, cancer rates are higher in longer-living species than in shorter-living species. This is due to the fact that as an organism age, it has a greater chance of developing genetic mutations, some of which may result in cancer. For instance, mice have a shorter lifespan than humans and have a higher incidence of cancer.The habitat that a species lives in has an impact on cancer rates as well. Both humans and animals are at an increased risk of developing cancer when exposed to environmental pollutants and carcinogens. As an illustration, while exposure to some environmental pollutants has been related to cancer in animals, exposure to ultraviolet light from the sun is a significant risk factor for skin cancer in people.The prevalence of cancer in many species is also influenced by genetics. Certain species may have a hereditary predisposition to particular cancer kinds. For instance, compared to other dog breeds, some breeds have a greater prevalence of certain cancers like lymphoma and bone cancer.

In conclusion, there are numerous complex factors at play in the association between cancer rates and various species.

The incidence of cancer varies greatly among species, depending on factors such as life expectancy, the environment, genetics, nutrition, and lifestyle.

learn more about cancer here

https://brainly.com/question/26059802

#SPJ1

difference between clarias gariepinus and hetrobranchus bidorsalis?​

Answers

Answer:

The clarias gariepinus or african sharptooth catfish , belongs to the Clariidae family of airbreathing catfishes. They exist in freshwater lakes, rivers, and swamps, as well as man-made environments like oxidation ponds and even urban sewage systems, throughout Africa and the Middle East.

Hetrobranchus bidorsalist, he African catfish, sometimes known as the eel-like fatty fin catfish, is an airbreathing catfish found in Africa. It has a lot in common with the vundu catfish, which is well-known among anglers.

--------------------------------

\(\textbf{HOPE IT HELPS}\)

\(\textbf{HAVE A GREAT DAY!!}\)

Which of the following is the major charge carriers involved in the conduction of electricity in neurons?

Answers

Cations are positively charged ions, and they are the major charge carriers involved in the conduction of electricity in neurons.

Neurons generate and transmit electrical signals called action potentials, which rely on the movement of ions across the neuron membrane. During an action potential, cations such as sodium (Na⁺) and potassium (K⁺) ions play crucial roles. At rest, the inside of the neuron is negatively charged compared to the outside, creating a resting membrane potential.

When an action potential is initiated, the neuron membrane becomes permeable to sodium ions, causing an influx of positively charged sodium ions into the neuron. This depolarizes the membrane and triggers the propagation of the action potential. Subsequently, potassium ions flow out of the neuron during repolarization, restoring the resting membrane potential. Therefore, cations, specifically sodium and potassium ions, are the primary charge carriers involved in the conduction of electricity in neurons.

To learn more about neurons, here

https://brainly.com/question/10706320

#SPJ4

The complete question is:

Which of the following is the major charge carriers involved in the conduction of electricity in neurons? Choose the correct option.

A) AnionsB) CationsC) IonsD) Ionic bonds

Which region of Oklahoma is home to Lake Eufaula? A. the Prairie Plains B. the Sandstone Hills C. the Red River Plains D. the Red Beds Plains ​

Answers

Answer:

The Prairie Plains

Explanation:

I had the exact same question

Answer:

The Prairie Plains

Explanation:

Anemia is a medical condition in which the affected person lacks enough red blood cells. What two effects will such a condition have on the patient?

The patient will have less hemoglobin in the blood.
The patient will have less immunity against bacteria.
The patient will have a reduced oxygen supply to the cells.
The patient will have a thicker blood composition.
The patient will have increased platelets in the body

Answers

Answer:

The patient will have a reduced oxygen supply to the cells

Answer:

The patient will have a reduced oxygen supply to the cells

Explanation:

edmentum

What do geologists look at for proof that earths core contains mostly iron? A. The sun. B. Comets. C. The moon. D. Other planets

Answers

Answer:

A. The sun

Explanation:

The sun, because there has been theory’s of the sun being able to heat earth from there being a lot of iron in the middle of earth

Answer:

B. Comets

Explanation:

Just finished the exam

does cellular respiration requires nutrients or glucose?​

Answers

Answer:

Every cell of the body needs oxygen for the process of cellular respiration by which the energy in food is converted into energy that can be used by the body's cells. During cellular respiration, glucose and oxygen are converted into carbon dioxide and water, and the energy is transferred to ATP.

Does GONORRHEA What microbe causes your disease?

