Is this spring or winter?

Is This Spring Or Winter?

Answers

Answer 1
The season is Spring

Related Questions

Hypochondriacs seek out medical care in order to verify that they do not have an illness.
Please select the best answer from the choices provided
T
F

Answers

Answer:

False

Explanation:

Just took the test

False, because hypochondriacs think they have a significant, undetected medical ailment even when testing reveal they are healthy.

Who are hypochondriacs?

A hypochondriac is someone who, despite diagnostic testing showing they have no health issues, lives in constant anxiety that they have a terrible, undetected medical illness. They are obsessed with the concept that they suffer from a major illness that has gone untreated.

In adults, hypochondriasis often begins to manifest. Among the symptoms are a persistent, strong anxiety of developing a major illness and concern that seemingly little symptoms portend a larger problem. A patient may change physicians or see them regularly.

Medication and counselling could be helpful.

Learn more about hypochondriac, here:

https://brainly.com/question/11046677

#SPJ5

A 90.0 kg man climbs hand over hand up a rope to a height of 15.2 m. How
much potential energy does he have at the top? (PE=mgh)


Need sum1 good at physics class

Answers

Answer:

13,680 J

Explanation:

The potential energy of a body can be found by using the formula

PE = mgh

where

m is the mass

h is the height

g is the acceleration due to gravity which is 10 m/s²

From the question we have

PE = 90 × 10 × 15.2

We have the final answer as

13,680 J

Hope this helps you

how many π electrons does c contain? how many π electrons are delocalized in the ring? explain why c is aromatic.

Answers

C contains 6 π electrons, and all 6 π electrons are delocalized in the ring. C is aromatic because it meets the criteria for aromaticity, which are that it is cyclic, planar, fully conjugated, and has a certain number of π electrons (4n+2, where n is a non-negative integer).

In order to determine the number of π electrons in C, we need to count the number of electrons involved in the π bond system. C has a benzene ring, which consists of 6 carbon atoms in a cyclic arrangement, with alternating single and double bonds. Each double bond contains 2 π electrons, so the total number of π electrons in the ring is 6 x 2 = 12. However, because the double bonds are delocalized around the ring, each carbon atom only contributes one π electron to the ring. Therefore, C contains 6 π electrons.

All 6 π electrons in C are delocalized in the ring, meaning that they are not localized to any one specific bond, but instead are free to move around the entire ring. This makes the ring particularly stable and resistant to reactions that would break the aromaticity.

C is aromatic because it meets the criteria for aromaticity. The ring is cyclic, planar, and fully conjugated, meaning that all of the atoms in the ring are sp2 hybridized and have overlapping p orbitals that allow for delocalization of electrons. Additionally, the number of π electrons in the ring is 4n+2, where n is 1 (in this case), making the ring aromatic. The aromaticity of C makes it particularly stable and has important implications for its reactivity and properties.

learn more about electrons

https://brainly.com/question/860094

#SPJ11

Question 10 of 10
Which is a contact force?
Minerai
O A. Friction slowing down a car
OB. A magnet pulling on a nail
OC. The Sun pulling on Earth
OD. Two electrons repelling each other

Answers

My answer is (A) “the friction slowing down a car

Explanation:

OC the sun pulling on earth

Suppose you have two metal cubes, one made of iron and one made of aluminum. You transfer the same amount of heat Q to each of them. Which cube will have the higher final temperature, given they have the same masses and initial temperatures?a. Iron Cubeb. Aluminum Cube

Answers

So, if you transfer the same amount of heat Q to each cube, the aluminum cube will have a higher final temperature than the iron cube.

What is temperature?

Temperature is a measure of the average thermal energy of the particles in a system. It is a scalar quantity that reflects the amount of heat energy present in a substance, and it is typically measured in units of degrees Celsius (°C), Kelvin (K), or Fahrenheit (°F). Temperature is related to the kinetic energy of the particles in a system, which is the energy associated with their motion. As the temperature of a system increases, the kinetic energy of its particles also increases, leading to faster and more chaotic motion. Conversely, as the temperature decreases, the kinetic energy of the particles decreases, leading to slower and less chaotic motion.
Here,

The final temperature of the two cubes will depend on the specific heat capacity of each material. The specific heat capacity of a material is the amount of heat energy required to raise the temperature of a unit of mass of that material by 1 degree Celsius.

