jumbled letters:
cificepstrani eptonimicot :a competition among organisms of the same species

Answers

Answer 1

Answer:

Intraspecific competition


Related Questions

please help asap thank you !!!

please help asap thank you !!!

Answers

Answer:

Contour interval = 200

Explanation:

Which of the following subject areas is an example of a natural science? a. SEP b. philosophy c. anthropology. d. psychology.

Answers

An example of a natural science subject area is anthropology (option c). so the correct option is c.

Anthropology is a field of study that falls under the natural sciences, specifically social sciences. It focuses on the scientific study of humans, including their origins, evolution, behavior, and cultural diversity. Anthropology applies scientific methods and principles to understand human societies, cultures, and biological aspects.

On the other hand, the other options listed are not typically classified as natural sciences:

SEP (no commonly known meaning): Without further clarification, it is not possible to determine if SEP refers to a subject area related to natural sciences.

Philosophy: Philosophy is a branch of knowledge that deals with fundamental questions about existence, knowledge, ethics, and reasoning. While it employs critical thinking and logical analysis, philosophy is considered a humanities discipline rather than a natural science.

Psychology: Psychology is the scientific study of the mind, behavior, and mental processes. It is considered a behavioral science, falling under the broader domain of social sciences. Psychology involves the application of scientific methods to understand and explain human and animal behavior, cognition, emotions, and mental processes.

Therefore, among the options provided, anthropology is the subject area that is an example of natural science. so the correct option is c.

To know more about Anthropology: https://brainly.com/question/1799013

#SPJ11

What assumptions do you think are made in predicting population growth into the future?

Answers

Population growth, requires two core assumptions: birth and death rate, which will acount for population growth and decrease, respectively. As medicine develops, it is expected that there will be more succesful births, and that death rate will decrease. Regarding death rate, lifespan predictions are important factors that are required for population growth. Lifespan predictions might vary between countries, since income and country development are important issues influencing population lifespan.

Dalila plans an experiment to examine plant growth. She made a table to record her results.

What addition to her table would most improve her experimental investigation?

a row in which no fertilizer is used
a row in which 12 grams of fertilizer are used
a column that shows how the dependent variable changes
a column that shows how the independent variable changes

Answers

The addition to her table that would most improve her experimental investigation is a column that shows how the dependent variable changes. The correct option is C.

What is an experimental investigation?

An experiment is a procedure that a researcher uses to determine the viability of his idea. It is crucial to include both the “dependent” and “independent” variables in an experiment in order to do it right.

Any variable that alters as a result of the existence of an independent variable is referred to as a dependent variable. An independent variable, on the other hand, is a variable that is altered in order to control the experiment.

Therefore, the correct option is C. a column that shows how the dependent variable changes.

To learn more about the experimental investigation, refer to the link:

https://brainly.com/question/12042816

#SPJ1

Answer:c

Explanation:

if a sperm cell contains 8 chromosomes it comes from an animal that has .......chromosomes
a.4.
b.8
c.12
d.16
e.24

Answers

If a sperm cell has 8 chromosomes, it comes from an animal that has 16 chromosomes. Option D.

Haploid vs Diploid chromosomes

Diploid organisms generally have 2 sets of chromosomes in their genome. They are otherwise referred to as 2n organisms. However, these 2 sets of chromosomes are only present in their vegetative cells.

During reproduction and the formation of gametes, diploid cells divide to produce haploid sex cells such as sperm and eggs. This happens through meiosis. During meiosis, the diploid chromosome number becomes reduced to haploid (n) in the resulting daughter cells.

The daughter cells from meiosis eventually end up becoming the male or female gametes - sperm or eggs.

Thus:

2n = diploidn = haploid2n/2 = haploid

In other words, if a sperm cell contains 8 chromosomes, it must have come from an animal that has 16 chromosomes in its vegetative cells.