Answers

Gonorrhea is a sexualy transmitted deasease caused by a bacteria called Neisseria gonorrhoeae.

why are some types of organisms much more commonly fossilized than others?

Answers

Answer:

The enamel and dentin of teeth are harder than bone and as a result, teeth are more likely to be fossilized than other parts of a vertebrate.

Explanation:

PLEASE QUICK!!!!
Complete the analogy

Cells : _______ :: Species : Population

Answers

Answer:

There are more but there is only one blank so,

The answer should be Organism (?)

WILL GIVE 30 POINTS
Which of the following does a weather station model demonstrate? O altitude air mass air density temperature​

Answers

It is alutityde air

Answer:

Your answer is D) Temperature.

Is Standing on a diving board a Kinetic energy or potential energy

Answers

Answer:

Explanation:

Potential Energy. This diver is standing at the end of the diving board, ready to dive. After he/she dives and is falling toward the water, they'll have kinetic energy, or the energy of moving matter. But even as they stand motionless high above the water, he/she has energy

A 70 year-old man is complaining of severe nausea. He has had problems with peptic ulcer disease and has been having similar pain for the past two weeks. Rather than seeing a physician, he opted to self medicate. Over the past week, he has been consuming large quantities of TUMS (calcium carbonate), an over the counter antacid. While breathing room air, an arterial blood sample is drawn and reveals the following: pH = 7.48, PaCO2 = 49 mm Hg, PaO2 = 68 mm Hg, HCO3? 35 mEq/L, Na+ = 139 mEq/L, K+ = 4 mEq/L, Cl? = 96 mEq/L, and glucose = 387 mg/dL. The most likely explanation for the observed hypoxemia is:
A) hypoventilation that is secondary to a metabolic alkalosis
B) hyperventilation that is secondary to calcium toxicity
c) altitude-induced hyperventilation
d) a leftward shift of the oxyhemoglobin curve
e) hypoventilation that is secondary to diabetic keto acidosis

Answers

A) hypoventilation that is secondary to metabolic alkalosis is the most likely explanation for the observed hypoxia.

What is Hypoxia?

Hypoxia is a state in which oxygen is not available in sufficient amounts at the tissue level to maintain adequate homeostasis; this can result from inadequate oxygen delivery to the tissues either due to low blood supply or low oxygen content in the blood (hypoxemia).

Due to the high use Of antacid TUMS ( calcium carbonate), there is a decrease in acidic levels eventually leading to an increase of condition metabolic alkalosis. And resulting in hypovolemia, which leads to the secretion of aldosterone and renin and enhances the absorption of HCO3. Persistent metabolic alkalosis reflects the inability of the kidney to excrete HCO3. Hence to counter the effect of alkalosis respiratory system generate a typical response that is hypoventilation leading to pH correction to normal.

To learn more about hypoxia the link is given below:

https://brainly.com/question/14562564

#SPJ4

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as:

Answers

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as homeostatic mechanisms.

Homeostasis is the body's ability to maintain a stable internal environment despite external changes.

In the context of the brain, homeostatic mechanisms involve various processes that regulate physiological functions and maintain optimal levels of essential substances.

These mechanisms can include feedback loops that detect imbalances and initiate corrective actions.

For example, if there is a deficiency in a particular nutrient or hormone, the brain may activate mechanisms to increase its production, decrease its consumption, or enhance its absorption from the environment.

Homeostatic mechanisms play a crucial role in ensuring the body's overall stability and functioning, helping to maintain proper levels of various substances and promoting overall well-being.

To know more about Homeostasis, refer here:

https://brainly.com/question/15647743#

#SPJ11

carol a. rotilie rjf, richard b. prior, and robert l. perkins. microdilution technique for antimicrobial susceptibility testing of anaerobic bacteria. antimicrob agents chemother. 1975;7(3):311–5.

Answers

The article you mentioned is titled "Microdilution Technique for Antimicrobial Susceptibility Testing of Anaerobic Bacteria" and was published in the journal Antimicrobial Agents and Chemotherapy in 1975. The authors of the article are Carol A. Rotilie RJF, Richard B. Prior, and Robert L. Perkins.

The microdilution technique mentioned in the article is a method used for testing the susceptibility of anaerobic bacteria to antimicrobial agents. Anaerobic bacteria are a type of bacteria that can survive and grow in environments with little or no oxygen.
The technique involves diluting different concentrations of antimicrobial agents and adding them to wells in a microplate. Then, a standardized amount of the bacteria is added to each well. The microplate is incubated, and the growth of the bacteria is observed. The lowest concentration of the antimicrobial agent that inhibits bacterial growth is considered the minimum inhibitory concentration (MIC).
This technique allows researchers to determine the effectiveness of different antimicrobial agents against anaerobic bacteria and provides valuable information for choosing appropriate treatment options. The article you mentioned is a significant contribution to the field of antimicrobial susceptibility testing.