Aluminum has a higher specific heat capacity than iron, meaning it requires more heat energy to raise its temperature by the same amount.

To know more about temperature,

https://brainly.com/question/12810312

#SPJ4

what is the color that makes purple ?
ANSWER RED)BLUE

Answers

Answer:

both

Explanation:

really you don't know something from kindergarden

red and blue together

A cloud contains spherical drops of water of radius R and charge Q. Assume the drops are far apart.

1. The electric field E0 and potential V0 at the surface of each drop is given by?

2. If two droplets happen to combine into a single larger droplet, the new potential V at the surface of the larger droplet is most nearly equal to:

Answers

1. The electric field E_0 and potential V_0 at the surface of each drop is given by the equation E_0\ =\ \frac{Q}{4\pi\varepsilon_0R^2} and V_0=\frac{Q}{4\pi\varepsilon_0R} respectively. 2. The new potential V at the surface of the larger droplet is most nearly equal to the original potential V_0.

1. The electric field E0 and potential V0 at the surface of each drop can be found using the formulas for electric field and potential of a sphere.

The electric field E_0 is given by:

E_0\ =\ \frac{Q}{4\pi\varepsilon_0R^2}

and the potential V_0 is given by:

V_0=\frac{Q}{4\pi\varepsilon_0R}  

where Q is the charge of the drop, R is the radius of the drop, and ε0 is the permittivity of free space.

2. When two droplets combine into a single larger droplet, the new potential V at the surface of the larger droplet will be given by: V_0=\frac{Q}{4\pi\varepsilon_0R^'}

where Q is the total charge of the two droplets (Q = Q1 + Q2), R' is the new radius of the larger droplet, and  \varepsilon_0 is the permittivity of free space.

Since the volume of a sphere is given by V = (4/3)πR^3, the new radius R' will be given by:

R' = (3V/4π)^(1/3) = (3(4/3)πR^3/4π)^(1/3) = R^(3/3) = R.

Therefore, the new potential V at the surface of the larger droplet will be:

V = Q/(4πε0R) = (Q1 + Q2)/(4πε0R) = V_0

So the new potential V at the surface of the larger droplet is most nearly equal to the original potential V_0.

Learn more about Electric field:

https://brainly.com/question/1592046

#SPJ11

Declaration of Independence --- Articles of Confederation--- _________________________ -- U.S. Constitution The events above are in chronological order – what event below should be in the blank? a The Boston Tea Party b The Constitutional Convention c The French & Indian War d Both Boston Tea Party and The French and Indian War are correct

Answers

Answer:

b. The Constitutional Convention

Explanation:

The given events in its chronological order :

1. Declaration of Independence  ---- 4th July, 1776.

2. Articles of Confederation ---------- 15th November, 1777

3. The Constitutional Convention ---- 25th May, 1787

4. U.S. Constitution ------------------------ 17 September, 1787

The U.S. Constitutional Convection took place in the year 1787 from 25th May to 17th September. It took place at the Pennsylvania State House situated in Philadelphia. The Constitutional Convection of the United States was chaired by George Washington.

How much power does it take to do 1000 J of work in 8 seconds?

Answers

Power = work/time
1000/8 = 125
Answer: 125 watts

Which of the following substances can be separated into several elements?
A. nitrogen B. zinc
C. air D. aluminum

Answers

Answer: C

Explanation: Air

Hope this helps! Brainlist Plz?

The following substances can be separated into several elements is the air because consisting of a mixture of several gases, such as nitrogen, oxygen, carbon dioxide and noble gases.

What is air composed of?

Atmospheric air is made up of a mixture of several gases, such as nitrogen, oxygen, carbon dioxide and noble gases. Oxygen and nitrogen are the most abundant gases, with the other gases being found in smaller amounts.