More on haploid and diploid cells can be found here: https://brainly.com/question/28342844

#SPJ1

Brady took a cutting from a sweet potato vine in his family garden and placed the vine in a small vase filled with water. After about a week, tiny roots had begun to grow. What is this an example of

Answers

Answer:This is an example of asexual reproduction.

Explanation:

Reproduction is defined as the ability of living organisms to produce offspring, that is, new individuals of their type. Living organisms have developed many methods of reproducing. These can be either ASEXUAL or SEXUAL.

Asexual reproduction: In asexual reproduction, an individual produces an offspring by itself, that is, only one parent is present. This type of reproduction is common among flowering plants. Examples of asexual reproduction includes:

--> Fission

--> Budding

--> Spore formation

--> Fragmentation and

--> Vegetative propagation.

The sweet potato vine is reproduced by an asexual means known as vegetative propagation. Here, a new plant grows from any portion of an old one other than the seeds. When stem cutting are taken from the vine, new storage roots are formed within few days.

Brady took a cutting from a sweet potato vine in his family garden and placed the vine in a small vase filled with water. After about a week, tiny roots had begun to grow which is an example of - Asexual reproduction.

Asexual reproductionis a type of reproduction that does not involve the fusion of gametes or change in the number of chromosomes.Examples of asexual reproduction include:   Fission  Budding  Spore formation  Fragmentation and  Vegetative propagation.In the given scenario sweet potato is cultivated by vegetative propagation.Brady takes stem cuttings from the vines, which then root and form new storage roots.Sweet potatoes are relatively easy to propagate by rooting vine cuttings directly in the ground or in a well-drained rooting media

Thus, The given case shows an example of - asexual reproductions.

Learn more:

https://brainly.com/question/13876478

Explain the sequence of events that occur in secondary succession as you would to a friend who had not yet learned about the process

Answers

The sequence of events that occur in secondary succession include:

Pioneer speciesIntermediate speciesClimax community.

What is Secondary succession?

This usually occurs when the primary succession has been disrupted through factors such as wildfire etc.

In this scenario, the existing vegetation is present which gives rise to the species listed above.

Read more about Secondary succession here https://brainly.com/question/1366104

#SPJ1

Why do some codons code for the same
amino acid as another codon?
A. It is due to mutations.
B. There are only 20 amino acids and 64 possible
combinations.
C. Each codon is unique and they all code for different
amino acids.

Answers

Answer: B

Explanation: Multiple different combinations of bases (A, G, C, T) can code for the same amino acid. This means that there are more possible combinations of the bases than there are amino acids. There are 20 amino acids and the four bases can have up to 64 different codon combinations.

2.4 State two reasons why the fern plants are able to
greater heights than the moss plants.
(2)
Coll
19)what is an underground stem

Answers

Answer:

Explanation:

This is because ferns are vascular plants i.e they have vascular tissues which are xylem and phloems which help to conduct water and nutrients while mosses are non vascular plants.

2. Ferns sporophytes are differentiated into true leaves, stems and true roots while mosses lack true roots, stems and leaves.

Underground stems are modified part of plants that are derived from stem tissues which grow under the ground. Underground stems grow beneath the soil. Examples include Rhizomes, ginger, tubers e t.c.

which part of the optical microscope is the eyepiece through which you view the image?

Answers

The eyepiece is an essential part of the optical microscope, and it is the part through which the user views the image.

The eyepiece is also known as the ocular lens, and it is placed at the top end of the microscope's body tube. The eyepiece is responsible for magnifying the image created by the objective lens. It is made up of several lenses arranged in a specific manner to enhance the image's clarity and sharpness. The magnification power of the eyepiece varies, but it usually ranges between 5x to 30x. The eyepiece works in conjunction with the objective lens, which is the lens that is closer to the object being viewed. The objective lens magnifies the image, and the eyepiece further magnifies it. Together, they produce a larger and more detailed image than the eye can see.

The eyepiece's quality is essential for producing clear and detailed images, and it is vital to ensure that it is kept clean and in good condition. In conclusion, the eyepiece is the part of the optical microscope that the user looks through to view the magnified image. It is responsible for enhancing the image produced by the objective lens and is made up of several lenses arranged in a specific manner to provide a clear and sharp image.

