______ is one of the five major practices of exemplary leaders according to Kouzes and Posner (2002).

Answers

Answer 1

According to Kouzes and Posner (2002), "inspiring a shared vision" is one of the five major practices of exemplary leaders. Leaders who inspire a shared vision are able to articulate a compelling and optimistic vision of the future that inspires and motivates others to work towards a common goal.

They are able to communicate their vision in a way that makes others feel passionate about achieving it, and they are able to create a sense of ownership and commitment to the vision among their followers. Leaders who inspire a shared vision are also able to recognize and celebrate the achievements of their followers, which helps to build a sense of trust and loyalty among team members. By inspiring a shared vision, leaders are able to create a sense of purpose and direction for their team, which can lead to higher levels of motivation, productivity, and job satisfaction. In conclusion, inspiring a shared vision is a critical practice for leaders who want to be successful in today's complex and competitive business environment. By developing and communicating a compelling vision, leaders can inspire and motivate their team members to work together towards a common goal, which can ultimately lead to greater success for the organization as a whole.

Learn more about Leaders here

https://brainly.com/question/12522775

#SPJ11


Related Questions

Which of the following is one of the three steps in solving ethical dilemmas?
1) Put yourself in the position of a decision-maker in the ethical dilemma.
2) Recognize the ethical situation and issues involved.
3) Identify and analyze the secondary elements in the situation.
4) Identify the alternatives, and weigh the impact of each alternative on management's reaction.

Answers

One of the three steps in solving ethical dilemmas is to 2) recognize the ethical situation and issues involved.

This step involves understanding and acknowledging that there is a problem or dilemma that needs to be addressed. It also requires identifying the key ethical issues at play and considering the perspectives of all parties involved.

However, it is important to note that there are typically more than three steps involved in solving ethical dilemmas. Other steps may include gathering information, evaluating options, considering consequences, and implementing a solution.

Therefore option 2 is the correct answer.

To know more about ethical dilemmas click on below link :

https://brainly.com/question/30401544#

#SPJ11

Which of the following may have contributed to changing religious and scientific thought from 1200-1500? Select all that apply.


1.The invention of the printing press


2.The exploration of Africa, Asia and the Americas


3.The introduction of Muslim and ancient Greek scholarship

Answers

The factors that contributed to changing religious and scientific thought from 1200-1500 includes:

1.The invention of the printing press2.The exploration of Africa, Asia and the Americas3.The introduction of Muslim and ancient Greek scholarship

What contributed to changing religious and scientific thought from 1200-1500?

The invention of the printing press, which occurred around 1440, allowed for the mass production of books and helped to disseminate ideas more quickly and widely. This facilitated the spread of new scientific and religious ideas and helped to challenge established beliefs.

The exploration of Africa, Asia, and the Americas also had a significant impact on religious and scientific thought. This allowed for the exchange of ideas and knowledge between different cultures, which often challenged prevailing beliefs and encouraged new ways of thinking.

Finally, the introduction of Muslim and ancient Greek scholarship into Europe helped to revolutionize scientific and religious thought. Muslim scholars, in particular, made significant contributions to mathematics, astronomy, and medicine, which helped to advance scientific understanding in Europe.

Read more about scientific thought

brainly.com/question/617174

#SPJ1

Which change in voting laws most likely helped elect Andrew Jackson in 1828?

A. Allowing white men who did not own land to vote
B. Limiting the vote to white landowners only
C. Limiting the vote to males who did not own land
D. Allowing all women and African Americans to vote

Answers

Answer:

A.

Explanation: it can't be D because black people and women weren't allowed to vote until much later, It's not B because it was limited to white male landowners already, It's not C because it wouldn't allow white landowners, So A.

After Marissa became frustrated with an insensitive comment Kevin made toward her, she excused herself and worked independently for the rest of the day. After work, she asked to switch shifts for the next few days so that she could have a bit of distance from him. What escapist strategy did Marissa use

Answers

The escapist strategy that Marissa used in the given situation is called "Withdrawal."

What is the Escapist Strategy?