So the only element that we can separate into is air, because when performing the separation we find oxygen, nitrogen, carbon dioxide and noble gases.

See more about air at brainly.com/question/19368011

#SPJ2

A minimum working space depth of _____ ft to live parts of equipment operating at 277 volts-to-ground is required where there are exposed live parts on one side and no live or grounded parts on the other side.

Answers

A minimum working space depth of 3 ft to live parts of equipment operating at 277 volts-to-ground is required where there are exposed live parts on one side and no live or grounded parts on the other side.

The National Electrical Code (NEC) specifies minimum safety standards for electrical installations, including requirements for working space around electrical equipment. According to NEC, a minimum working space depth of 3 feet (or 1 meter) is required to live parts of equipment operating at 277 volts-to-ground where there are exposed live parts on one side and no live or grounded parts on the other side.

This working space depth ensures that there is enough space for an electrical worker to safely approach, operate, maintain, and troubleshoot the equipment without coming into contact with live parts or exposing themselves to electrical hazards. Additionally, the minimum working space depth may vary based on the equipment's voltage, current, and other specific installation conditions.

To know more about working space here

https://brainly.com/question/28305204

#SPJ1

an aircraft is flying not worth at 300 km per hour yesterday wind is blowing West was at 80 km per hour what is the actual Direction the aircraft travels over the ground​

Answers

Answer:

220km

Explanation:

What is the rms-current irms in the circuit when vrms = 30. 0 v, c = 1. 7 µf, and f = 4. 0 khz?

Answers

In conclusion, the RMS current (irms) in the circuit when vrms = 30.0 V, c = 1.7 µF, and f = 4.0 kHz is approximately 0.405 A.

To calculate the RMS current (irms) in a circuit, we need to use the formula irms = vrms / (Z × √2), where vrms is the RMS voltage, Z is the impedance, and √2 is the square root of 2.
In this case, we are given that vrms = 30.0 V, c = 1.7 µF, and f = 4.0 kHz.
First, we need to calculate the impedance (Z) using the formula Z = 1 / (2πfC), where π is a mathematical constant equal to approximately 3.14159.
Plugging in the values, we have

Z = 1 / (2 × 3.14159 × 4.0 × 10^3 × 1.7 × 10^(-6)).
After evaluating this expression, we find Z ≈ 46.81 ohms.
Now, we can calculate the RMS current using the formula irms = vrms / (Z × √2).
Plugging in the values, we have irms = 30.0 V / (46.81 ohms × √2).
After evaluating this expression, we find irms ≈ 0.405 A.
In conclusion, the RMS current (irms) in the circuit when vrms = 30.0 V, c = 1.7 µF, and f = 4.0 kHz is approximately 0.405 A.

To know more about RMS current visit:

https://brainly.com/question/31425711

#SPJ11

what is the frequency of a standing wave with a wave speed of 12 m/s as it travels on a 4.0-m string fixed at both ends?

Answers

The frequency of a standing wave with a wave speed of 12 m/s as it travels on a 4.0-m string fixed at both ends is 3.0 Hz.

What Is A Standing Wave?

A standing wave is produced by a wave with the same amplitude, frequency, and wavelength moving in the opposite direction with the initial wave. This indicates that the wave appears to stand in one place. Standing waves can only be generated in a medium if there is a boundary that restricts the movement of the wave. Standing waves can be observed in various shapes and sizes, and their frequencies are determined by a variety of factors, including the wave speed and the length of the string. When a standing wave is generated in a string, the points where the wave appears to be fixed are known as nodes, while the points where the string vibrates with the most amplitude are known as antinodes.In this scenario, the wave speed and the length of the string are given.

The wave speed, frequency, and wavelength of a wave are related by the formula v = fλ, where v is the wave speed, f is the frequency, and λ is the wavelength. Since the length of the string is fixed, the wavelength of the standing wave is twice the length of the string. Thus, λ = 2L = 8 m. Plugging in the values for the wave speed and wavelength, the frequency can be calculated as follows:f = v / λ = 12 m/s / 8 m = 1.5 Hz. The frequency of a standing wave with a wave speed of 12 m/s as it travels on a 4.0-m string fixed at both ends is 3 Hz.