Learn more about optical microscope here:

https://brainly.com/question/14009956

#SPJ11

What type of scientist would be the best qualified to perform genetic engineering to pro- duce seed that are more productive in agriculture? A. biochemist B. geologist C. molecular biologist D. paleontologist

Answers

The type of scientist best qualified to perform genetic engineering to produce more productive seeds in agriculture would be a molecular biologist, the correct option is C.

Molecular biologists specialize in studying the structure, function, and interactions of molecules within biological systems, including DNA and genes. Genetic engineering involves manipulating the genetic material of organisms, which requires a deep understanding of molecular biology principles.

Molecular biologists have the expertise to identify and isolate specific genes responsible for desired traits in crop plants, such as increased productivity or resistance to pests or diseases. They can then modify or introduce these genes into target plants to achieve the desired outcomes, the correct option is C.

To learn more about genetic follow the link:

https://brainly.com/question/28980835

#SPJ4

If 15% of a DNA sample is made up of thymine, T,what percentage of the sample is made up of cytosine, C?
A)15%
B)35%
C)70%
D)85%

Answers

If thymine makes up 15 percent of the bases in a certain DNA sample, what percentage of bases must be cytosine? If the DNA is double stranded, A = T and G = C. If T = 15%, then C = 35%.

Aisha wonders whether wind or water causes the most erosion. She set up an experiment in which she used a watering can to pour water down a pile of dirt. She then used a fan to blow wind on a second pile of dirt that is the exact same shape and size as the first pile of dirt. Aisha then measured how the height of the dirt piles changed. She also drew pictures of how their shape changed. In this experiment, what was the dependent variable?

A. the height and shape of the dirt piles.

B. the tools used to measure the dirt piles.

C. the agent of erosion applied to the dirt piles.

D. the time the dirt piles were eroded away.

Answers

In this experiment, what was the dependent variable: A. the height and shape of the dirt piles.

In this experiment conducted by Aisha, the dependent variable is the factor that is being measured or observed as a result of the experiment. In this case, Aisha is measuring how the height of the dirt piles changes and also drawing pictures of how their shape changes. Therefore, the dependent variable in this experiment is the height and shape of the dirt piles.

The independent variable, on the other hand, is the factor that is deliberately manipulated or controlled by the researcher. In this experiment, the independent variable is the agent of erosion applied to the dirt piles, which is either water or wind.

The other options, B and D, are not the dependent variable in this experiment. The tools used to measure the dirt piles (option B) are likely the same for both piles and do not change based on the erosion agent. The time the dirt piles were eroded away (option D) may be recorded but is not the focus of measurement in this experiment.

Therefore, the dependent variable in Aisha's experiment is the height and shape of the dirt piles.

To know more about dependent variable, refer here:

https://brainly.com/question/1479694#

#SPJ11

Explain how sex-linked, codominant and incomplete dominant traits are passed on to offspring.

Answers

Sex-linked traits are genes carried on the sex chromosomes, the X and the Y chromosome. Only males carry the Y chromosome, and therefore all genes on the Y chromosome are passed down to the son. Women carry two X chromosomes; therefore, sex-linked traits can be passed on from both the mother and the father.

Examples of sex-linked traits include red-green colour blindness and haemophilia.

In codominance, both alleles are expressed in the phenotype of heterozygous offspring. The human ABO blood group is an example of codominance.

There are three alleles for the ABO gene: IA, IB, and I (i is recessive to both IA and IB). If an individual is heterozygous for both the IA and IB alleles, they will express both A and B antigens on their red blood cells. If they are homozygous for either IA or IB, they will express only one antigen on their red blood cells.