Escapist strategies are those that involve avoiding confronting the problem and taking steps to get away from the situation that is causing the problem. These strategies are an unhealthy way to deal with problems since they do not help the person solve the underlying problem, and the problem persists until it is addressed directly.

What is Withdrawal?

Withdrawal is a kind of escapist strategy that involves avoiding the source of the problem or taking oneself away from the problem altogether. Marissa used the withdrawal strategy when she asked to switch shifts for the next few days so that she could have a bit of distance from Kevin after he made an insensitive comment to her, causing her to become frustrated. By avoiding interacting with Kevin, Marissa hopes to distance herself from the situation and avoid any further unpleasantness.

To know more about Escapist Strategy :

https://brainly.com/question/24462624

#SPJ11

Why do port cities often grow into large metropolises?

Answers

Answer:

Transportation and commerce. They become the main hub for trade, exports and imports, and transportation. They are essentially an economic hotspot for regions.

They become a hub for exports and imports due to the advantage of having a coast. Secondly, and in addition to the first comment, it becomes a huge hub for immigrants and outer city citizens to find work, which boosts the port city economies so that they may enjoy more luxuries instead of working for survival. That’s why historically, port cities are very rich and very luxurious

__________ is a legendary figure in Sumerian literature and was the King of Uruk, which was a city-state in Sumer that was uncovered in 2003. a. Sargon b. Gilgamesh c. Cuneiform d. Ziggurat

Answers

Answer:

Gilgamesh

Explanation:

Answer:

Gilgamesh

Explanation:

hope it helps

If a nation chooses to specialize and trade, which of the following situations could be expected to occur in the long run?
a
Decreased resource availability
b
Lower prices
c
Decreased quantity and quality of goods
d
Fewer domestic jobs
e
Decreased dependence on other nations

Answers

The correct option is (E). If a nation chooses to specialize and trade, one of the expected outcomes in the long run would be decreased dependence on other nations.

Specializing and engaging in trade allows nations to focus on producing goods and services in which they have a comparative advantage. By specializing, nations can allocate their resources more efficiently and increase productivity. This leads to an increase in overall economic output and the potential for lower prices. As nations trade with one another, they can access a wider range of goods and services that may not be available domestically. This increased access to goods and services from other nations reduces the nation's dependence on its own production capabilities alone.

However, it is important to note that the other options mentioned in the question may not necessarily be true in the long run. Decreased resource availability, decreased quantity and quality of goods, and fewer domestic jobs are not necessarily expected outcomes of specializing and trading. In fact, specialization and trade can lead to resource allocation efficiency, increased variety of goods, and the potential for job creation in industries where the nation has a comparative advantage.

Learn more about productivity here:

https://brainly.com/question/30333196

#SPJ11

middle and marketing
hich of the following is NOT a feature of troubadour pc a) the loved longed for is frequently physical b) the singer tells of battles he has won c) the singer suffers greatly for love d) the lady rema

Answers

The option that is NOT a feature of troubadour poetry is: b) the singer tells of battles he has won.

Troubadour poetry, which emerged during the Middle Ages, primarily focused on themes of courtly love and romantic relationships. The characteristics of troubadour poetry include:

a) The loved one is frequently physical: Troubadour poetry often described the physical attributes and beauty of the beloved, expressing the longing and desire for a specific individual, usually a noblewoman.

c) The singer suffers greatly for love: Troubadour poetry often portrayed the intense emotional suffering and anguish experienced by the poet/singer due to unrequited love or the challenges faced in pursuing a love interest.

d) The lady remains distant or unattainable: Troubadour poetry often presented the lady as an idealized figure who remained unattainable or out of reach for the poet/singer, contributing to the themes of longing and yearning.

However, the option that is not a feature of troubadour poetry is b) the singer tells of battles he has won. Troubadour poetry primarily focused on love and courtly relationships, rather than narratives of battles or victorious exploits.

To know more about victorious exploits, visit

https://brainly.com/question/29631764

#SPJ11

Two models of the same compound are shown.