Learn more about a standing wave at https://brainly.com/question/29558685

#SPJ11

PLS HELP WILL GIVE BRAINLIEST PLSSSS The equation for the reaction is: Mg(s) magnesium + 2 HCl(aq) hydrochloric acid MgCl2(aq) magnesium chloride + H2(g) hydrogen The student investigated how the rate of this reaction changed when the concentration of hydrochloric acid was changed. Write a plan the student could use. In your plan you should: • describe how you would carry out the investigation and make it a fair test • describe the measurements you would make.

Answers

Answer:

50 cm3 of 1M hydrochloric acid is a six-fold excess of acid. In this reaction, the magnesium and acid are gradually used up. However the acid is in excess, so it is mainly the loss of magnesium (surface area becomes smaller) that causes the change in the rate.

Explanation:

The equation for the reaction is: magnesium + hydrochloric acid → magnesium chloride + hydrogen

Mg(s) + 2HCl(aq) → MgCl2(aq) + H2(g)

Students follow the rate of reaction between magnesium and the acid, by measuring the amount of gas produced at 10 second intervals.

3 cm of magnesium ribbon typically has a mass of 0.04 g and yields 40 cm3 of hydrogen when reacted with excess acid. 50 cm3 of 1M hydrochloric acid is a six-fold excess of acid.

In this reaction, the magnesium and acid are gradually used up. However the acid is in excess, so it is mainly the loss of magnesium (surface area becomes smaller) that causes the change in the rate.

If a graph of volume (y-axis) against time (x-axis) is drawn, the slope of the graph is steepest at the beginning. This shows that the reaction is fastest at the start. As the magnesium is used up, the rate falls. This can be seen on the graph, as the slope becomes less steep and then levels out when the reaction has stopped (when no more gas is produced).

The reaction is exothermic, but the dilute acid is in excess and the rise in temperature is only of the order of 3.5˚C. There is some acceleration of the reaction rate due to the rise in temperature. Some students might notice the flask becoming slightly warm and they could be asked how this would affect the rate of reaction, and how they might adapt the experiment to make it a ‘fair test’.

Additional information

This is a resource from the Practical Chemistry project, developed by the Nuffield Foundation and the Royal Society of Chemistry. This collection of over 200 practical activities demonstrates a wide range of chemical concepts and processes. Each activity contains comprehensive information for teachers and technicians, including full technical notes and step-by-step procedures. Practical Chemistry activities accompany Practical Physics and Practical Biology.

To solve this we must be knowing each and every concept related to Le Chatelier′s Principle. Therefore, when concentration of hydrochloric acid was changed. the concentration of product will also change.

What is Le Chatelier′s Principle?

When a stress is given to a chemical system in equilibrium, the equilibrium shifts to alleviate the tension, according to Le Chatelier′s Principle. In other words, it can anticipate the outcome of a chemical reaction with response to changes in temperature, concentration, quantity, or pressure.

While Le Chatelier's concept can be used to anticipate the reaction to a change from equilibrium, it doesn't explain why the system behaves as it does (at the molecular level).

Mg(s) + 2 HCl(aq) \(\rightarrow\) MgCl\(_2\)(aq) + H\(_2\)(g)

According to  Le Chatelier′s Principle, when concentration of hydrochloric acid was changed. the concentration of product will also change.

Therefore, when concentration of hydrochloric acid was changed. the concentration of product will also change.

To know more about Le Chatelier′s Principle, here:

https://brainly.com/question/29009512

#SPJ2

i) Show that total energy of the body at points A, B and C during the fall is same. ii) Find the distance from A to B and final velocity of the ball just reach before C. mass =5 kg, total height (h)= 100m​

i) Show that total energy of the body at points A, B and C during the fall is same. ii) Find the distance

Answers

The total energy of the body at evevry point is remained same due to the law of conservation of energy. Distance from A to B and final velocity of the ball just reach before C is 44.3 m/s.

d (distance) from A to B is = √2gh

In this case given are, g = 9.8 m/s² and h = 100m,

so here d = √(2⋅9.8⋅100) = 44.3m.