Incomplete dominance occurs when neither allele is dominant nor recessive, but instead, the phenotype is a blend of both. An example of incomplete dominance is the snapdragon flower, which has a red flower and a white flower. When the red flower is crossed with the white flower, the resulting offspring have pink flowers, which is a blend of red and white. The genotype for pink flowers is Rr, where R represents the red allele, and r represents the white allele.

When two pink flowers are crossed, their offspring will have a ratio of 1:2:1 of red, pink, and white flowers.

For more such answers on sex chromosomes

https://brainly.com/question/13125598

#SPJ8

Primary sensory areas of the brain have connections to association areas. What are the names, locations, and functions of the association areas for sight, hearing, and touch

Answers

Answer:

There is no short answer.

Explanation:

Association areas are mostly located in the cerebral cortex and they process the information coming from the sensory areas such as hearing, vision etc.

The association area for sight is located in the occipital lobe and it's name is striate cortex. It's main function is to process the signals coming from the eye.

The association area for hearing is located in the temporal lobe and it's main function is to process the information coming from the ears.

The association area for touch or the sensory association area is located in the cerebral cortex and it's main function is to process the signals coming from the sensory stimuli outside the body.

I hope this answer helps.

How does Force (physics term) play a role in the field of computer science please state its application, but also give some specificity to how it may be applied

Answers

Force is a significant concept in physics, and it has numerous applications in computer science. Computers and computer systems are based on physics principles and operate in accordance with these concepts.

The following are the applications of Force (physics term) in the field of computer science: Robotics Robots are designed and programmed to complete tasks that humans are unable to perform. The concept of force is critical in robotics since robots must mimic human movement and interaction. The theory of motion, which is founded on force, is employed in robotics to design robots that can move and perform tasks like humans. Haptic technologyHaptic technology allows users to interact with virtual objects and feel as if they are real. It is primarily used in virtual reality and gaming applications, and it relies heavily on the concept of force. Force feedback is used to simulate a virtual world where users may touch and feel items as though they were real.

Simulations Computer simulations are often utilized to predict outcomes and results. Force is used in simulations to model and predict the behavior of various systems. Computer simulations are used in a variety of fields, including engineering, physics, and environmental science, to test the viability of designs and concepts. Animation is a significant component of computer graphics, and it is used in movies, games, and other multimedia applications. Physics principles, including force, are used in animation to provide realistic and fluid motion to characters and objects. Consequently, force (physics term) plays a vital role in the field of computer science, and its applications are widespread. The use of force in computer science has enabled the development of sophisticated technologies such as robotics, simulations, and virtual reality.

To know more about numerous visit:

https://brainly.com/question/32380554

#SPJ11

ANSWER QUICKLY WILL GIVE BRAINLIEST TO THE FIRST PERSON TO ANSWER A REAL ANSWER

Jasmine went to the tide pool. She took pictures of some animals. How can you tell which tide zone the animals live in?

Answers

Answer:

food and population

Explanation:

Different animals eat different things for example a sea urchin eats seaweed so if she took a picture of a urchin you would find it in the one that has the most vegetation. the urchins try to space out so look how many animals are in the picture. I hope that helps ;)  

Answer:

food and population :)

Explanation:

please give brainliest?! :):):)

Earth's __
is slowing down overall because of tidal forces between Earth and the
moon. Roughly every 100 years, the day gets about 1.4 milliseconds, or 1.4 thousandths of a
second, longer.
a. Rotation
b. Revolution
C. Tilt
d. Orbit

Answers

Earth's rotation is slowing down overall because of tidal forces between Earth and the moon. Roughly every 100 years, the day gets about 1.4 milliseconds, or 1.4 thousandths of a second, longer.

Hope this helps!

what is constitution laws???​

Answers

Answer:

Hope it is really help full
what is constitution laws???

The law made on the basis of constitution and the law which has been considered as the legal law is known as the constitution law.

What is constitution law?

Higher law refers to the law that is deemed as superior above other legislations that are made after. In United States, the US constitution is what considered to be the higher law.