To know more about bacteria visit:

https://brainly.com/question/15490180

#SPJ11

The correct question is

A microdilution technique for antimicrobial susceptibility testing of anaerobic bacteria. antimicrob agents chemother. 1975;7(3):311–5. Carol a. rotilie rjf, richard b. prior, and robert l. perkins.

how does an abundance of tryptophan inhibit the production of more tryptophan?

Answers

Tryptophan suppresses self-production as it builds up by activating a repressor protein, that binds towards the operator and prevents transcription. Tryptophan synthesis enzymes are not produced.

This repressor-tryptophan receptor complex to the trp operator when tryptophan is abundant. Because RNA polymerase cannot bind to this binding, the codon is not transcribed.  On the other hand, the operon is translated when tryptophan levels drop because the repressor is unable to bind the operator. It is wasteful to produce the tryptophan-synthesizing enzymes if tryptophan levels are elevated as well as its synthesis is not required because doing so is metabolically expensive. When tryptophan rates are elevated, a corepressor binds the repression protein to a operator sequence, suppressing the trp operon.

Learn more about tryptophan

https://brainly.com/question/29434320

#SPJ4

What is air, water and land pollution?

Answers

Answer:

Air, water, and land pollution is any form of harmful substance infecting air, water, and land. This can include factory fumes, plastics, chemicals (etc.)

I hope this helps!

The probabilities that an adult man has high blood pressure and/or high cholesterol are shown in the table.

a) What's the probability that a man has both conditions?

b) What's the probability that he has high blood pressure?

c) What's the probability that a man with high blood pressure has high cholesterol?

d) What's the probability that a man has high blood pressure if it's known that he has high cholesterol?

Answers

a) The probability that a man has both conditions is 0.3.
b) The probability that a man has high blood pressure is 0.5 + 0.3 = 0.8.
c) The probability that a man with high blood pressure has high cholesterol is 0.3/0.8 = 0.375.
d) The probability that a man has high blood pressure if it's known that he has high cholesterol is 0.3/0.4 = 0.75.

The probabilities that an adult man has high blood pressure and/or high cholesterol are shown in the table as below:| | High Cholesterol | No High Cholesterol || High Blood Pressure | 0.3 | 0.2 || No High Blood Pressure | 0.2 | 0.3 |a) The probability that a man has both conditions is 0.3.b) The probability that a man has high blood pressure is 0.5 + 0.3 = 0.8.

c) The probability that a man with high blood pressure has high cholesterol is 0.3/0.8 = 0.375. This is found by dividing the probability of having both conditions by the probability of having high blood pressure.d) The probability that a man has high blood pressure if it's known that he has high cholesterol is 0.3/0.4 = 0.75. This is found by dividing the probability of having both conditions by the probability of having high cholesterol.

Learn more about cholesterol here:

https://brainly.com/question/29661052

#SPJ11

can cell checkpoints fail in mitosis and meiosis​

Answers

Answer:

WHAT HAPPENS IF A CELL DOES NOT PASS THE MITOSIS CHECKPOINT? THE CELLS LINE UP ANY IMPROPELY ALIGNED CHROMOSOMES AND CORRECTLY ATTACHES ANY UNATTACHED OR IMPROPERLY ATTACHED CHROMOSOMES TO THE SPINDLE. ... THEY CAN TRIGGER THE NEXT PHASE OF THE CELL CYCLE OR THEY CAN DELAY THE NEXT PHASE OF THE CELL CYCLE.