Final velocity ,v = √2gh

Here given are , v is the velocity, g is the acceleration due to gravity, and h is the height. In this case,

g = 9.8 m/s² ,h = 100m,

v = √(2⋅9.8⋅100)

= 44.3 m/s (final velocity)

Learn more about the energy here

https://brainly.com/question/32623120

#SPJ1

Neutrons have a ____ charge

Answers

Answer:

Neutrons have no charge

Explanation:

Answer:

Neutrons don't have a charge....

Explanation:

Hope this helped!!!

A high-speed train accelerates at a constant rate in a straight line calculate the change in the velocity of the train

Answers

If the acceleration is constant, the velocity changes at the same rate or said to be uniform.

What is acceleration?

The rate of change of velocity with respect to time is known as acceleration. According to Newton's second law, the eventual effect of all forces applied to a body is its acceleration.

The formula of the acceleration is;

\(\rm a= \frac{v-u}{t} \\\\\)

When a high-speed train accelerates at a consistent rate in a straight path, the change in velocity is uniform.

Hence, if the acceleration is constant, the velocity changes at the same rate.

To learn more about acceleration, refer to the link;

https://brainly.com/question/2437624

#SPJ1

The work done in accelerating an object along a frictionless horizontal surface is equal to the change in the object's
(A) momentum
(B) velocity
(C) potential energy
(D) kinetic energy

Answers

"The work done in accelerating an object along a frictionless horizontal surface is equal to the change in the object's kinetic energy."

The amount of internal and mechanical energy that objects possess fluctuates as a result of work. When work is done on a system or an object, energy is contributed to it. When a system or item accomplishes work, some of its energy is transferred to something else.

Work involves the transfer of energy from the agent to the object, which modifies the object's motion.

The energy of motion is known as kinetic energy, and it can be observed in the motion of objects or subatomic particles. Kinetic energy can be found in all particles and moving objects. Examples of kinetic energy in action include a person walking, a baseball soaring through the air, a piece of food falling from a table, and a charged particle in an electric field.

To know more about work:

https://brainly.com/question/27019721

#SPJ4

What do people mean when they say "dropping of the face of the planet"? Is that even possible?

Answers

Answer:

Explanation:

Remark

Don't read it literally. It does not mean that you are on earth's surface one moment and the next your floating somewhere on the edge of the milky way.

It means that before the remark was made, you were outgoing and friendly. Something happened that caused you to withdraw from society and become somewhat like a hermit.

scribe the proposed fusion-powered starships of project orion and project daedalus. how quickly could such ships reach the stars?

Answers

Project Orion and Project Daedalus are fusion-powered starship concepts designed to travel faster than traditional methods, potentially reaching nearby stars within decades, not centuries.


Project Orion, proposed in the late 1950s, was a concept for a nuclear pulse propulsion starship that used small nuclear explosions to propel the spacecraft forward. It had the potential to reach nearby stars within decades, as opposed to centuries. Project Daedalus, proposed in the 1970s by the British Interplanetary Society, was a fusion-powered starship concept that utilized nuclear fusion reactions to generate thrust.

Daedalus aimed to reach Barnard's Star, about 6 light-years away, in approximately 50 years. Both projects demonstrated the potential of fusion-powered starships for interstellar travel, but were never realized due to technical, ethical, and budgetary constraints.