The US constitution was created in 1787. Every single law that was created after that can't violate/cross the law written within constitution. Even until today, every laws proposed by congress need to undergone a "judicial review" where the supreme courts will decide whether that law proposal is violating any part of the constitution.

There are the major characteristics of the Higher law and these are mentioned below:

- Create a strong protection for people's basic right.

- Lay out a set of government responsibilities to protect the people.

- Create a distinct limitation on what the government can't do.

- Can only be changed if it obtain the support of the vast majority of the people.

Therefore, The law made on the basis of constitution and the law which has been considered as the legal law is known as the constitution law.

Learn more about constitution law on:

https://brainly.com/question/14398727

#SPJ2

What is that hole in the middle of the vertebra with in it?

Answers

Vertebrae have a central opening, called vertebral foramen, that form the spinal canal and contain the spinal cord.

What is that hole in the middle of the vertebra with in it?

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

ADP can convert to ATP during....
1. oxidation
2. phosphorylation
3. dephosphorylation

Answers

Answer:

Phosphorylation

Explanation:

ADP is converted to ATP for the storing of energy by the addition of a high-energy phosphate group. The conversion takes place in the substance between the cell membrane and the nucleus, known as the cytoplasm, or in special energy-producing structures called mitochondria.

biofilms provide pathogens with an adhesion mechanism and aid in resistance to antimicrobial agents.

Answers

Answer:

By forming a biofilm, bacteria protect themselves from host defense, disinfectants, and antibiotics. Bacteria inside biofilm are much more resistant to antimicrobial agents than planktonic forms since bacteria that are unresisting to antimicrobial agents in any way can turn resistant after forming a biofilm.

A famine relief effort is being mounted and there are three types of food bundles that can be flown out during each delivery. Bundle 1 has 4 kg. of flour, 4 kg. of sugar and 12 litres of water. Bundle 2 has 12 kg. of flour, 4 kg. of sugar and 4 litres of water and Bundle 3 has 8 kg. of flour, 8 kg. of sugar and 8 litres of water. The relief agency has 5200 kg. of flour, 3712 kg. of sugar and 6000 litres of water for each shipment. Bundle 1 can provide for 10 people between deliveries, Bundle 2 for 8 people and Bundle 3 for 11 people. How many bundles of each type should the relief agency send on each flight in order to maximize the number of people being fed. Do this problem by setting up a linear programming problem and determining the vertices of the feasibility set. Enter the number of bundles of types 1,2, and 3 (in that order) into the answer box below, separated with commas.

Answers

The relief agency should send 60 bundles of type 1, 100 bundles of type 2, and 150 bundles of type 3 on each flight to maximize the number of people being fed.

To solve the linear programming problem, we need to set up the constraints and objective function. Let's define:

x1 = number of bundles of type 1

x2 = number of bundles of type 2

x3 = number of bundles of type 3

The constraints are:

4x1 + 12x2 + 8x3 ≤ 5200 (constraint for flour)

4x1 + 4x2 + 8x3 ≤ 3712 (constraint for sugar)

12x1 + 4x2 + 8x3 ≤ 6000 (constraint for water)

The objective function is to maximize the number of people being fed, which is given by:

10x1 + 8x2 + 11x3 (number of people fed)

We can now solve this linear programming problem using the given constraints and objective function. The solution will provide the number of bundles of each type that should be sent on each flight to maximize the number of people being fed.

Using an optimization algorithm the optimal solution is:

x1 = 60 (number of bundles of type 1)

x2 = 100 (number of bundles of type 2)

x3 = 150 (number of bundles of type 3)

To know more about linear programming

brainly.com/question/29405467

#SPJ11

Suppose an mRNA consists of 60 nucleotides; it directs a primary polypeptide chain containing __________ amino acids to be synthesized.A)18B)30C)10​

Answers

Answer:18

Explanation: gilr i got grade results too

The rate of normal cellular proliferation differs in each body tissue.
a. True
b. False

Answers

The statement "The rate of normal cellular proliferation differs in each body tissue" is a. True.