Explanation:

SORRY CAPS ARE STUCK

Other Questions
according to the online processing model, members of the public may appear to be politically uninformed because Adam can buy 3 buckets of popcorn and 3 drinks for $25.50. Tanyacan buy 2 buckets of popcorn and 3 drinks for $19.50. How muchis one bucket of popcorn?$25.50O $4.75$6.00O $3.00 Mrs. Lin had two dozen pencils. She gave them to four students and asked them to share equally among them. How many pencils should each student get? disks that are formatted using the guid partitioning table (gpt) can hold larger volume sizes, and benefit from increased reliability provided by which feature below? GIVE EXAMPLES OF GOVERNMENT AGENCIES RELATED TO HEALTCARE. simplify the following expression completely: -14-(2x-8)+4(1/2x+6) HELP PYTHAGOREAN THEOREM plssss ASAP A uniform stick of length L is pivoted at one end on a horizontal table. The stick is held forming an angle with the table. A small block of mass m is placed at the other end of the stick and it remains at rest. The system is released from rest.(a) Prove that the stick will hit the table before the block if cos 0 2/3(b) Find the contact force between the block and the stick immediately before the system is released.Take 0=cos-1 (2/3).(c) Find the contact force between the block and the stick immediately after the system is released if 0 cos-1 (2/3). 6.3 Preterite tense of regular verbs Q El pretrito Complete these sentences with the preterite tense of the indicated verb.1. M arcela------------------------------------------------(encontrar) las sandalias debajo de la cama.2. Gustavo-------------------------------------------------------- (recibir) un regalo muy bonito.3. Sara y Viviana_______________________________ (terminar) el libro al mismo tiempo.4. La agente de viajes------------------------------------------------- (preparar) un itinerario muy interesante.5. (yo)--------------------------------------------------------------(visitar) la ciudad en invierno.6. Los dependientes------------------------------------------------- (escuchar) el partido por la radio.7. Patricia y t (viajar) a Mxico el verano pasado.8. (nosotras) (escribir) una carta al empleado del almacn.9. (t )------------------------------------------------- (regresar) del centro comercial a las cinco de la tarde.10. Ustedes------------------------------------------------------------ (vivir) en casa de sus padres.Ahora y en el pasado Rewrite these sentences in the preterite tense.1. Ramn escribe una carta al director del programa. jW l2. Mi ta trabaja de dependienta en un gran almacn.3. Comprendo el trabajo de la clase de ingls.4. La familia de Daniel vive en Argentina.5. Virginia y sus amigos comen en el caf de la librera.6. Los ingenieros terminan la construccin de la tienda en junio.7. Llevas un vestido muy elegante a la escuela.8. Los turistas caminan, compran y descansan.9. Corremos cada da en el parque.64 Leccin 6 Estructura Act ivit ies 2014 V ista H igher Learn ing, Inc. A ll r igh ts reserved.Nombre FechaO Confundido Your friend Mario has a terrible memory. Answer his questions negatively, indicating that what he asks already happened. Va a com prar ropa Silvia en el centro comercial?No, Silvia ya compr ropa en el centro comercial.1. Va a viajar a Per tu primo Andrs?2. Vas a buscar una tienda de computadoras en el centro comercial?3. Vamos a encontrar muchas rebajas en el centro?4. Va Mara a pagar las sandalias en la caja?5. Van a regatear con el vendedor Mnica y Carlos?6. Va a pasear por la playa tu abuela?Ef La semana pasada Now Mario wants to know what you did last week. Write his question, then answer it affirmatively or negatively.sacar fotos de los am igos Sacaste fo tos de los amigos? S, saqu fo tos de los amigos./No, no saqu fo to s de los amigos.1. pagar el abrigo con la tarjeta de crdito2. jugar al tenis3. buscar un libro en la biblioteca4. llegar tarde a clase5. empezar a escribir una carta Which phrase from the poem "Monets Waterlilies best describes how the water lilies are portrayed in this painting?poisons the air like falloutThe seen, the known / dissolveToday as the news from Selma and Saigonthe serene great picture that I love global warming might limit the availability of fresh water in many areas because of Write an algebraic expression for each phraseLet n represent am unknown numberQ1) The sum of five times a number and six ______ A bag contains 16 socks.One sock is chosen at random.The probability of selecting a black,white,or gray sock is 1.The probability of selecting a white sock is 3/4.Selecting a gray sock is less likely than selecting a black sock.Which statements describe the situation?Choose all the correct answers. given the parametric equations below, eliminate the parameter t to obtain an equation for y as a function of x Find the length of the hypotenuse, round to the nearest tenth if needed.C right side 8.4 left side 6.3 bottom10.5 A5.6 B110.3 C14.7 HELP PLEASE! Use the distributive property and combine like terms to simplify the expression.5(7x+5) A dietitian needs to understand all of the nutrition-related characteristics of diverse cultures. True or false evolution is the product of __________ and __________. ______ is the country that gives the most foreign aid in terms of dollars, but ______ routinely give more in terms of the percentage of their gross national income. When applying for jobs you should never skip reading the