Learn more about Barnard's Star here:

https://brainly.com/question/32320516

#SPJ11

Circle the words that relate to BOTH Nuclear and Coal Burning power generation.Cross out the words that ONLY apply to Coal Burning power plants.fuel rods - steam - generator - turbine - uranium - CO2 emissions - nonrenewable - radiation - heat

Answers

The words that relate to BOTH Nuclear and Coal Burning power generation: fuel rods - steam - generator - turbine - heat.  The words that ONLY apply to Coal Burning power plants: CO2 emissions - nonrenewable

Both nuclear and coal-burning power plants use heat to generate electricity. In a nuclear power plant, the heat is produced by the fission of uranium atoms. In a coal-burning power plant, the heat is produced by the combustion of coal. The heat is then used to boil water, which turns into steam. The steam drives a turbine, which generates electricity.

Nuclear power plants do not produce CO2 emissions, but they do produce radioactive waste. Coal-burning power plants produce CO2 emissions, but they do not produce radioactive waste.

Nuclear power plants are considered to be a nonrenewable resource because uranium is a finite resource. Coal-burning power plants are also considered to be a nonrenewable resource because coal is a finite resource.

Nuclear power plants emit radiation, but the amount of radiation released is very small. Coal-burning power plants do not emit radiation.

Overall, nuclear power plants and coal-burning power plants have both advantages and disadvantages. The best choice of power plant for a particular region will depend on a variety of factors, including the availability of resources, the cost of electricity, and the environmental impact.

To learn more about Coal click here

https://brainly.com/question/12981477

#SPJ11

how did barnett newman increase the capacity of color to communicate emotion?

Answers

Barnett Newman, an American abstract expressionist painter, increased the capacity of color to communicate emotion by using color in an abstract way. Newman is well-known for his "zip" paintings, which are large canvases divided by a vertical line of color. He argued that the viewer's experience of these paintings was not just visual but physical, invoking emotions like awe, transcendence, and mystery.

He believed that his use of color had the capacity to evoke a spiritual experience in viewers. In his work, he made extensive use of large fields of pure color, which he believed had the power to convey deep emotions and spiritual states. He aimed to create an almost mystical experience for the viewer by immersing them in the color and allowing them to feel its intensity and purity.

In conclusion, Barnett Newman increased the capacity of color to communicate emotion by using pure color fields in his abstract paintings, which evoked a sense of awe, transcendence, and mystery, which he believed had the capacity to create a spiritual experience for the viewer.

To know more about Barnett Newman visit :

brainly.com/question/32382532

#SPJ11

the security needs of an information system are determined during the component design phase of the systems development life cycle. group of answer choices
of the increasing in air pressure in the space between them.
of decrease in the velocity of air molecules between them.
of decrease in air pressure in the space between them.
of the increase in the velocity of air molecules between them

Answers

None of the answer choices provided are relevant to the security needs of an information system. The security needs of an information system are determined based on factors such as risk assessment, threat analysis, and organizational requirements. They are not determined by changes in air pressure or velocity of air molecules.

The systems development life cycle is a methodical approach to creating an information system that includes stages of initiation, development, and deployment. In the component design phase, designers build the components of the information system, which would include both hardware and software components. The designers establish how components interact with each other and determine the system's security needs during this stage of development.

They also consider how data will flow throughout the system and identify potential security risks and vulnerabilities in the system. Once the components are built, they move on to the next stage of the systems development life cycle, where they integrate the components into the system and test the entire system as a whole. Hence, none of the given answers is correct.

You can learn more about the design phase at: brainly.com/question/29783908

#SPJ11

what is the change in gravitational potential energy between the asteroid's starting point and when it hits the earth's surface? does it gain or lose potential energy?

Answers

The change in gravitational potential energy between the asteroid's starting point and when it hits the Earth's surface is negative. The asteroid loses potential energy as it falls towards Earth due to the conversion of potential energy into kinetic energy.

The change in gravitational potential energy between the asteroid's starting point and when it hits the Earth's surface can be determined by considering the gravitational potential energy equation:

ΔPE = m * g * h

Where:

ΔPE is the change in gravitational potential energy

m is the mass of the asteroid

g is the acceleration due to gravity

h is the change in height or vertical displacement

Assuming the asteroid is falling from a height, we can consider the change in gravitational potential energy as the difference between the potential energy at the starting point and the potential energy at the Earth's surface.