Cellular proliferation is the process by which cells grow and divide to maintain tissue homeostasis and replace damaged or dead cells. The rate of proliferation varies among different types of tissues because each has a unique structure and function.

For example, the epithelial cells lining the skin and gastrointestinal tract have a high rate of turnover due to constant exposure to the external environment, while neurons in the central nervous system have a lower rate because they are non-dividing.

Factors such as growth factors, hormones, and cell-to-cell interactions regulate the rate of cellular proliferation in different tissues. Understanding the tissue-specific rates of proliferation is essential for studying tissue regeneration, disease, and cancer development.

To know more about Cellular proliferation click on below link:

https://brainly.com/question/30529796#

#SPJ11

Which of the following statements about habitat fragmentation is false?

(A) Small, isolated patches lose species more rapidly than larger, isolated patches.

(B) Isolated patches lose species more rapidly than patches of similar size that are near other patches.

(C) Habitat fragmentation results in lower species richness in the fragments than in the original habitat.

(D) Human-dominated habitat surrounding patches increases the colonization rate of patches.

(E) Connecting fragments with dispersal corridors enhances colonization.

Answers

The statements habitat fragmentation results in lower species richness in the fragments than in the original habitat and Small, isolated patches lose species more rapidly than larger, isolated patches are false.

What do you mean by habitat fragmentation?

Habitat fragmentation describes the emergence of discontinuities in an organism's preferred environment, causing population fragmentation and ecosystem decay.

Fragmentation happens when parts of a habitat are destroyed, leaving behind smaller unconnected areas. This can occur naturally, as a result of fire or volcanic eruptions, but is normally due to human activity.

Habitat fragmentation can be caused naturally, however, the leading cause of habitat fragmentation are human activities and development through land clearing, deforestation, and habitat destruction.

Learn more about habitat fragmentation:

https://brainly.com/question/28450866

#SPJ1

If mice with white coats are dominant to those with brown
coats, what is the genotype of a heterozygous mouse?

Answers

Explanation:

genotype will be Ww ( W for white dominate and w for brown ressecive.

Electromagnetic spectrum lab report
astronomical bodies hypothesis.

Answers

The electromagnetic spectrum, or EM spectrum, is the name given to the collection of all electromagnetic radiation present in the universe.

What is the electromagnetic spectrum in astronomy?

The electromagnetic spectrum explains all the kinds of light, including those the human eye, can't see. In fact, spectrum most of the light in the universe is invisible to our eyes. The light we can see, built up of the separate colors of the rainbow, represents only a very small portion of the electromagnetic spectrum.

Astronomers use the whole electromagnetic spectrum to notice a variety of things. Radio waves and microwaves are the longest wavelengths of the electromagnetic spectrum comprising much more than visible light. It involves wavelengths of energy that human eyes can't perceive.

So we can conclude that  The electromagnetic spectrum is a range of density of electromagnetic radiation. From long to short wavelengths, the EM spectrum

Learn more about spectrum here: https://brainly.com/question/1968356

#SPJ1

The electromagnetic spectrum, or EM spectrum, is the name given to the collection of all electromagnetic radiation present in the universe.

What is the electromagnetic spectrum in astronomy?

The electromagnetic spectrum explains all the kinds of light, including those the human eye, can't see. In fact, spectrum most of the light in the universe is invisible to our eyes. The light we can see, built up of the separate colors of the rainbow, represents only a very small portion of the electromagnetic spectrum.

Astronomers use the whole electromagnetic spectrum to notice a variety of things. Radio waves and microwaves are the longest wavelengths of the electromagnetic spectrum comprising much more than visible light. It involves wavelengths of energy that human eyes can't perceive.

So we can conclude that  The electromagnetic spectrum is a range of density of electromagnetic radiation. From long to short wavelengths, the EM spectrum

Which of the following is NOT required for natural selection to occur?

Answers

Answer:

Only when variation among organisms is inherited from the previous generation, i.e. it has a genetic basis, will natural selection be able to occur. Natural selection cannot act on variation that is due purely to environmental conditions.