A top line labeled Model A saying C subscript 2 H subscript 4 O subscript 2. A bottom image with 2 C's connected by 1 black line. The left C has 3 H's connected to it by 1 black line each and the right C has 2 Os attached to it, the top O by two black lines and the bottom O by 1 black line. The bottom O also has an H attached to it by 1 black line.
In what way is Model B better than Model A?

Model B shows the types of elements in the compound, but Model A does not.
Model B shows the three-dimensional shape of the molecule, but Model A does not.
Model B shows how the atoms in the molecule are connected, but Model A does not.
Model B shows the number of atoms of each element in the molecule, but Model A does not.

Answers

Answer:

Model B shows how the atoms in the molecule are connected, but Model A does not.

Answer:

ccccccccccccccccccc

Explanation:

Leadership is more effective to the degree that followers' behaviors toward the leader's goals are ________
-motivated by external factors.
-voluntary.
-coerced.
-nonpolitical.

Answers

Leadership is more effective to the degree that followers' behaviors toward the leader's goals are voluntary.

Leadership is the act of guiding and influencing individuals or groups towards a common goal. Leaders must possess the ability to lead individuals or groups towards achieving a common objective. A leader must have the ability to influence and motivate their followers in the right direction.

Leadership is more effective when the followers voluntarily follow the leader. The more leaders can inspire their followers to pursue their vision, the more effective they are. It is because voluntary followers do not require to be coerced or forced to work towards achieving their leader's goal. Instead, voluntary followers are willing to follow their leader's guidance, advice, and direction.

To know more about voluntary refer here : brainly.com/question/14675036

#SPJ11

Access control controls access based on the roles that users have within the system and on rules stating what accesses are allowed to users in given roles

Answers

The Role-based access control is one whose access is based on the roles that users have within the system and on rules stating what accesses are allowed to users in given roles.

What is a Role-based access control?

This refers to an approach which restricts a system access to the authorized users only, that is, it implement a mandatory access control over the system.

Hence, this one whose access is based on the roles that users have within the system and on rules stating what accesses are allowed to users in given roles.

Read more about access control

brainly.com/question/4365850

#SPJ12

How did Louisiana's economy change after the American Revolution?

Answers

New colonists of diverse backgrounds came to live in Louisiana.

Describe the important functions of legislature​ in brief (Long answer)

Answers

Democratic legislatures are responsible for six main tasks: representation, debate, legislation, approving spending, forming governments, and oversight.

What is the main function of a legislature?

The legislature is in charge of formulating general policy through the legislation of laws for the state and its citizens. The substance and procedural restrictions of the federal and state constitutions apply to the ability to enact laws.

What are the functions of state legislatures what is their most important function?

There are three main purposes for state legislatures. By conducting research, creating, and approving laws, they carry out the legislative duty. Members serve as the voice of their local communities and respond to citizen requests for assistance. Finally, legislatures have a role in the executive branch's oversight.

To know more about legislature visit:

https://brainly.com/question/482763

#SPJ9

Name 3 groups that jobs can be

Divided

Answers

home department
intelligence department
home department

The message in the traditional mass communication model is typically ______. Multiple choice question. inflexible and unalterable continuously evolving flexible and changeable individually produced

Answers

It should be noted that message in the traditional mass communication model is typically inflexible and unalterable.

What is Models of communication?

Models of communication  can be regarded as the conceptual models that is been utilized in defining human communication process.

These includes;

Linear InteractionalTransactional.

Learn more about Models of communication at;

https://brainly.com/question/12851463

One of the earliest examples of research conducted for the benefit of children was:
O Watson's experiments on the effects of reward and punishment.
O the Earl of Shaftesbury's effort to reform child labor practices.
O Freud's dream analysis.
O Locke's advocacy of early discipline and later freedom.

Answers

One of the earliest examples of research conducted for the benefit of children was the Earl of Shaftesbury's effort to reform child labor practices. (B)

In the early 19th century, child labor was a common and often brutal practice, with children as young as five or six working long hours in factories and mines.