Since the asteroid is falling towards Earth, it is losing height, resulting in a negative change in height (h). Thus, we have:

ΔPE = m * g * (-h)

The negative sign indicates a decrease in height and potential energy.

To know more about gravitational potential energy refer here

https://brainly.com/question/3910603#

#SPJ11

Data from a weather satellite was used to generate the image below. The colored regions represent warm portions of the atmosphere.

Which fact about electromagnetic radiation allows scientists to gather such information about the Earth's atmosphere?
A.
Some of the Sun's visible light is scattered as it passes through the Earth's atmosphere.
B.
The warmer a region of the atmosphere is, the more infrared radiation it emits.
C.
Radio waves can pass through buildings and other solid structures.
D.
Ozone in the Earth's upper atmosphere absorbs ultraviolet radiation.

Data from a weather satellite was used to generate the image below. The colored regions represent warm

Answers

Answer: the answer is b “The warmer a region of the atmosphere is, the more infared radiation it emits”

Explanation:

Data from a weather satellite was used to generate the image below. The colored regions represent warm

Answer:

a

Explanation:

i got it right

The tongs are used to lift the 150 kg crate. Determine the smallest value for the coefficient of static friction between the crate and the pivot blocks (A and B) so the crate can be lifted.

Answers

The smallest value for the coefficient of static friction between the crate and the pivot blocks (A and B) so the crate can be lifted using tongs is 1471.5 N

To determine the smallest value for the coefficient of static friction between the crate and the pivot blocks (A and B) so the crate can be lifted using tongs, we need to consider the maximum force that the tongs can exert on the crate without slipping.

Let's assume that the tongs are able to exert a maximum force of F on the crate. According to the laws of physics, the force required to lift an object is equal to its weight. Therefore, the weight of the crate is 150 kg multiplied by the acceleration due to gravity (9.81 m/s²) which is approximately equal to 1471.5 N.

For the crate to be lifted without slipping, the maximum force exerted by the tongs (F) must be equal to or greater than the weight of the crate (W). Therefore, we can write the following inequality:

F ≥ W

Substituting the values, we get:

F ≥ 1471.5 N

Now, let's consider the force required to overcome the static friction between the crate and the pivot blocks. The static friction force is given by:

f = μs N

where μs is the coefficient of static friction, and N is the normal force acting on the crate (which is equal to its weight).

To lift the crate without slipping, the maximum force exerted by the tongs must be greater than or equal to the static friction force. Therefore, we can write the following inequality:

F ≥ f

Substituting the values, we get:

F ≥ μs N

F ≥ μs × 1471.5 N

Now, to determine the smallest value for the coefficient of static friction (μs), we need to rearrange the inequality as follows:

μs ≤ F/1471.5

Therefore, the smallest value for the coefficient of static friction between the crate and the pivot blocks (A and B) so the crate can be lifted using tongs is equal to the maximum force exerted by the tongs (F) divided by the weight of the crate (1471.5 N).

More on static friction: https://brainly.com/question/13828735

#SPJ11

A 2750 kg helicopter flies horizontally at constant speed. Air resistance creates a 7510 n backward force. What is the magnitude of the lift force created by the propellers

Answers

Answer:

Explanation:

Let lift force F be created by propellers at angle of Ф with the horizontal .

The vertical component of this force will balance the weight of helicopter and horizontal component will balance the air resistance .

F sinФ = mg = 2750 x 9.8 = 26950 N

F cosФ = 7510 N

Squaring and adding ,

F² = 26950² + 7510²

= 726302500 + 56400100

= 782702600

F = 27976.82 N .

3. Calculate the speed for a car that went a distance of 155 kilometers in 3 hours

Answers

Answer:This is an explanation

for 150 km its all ik i tried hard ty

Explanation:The car covers 150 km in 3 hours or 3*60 = 180 minutes.

So in 12 min the car will cover (12/180)*150 = 10 km.

Answer:

The average speed would be the distance covered divided by the time. In this case, (130 km)/(2 hours) = 65 km/hour. Note that you didn't ask for the average speed, just the speed

An object moves at 43m/s with 12018.5J of kinetic energy. Determine the mass of the object.