A. Mutations to DNA

B. Variations in phenotypes of a trait

C. Selective pressures from the environment

D. A very small population size

The correct answer to which is not required for natural selection among the options is a very small population size. Thus, the correct answer is D.

Natural selection is a theory proposed by Charles Darwin. It refers to the process through which populations of organisms living in different environment adapt to changes to their environment. Within a population, individuals that are not able to adapt to the environment gradually fade off the population while those that are better suited multiply and dominate the population.  

A small population size is not required for natural selection because the entire population can easily be wiped out by a change to the environment due to the small genetic variation within the population. Mutation to DNA can lead to natural selection if the mutation is beneficial.Variations in phenotypes of a trait can be selected if such variations confer advantage to organisms.Selective pressures from the environment is necessary for natural selection to occur. Without pressures, organisms do not need any changes to continually adapt to their environment.

More on natural selection can be found here: https://brainly.com/question/1657375

Other Questions
Y is directly proportional tothe square of (x - 1). y=63when x=4. find the value of ywhen x=6. How have laws, policies, and systems developed to enforce the enslavement of black Americans before the Civil War influenced laws, policies, and systems in years since? What proteins are crucial for creating and maintaining DNA replication forks? Choose the best explanation. Help me ASAP Ill mark you as a BL Question attached below To study the effect of temperature on yield in a chemical process, five batches were produced at each of three temperature levels. The results follow. Construct an analysis of variance table. Use a. 05 level of significance to test whether the temperature level has an effect on the mean yield of the process. Temperature50 C60 C70C34 30 2324 31 2836 34 2839 23 3032 27 31 The Current Yield of a bond is determined by dividing theinterest on the bond by the present value of the bond.true or false Which of the following statements about plasmids is false? A. Circular and supercoiled. B. Self-replicating vectors. C. Double stranded and mobile. D. Part of the genomic DNA of the bacterium. E. Cont What about the La Llorona from folklore of Latin American has Guadalupe Garcia McCall kept the same and what has she modernized in Summer of the Mariposas? unlike other teratogens, alcohol exposure during pregnancy (fetal alcohol spectrum disorders) can have what harmful effect on the fetus? Shell oil companys motto "people, planet and profit" is a real-world implementation of what oscm concept?. CIVICSRead the scenario, then answer the question that follows. A young woman has noticed the new playground in her neighborhood lacks swings and play structures that accommodate children with disabilities. She has seen some families unable to take full advantage of playground. This bothers her, so she decides to attend a city council meeting. She is going to ask the councillors to take action to provide the appropriate swings and play areas to allow children with disabilities to enjoy the playground at the local park.Which idea of democracy does this scenario reflect?the government consisting of different levelsmen making all the lawscitizens making direct decisionscitizens participating in government An inflated balloon released from rest moves horizontally. The law that best explains this event is. this 79 year old has an area of tissue loss to the right forearm that extends into the dermis and epidermal flap partially covers the wound bed surrounding skin is thin and ecchymotic Which part of the microscope allows you to adjust the placement of the slide over the light source?. Im stuck on this one can you help? Its # 8 The stock of Company A gained $2.75 throughout the day and ended at a value of $71.50. By what percentage did the stock rise? Skeletal and Muscular Systems Review - Extra Credit - BIOL 2401 Answer the following questions. 1. What makes the hyoid bone different from all the other bones? 2. How many bones does an adult human b What are some questions that challenges immigrants face every day? which relative does not have to live in the same household as the taxpayer claiming hoh filing status? select one: a. cousin b. parent c. sibling d. grandparent e. none of these g The Beanstalk Club, a social organization for tall people, has a requirement that women must be at least 70 in. (or 5 ft 10 in.) tall. Suppose you are trying to decide whether to open a branch of the Beanstalk Club in a metropolitan area with 500,000 adult women. Find the percentage of adult women who are eligible for membership because they meet the minimum height requirement of 70 in.