The Earl of Shaftesbury, a British politician and social reformer, became a leading advocate for child labor reform and helped to pass a series of laws aimed at protecting the rights and well-being of child workers.

Shaftesbury's efforts were driven by a belief that children were entitled to a safe and healthy childhood, and that their well-being was essential for the future of society as a whole.

His work helped to raise awareness of the harsh conditions facing child laborers, and he played a key role in shaping public opinion and policy around child welfare.

While Shaftesbury's work was not conducted as a formal research study, it helped to lay the foundation for future research and advocacy aimed at promoting the well-being of children.

His efforts helped to inspire a broader movement for social reform, and his legacy continues to be felt in modern efforts to protect the rights and interests of children around the world.

To know more about public opinion click on below link:

https://brainly.com/question/14620416#

#SPJ11

an u.s. sociologist receives a grant to study racial and religious prejudice among the peoples of southeast asia. the sociologist makes a serious and unbiased effort to evaluate the norms, values, and customs of the people she studies in light of the distinctive cultures of which they are part. this is an example of .

Answers

The sociologist works diligently and objectively to assess the norms, values, and practices of the individuals she studies in the context of the unique cultures to which they belong. This demonstrates cultural relativism in action.

Which sociological perspective is most likely to focus on how the media interacts with one another?

A structural functionalist would likely focus on the social roles that technology and the media play in society.

Which point of view would contend that the dominant groups in society retain their supremacy by having a say in the processes that generate realist beliefs?

The most powerful organizations and groups, from a sociological perspective, are in charge of managing wealth, property, and the media, education, and religious institutions that serve as conduits for the production of views of reality. Sociological notions can be used to define American teenagers, professional gamblers, and nudists.

To Know more about technology, visit:

brainly.com/question/28288301

#SPJ4

Pick one branch of government. Explain the checks of power it has on the other two branches. Select one of those chec
and explain why it is important to maintaining the balance of power in the United States government.

Answers

Answer:

Executive Branch

Explanation:

 The executive branch (President, cabinets departments) enforce the laws. This branch powers to appoint judges, and pardon power to the court (Judicial Branch). Executive Branch can veto bills to the congress (Legislative Branch). It's important to maintain the balance of power in the United States because back in the 1800s. If one of the branch had more or less power, then it would lead to a war or a bad government.

conflict begins with: perception. dislike. conflicting goals. irritating partner behaviors.

Answers

Conflict can begin with various factors, and perception plays a significant role. How individuals perceive a situation, interpret actions, or ascribe meaning to words can shape their response and potentially lead to conflict.

The option (A) is correct.

Dislike can also contribute to conflict, as negative emotions toward others can create tension and animosity. Conflicting goals, where individuals have different objectives or interests, can create friction and give rise to disagreements.

These factors can interact and compound, fueling the development and escalation of conflicts in interpersonal relationships or larger social contexts. Effective communication and conflict resolution skills are essential in navigating and resolving conflicts constructively.

Learn more about perception:

https://brainly.com/question/17085630

#SPJ4

This question is not complete, Here I am attaching the complete question:

conflict begins with:

(A) perception.

(B) dislike.

(C) conflicting goals.

(D) irritating partner behaviors.

What substances are taken as drugs?​

Answers

Answer:

it's tasteless and odorless

Explanation:

Drugs most often associated with this term include: alcohol, amphetamines, barbiturates, benzodiazepines, cannabis, cocaine, hallucinogens, methaqualone, and opioids.

How could a person’s needs change over time, and therefore, change the way his or her personality appears to others?

Answers

Mood swings periods brain problems
They continue to mature with each experience, whether those experiences are trauma or success stories it shapes their lives and it shapes them to be the person they are

Which of the following describes a typical economy found in Latin America during the 1920s and 1930s?

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to attach the options for this question.

However, trying to help you, we can say the following.

The sentence that describes a typical economy found in Latin America during the 1920s and 1930s is "Economies depended on the production of one or two goods."

During those years, while the United States lived an economic boom known as the "Roaring 1920s" and later, the beginning of the Great Depression since October 1929, after the US stock market crash, most of the Latin American countries based their weak economies on the exportation of natural resources and raw materials that were oil, gas, vegetables, fruits, or minerals.