Answers

If kinetic energy = 1/2m square v
Therefore m=2(kinetic energy)/ squared v
M=2(12018.5J)/43x43
M=24,037J/1849m/s
M=13kg
Other Questions
Many Blacks chose a life in the city. What was urban life like for African Americans? how do social traps and mirror-image perceptions (reciprocity) fuel social conflict? Propaganda is primarily used by governments to __________. hi help rn plssthis is a system of equations question Suppose you are given an array A [1...n] of numbers, which may be positive, negative or zero, and which are not necessarily integers.a) Describe and analyze an algorithm that finds the largest sum of elements in a contiguous subarray A [i.. j]b) Describe and analyze an algorithm that finds the largest product of elements in a contiguous subarray A [i.. j]. Plz hurry its done in 30 minutes What does the following code display? int d = 9, e = 12; System.out.printf("%d %d\n", d, e); Select one: a. %d %d b. 9 12 c. %d 9 d. %9 %12 how is it possible that charcoal, graphite, and diamonds are largely composed of the same element? C xy dx x2y3 dy, C is counterclockwise around the triangle with vertices (0, 0), (1, 0), and (1, 4) Which incident from The Metamorphosis mirrors Kafka's personal feelings in this excerpt from "Letter to His Father"? Which element is not part of a disaccharide Blair's average on the first five in-class tests is 67. If this is not pulled up to at least a 70,Blair will not be allowed to watch any more of their favorite Netflix shows. To avoidlosing those access privileges, what is the lowest score Blair can afford to earn on the lastin-class test? Assume that all tests carry equal weight. A 3.0 kg book sits on a very high shelf 4.5 meters above the ground. Calculate the potential energy of the book. HELLP PLEASE I NEED THISWhich of these pairs of points defines a line with a slope of -1? A. (3, 10) and (3, 5) B. (3, 10) and (5, 3) C. (10, 3) and (15, -2) D. (10, 3) and (3, 5) Transcribe the following dna strands into mrna strands: ATTCGACGTCGATAGCTAGG Which of the following sentences contains an infinitive?OA. Elyza planned to take the train to the fairgrounds on Thursday afternoon.OB. Meghan led her horse to the barn just before the big thunderstorm hit.OC. Charlotte took her cousin Clay to the movies each year on his birthdayOD. Travis practiced pitching to the side of the house until his mom got mad. The Road Not Takenby Robert FrostTwo roads diverged in a yellow wood,And somy I could not travel bothAnd be one traveler, long I stoodAnd looked down one as far as I couldTo where it bent in the undergrowth;Then took the other, as just as far,And having perhaps the better claim,Because it was grassy and wanted wear,Though as for that the passing thereHad wom them really about the same,And both that moming equally layin leaves no step had trodden blackOh, I kept the first for another day!Yer knowing how way leads on to way.I doubned it should ever come backI shall be selling this with a sighSomewhere ages and ages henceTwo roads diverged in a wood, and s-I took the one less traveled byAnd that has made all the difference2Select all the comect answersWhich two themes are present in the poem?Le presents many unfair challenges for us.Our future is often determined by fateRoads are the best way to travelOur future depends on the choices we makeLifepreserts many choices for us to make.Reset Assume that military aircraft use ejection seats designed for men weighing between 145.3 lb and 204 lb. If women's weights are normally distributed with a mean of 161.4 lb and a standard deviation of 42.8 lb, what percentage of women have weights that are within those limits? Are many women excluded with those specifications? The percentage of women that have weights between those limits is %. (Round to two decimal places as needed.). upload a single file of all the skeletal structures for the molecules in the table. make sure that each structure is clearly labeled with the name of the molecule. The following matching pertain to the Cori Cycle. Group of answer choices lactate delivered to liver from muscle lactate dehydrogenase generated lactate in muscle under anaerobic conditions glucose synthesized in liver from pyruvate transport into the circulatory system from liver glucose glycolysis