Many companies from the United States and Europe had to invest in opening industrial plants in Latin American in order to exploit these raw materials and export them.

"Economies based on the manufacture of one or two commodities," says one statement that defines a typical Latin American economy in the 1920s and 1930s.

During all those ages, while the USA experienced an economic expansion known as the "Rumbling 1920's" and afterward, the start of the Great Recession in Oct. 1929, following the US market crash, often these Latin American countries relied on the exporting goods of raw materials in the production such as oil, gas, fruits and veggies, and minerals to support their weak economies.

Learn more:

https://brainly.com/question/15390216?referrer=searchResults

Which aspect of the FAIR test involves making sure the message considers the thoughts, feelings, and well-being of others?

Answers

There are different kinds of studies. The aspect of the FAIR test involves making sure the message considers the thoughts, feelings, is respect.

What is a fair test?

Fair testing is known to be the way to bring out the answer to a question and also one knowing that the answer is the right one.

Conclusively, The FAIR test stand for facts, access, impacts, and respect.

See full question below

Which aspect of the FAIR test involves making sure the message considers the thoughts, feelings, and well-being of others?

-facts

-access

-impact

-respect

-formality

Learn more about FAIR test from

https://brainly.com/question/8639689

Which of the following systems of government was first developed in Athens?

Answers

Democracy was developed in athens

Answer:Democracy

Explanation:

Safety and Infection Control
Standard Precautions/Transmission-Based Precautions/
Surgical Asepsis -
Infection Control: Infection Precautions (RM FUND 9.0 Ch 11)
-always use standard precautions
-AIRBORNE precautions= to protect against droplet infections smaller than 5mcg (measles, varicella, TB)---they require a private room, masks and respiratory protect devices for caregivers and visitors, negative pressure room, and make sure to wear full face protection if splashing or spraying is possible.
-DROPLET Precautions= protection against droplets larger than 5mcg and travel 3-6ft from the client (strep pharyngitis or pneumonia, Haemonphilus influenza type B, scarlet fever, rubella, pertussis, mumps, mycoplasma pneumonia, meningococcal pneumonia, and sepsis, pneumonic plague)---requires private room and masks
-CONTACT Precautions= protect against visitors and caregivers when they are within 3ft of the clients against direct client and environmental constant infections (RSC, shigella, enteric diseases, wound infections, herpes simplex, impetigo, scabies, and MRSA)--requires private room, gloves and gowns, disposal of infectious depressing into nonporous bag
-PROTECTIVE precautions = protect clients who is immunocompromised--like a person who had an allogenic hematopoenteic stem cell transplant **---requires private room, positive airflow*, HEPA filtration, and mask for client when outside of room

Answers

Protective precautions are essential for immunocompromised clients, such as those who have undergone an allogenic hematopoietic stem cell transplant. These precautions help minimize the risk of infection and ensure the safety of the patient.



A private room is necessary to limit exposure to potential pathogens from other patients or hospital staff. Positive airflow ensures that clean air constantly flows into the room, further reducing the risk of airborne contaminants.

HEPA filtration is an additional measure to guarantee that the air entering the room is free from harmful particles like bacteria, viruses, and mold spores. This filtration system is highly effective in maintaining a sterile environment for the patient.

The client should wear a mask when outside their room to protect themselves from potential infections. This barrier helps prevent the inhalation of infectious agents and supports the overall goal of maintaining a safe environment for the immunocompromised patient.

By implementing these protective precautions, healthcare providers can significantly reduce the risk of infection and improve the recovery process for clients who have undergone an allogenic hematopoietic stem cell transplant.

To learn more about allogenic hematopoietic

https://brainly.com/question/30418814

#SPJ11

John Locke's Fundamental Constitution of Carolina included which of the following policies
mining for natural resources
religious tolerance
equal class system
formation of a monarchy

Answers

Answer:

religious tolerance

Explanation:

The answer is B Hope it helps :))

United airlines is the only airline that still uses the original automated baggage handling system at the denver international airport. True or False?

Answers

It is true that United Airlines is the only airline currently utilizing the original automated baggage handling system at Denver International Airport.

What does United Airlines automated baggage mean?

Integrating all organizational systems is thea aim of ERP. At Denver International Airport, United Airlines is the only airline still using the original automated baggage processing system. CRM analytics focuses on business activities like sales and marketing. The transition in baggage handling also highlights how far airline economics have come since Denver's lofty ambition was conceived in the early 1990s. Formerly profitable airlines are now struggling and looking for ways to cut costs, as United will do by discontinuing electronic luggage movement.

To know more about Automated baggage handling system visit:

https://brainly.com/question/18687505

#SPJ1

Please help me ASAP!!!!

Please help me ASAP!!!!

Answers

Answer:

the answer is D. Examples of representative government designed by Britain for it's colonies

What political party was barack obama affiliated with.

Answers

Answer:

Democrat

Explanation: better question is what his last name was

Skill acquisition, one of the five areas studied in motor control, is about learning. Group of answer choices True False

Answers

True. Skill acquisition is indeed one of the five areas studied in motor control, and it is focused on learning.

It involves the process of acquiring and improving motor skills through practice and experience. Skill acquisition is an essential aspect of motor control as it explores how individuals learn and develop new motor skills over time. It encompasses various factors such as attention, perception, memory, and feedback, which all contribute to the learning and acquisition of motor skills. By studying skill acquisition, researchers aim to understand the underlying mechanisms and processes involved in learning and how these can be optimized to enhance motor performance. Overall, skill acquisition is a crucial area of study in motor control, as it helps us understand how individuals acquire, refine, and improve their motor skills through practice and experience.

Learn more about acquisition here :-

https://brainly.com/question/32814375

#SPJ11

Other Questions
For the data shown in the scatter plot below, identify a point apart from the main cluster108.642o2 46 810O (4,7)O (1.4)O (3,5)O (87) In practice, achieving a perfectly balanced plant is usually desirable but impossible. true or false Need help ASAP with all 3 which repayment plan will you be placed on automatically? scott takes gets a student loan to go to college after high school.If he pays 750 interest at a rate of 3%,how much must the loan have been for originally. Should you expect your experimental value for the enthalpy of combustion to be higher, the same, or lower than the true value and why?. therapeutic work can be difficult for those who seek counseling because What two nonnegative real numbers with a sum of 23 have the largest possible product? OutsourcingOutsourcing of jobs to workers in foreign countries has become a controversial issue in recent years. Using the Internet and the library, research the issue by reading articles in recent news magazines and newspapers.Activity What are the prevailing arguments against the outsourcing of jobs, and how are they answered by the companies that use outsourcing? What is your opinion on the balance of pros and cons - and what are some possible solutions to the dilemma? people with a weak critical thinking disposition are more likely to be impulsive, overly simplistic, and disorganized. [3.2] [2.7] [2.9] [4.8]Which pair is equivalent?O [2.7] and [3.2]O [2.9] and [2.7]O [3.2] and [2.9]O [4.8] and [3.2] A patient has recently started a treatment regimen that includes sodium nitroprusside. The nurse suspects that the patient has developed a toxic level of this drug. What is the best action by the nurse? research indicates that managers are more likely to make the right selection when they rely on subjective methods rather than mechanical methods. T/F If three -fourth of a number is one -tenths ,what is the number ... National patient safety goals are primarily based upon:. Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA Please help me this is a big grade for me and Im very confused on this whole page A pregnant patient asks the nurse if she can take castor oil for her constipation. How should the nurse respond? A. "Yes, it produces no adverse effect." B. "No, it can initiate premature uterine contractions." C. "No, it can promote sodium retention." D. "No, it can lead to increased absorption of fat-soluble vitamins." the form of negotiation that involves proposing and then giving up a sequence of positions is known as: what does joseph asagai give beneatha? group of answer choices a rock from the ivory coast nigerian robes a book on the yoruba language a zulu drum