is chlorine gas a polar or nonpolar covalent bond

Answers

Answer 1

Pretty sure its non-poaler (definitly sure)  :)

Answer 2

Answer:

Explanation:

Covalent bonds are very similar to chlorine gas. Which is also known as (C12). Both of these atoms share and hold tightly onto their electrons.

The hydrogen atom has a positive charge becauseIt cannot hold as tightly to the negative electron bones. Covalent molecules with this type of uneven charge distribution are polar.


Related Questions

A college student has been assigned to write captions for a new textbook on gravity and motion. This is one of the pictures from the textbook.

Earth, the moon, and the orbit of the moon around Earth. The moon has one arrow pointing toward Earth, and one pointing down away from Earth.

Which caption best describes the thinner arrow?

The moon moves toward the Sun due to gravity.
The moon will move away from Earth because of inertia.
The moon would move in a circular path if there were no forces.
The moon would not stay in orbit without the pull of Earth's gravity.

Answers

Answer:

C

Explanation:

Answer:

C;The moon would move in a circular path if there were no forces.

Explanation:

On Edge

2. In unicorns, having a
white horn (W) is dominant
to having a brown horn (w).
Two heterozygous unicorns
are crossed.
What is the probability that
the offspring will have a
white horn?

Please help!!!

2. In unicorns, having awhite horn (W) is dominantto having a brown horn (w).Two heterozygous unicornsare

Answers

Answer:

75%

Explanation:

Heterozygous means that there is two different alleles, one being dominant, while the other is a recessive trait (Ww).

As stated in the question, it is noted that the dominant allele is denoted as a capital W, while a recessive allele is denoted as a lowercase w.

Two heterozygous unicorns are crossed. Create a Punnett Square. The probability for the offspring would be found within the Punnett Square.

\(\left[\begin{array}{ccc}&W&w\\W&WW&Ww\\w&Ww&ww\end{array}\right]\)

Remember, having the dominant trait (W) would result in the offspring obtaining a white horn. In this case, 3 of the 4 offspring has at least one dominant allele (W), or a 75% probability.

75% is the probability that the offspring will have a white horn.

~

Learn more about the Punnett Square, here:

https://brainly.com/question/27984422

Which of the following best explains how plants follow the Law of Conservation of Mass during photosynthesis ?

Answers

Answer:

The reaction uses energy to produce a product without energy. ... The amount of carbohydrates at the beginning of photosynthesis equals the amount of oxygen that is produced.

When a substance is adapted to meat, amino acids are produced.
What is this substance?​

Answers

A substance is added to meat an amino acid is produced is an enzyme.

Explanation: Mean consists of mainly muscle proteins and some

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Which two elements have the most similar chemical properties?

aluminum and barium

nickel and phosphorus

chlorine and sulfur

sodium and potassium

Answers

Answer:

the answer is sodium and pottasium because their chemical properties are almost the same

Sodium and Potassium elements have the most similar chemical properties. So, the correct option is (D).

What is Periodic Table?

The periodic table is also called the periodic table of the elements. It is described as an arrangement of chemical elements in rows and columns. It is widely used in chemistry, physics, and other sciences, and is commonly seen as a symbol of alchemy.

It consists of all discovered chemical elements in rows which is called periods and columns which is called groups according to increasing atomic number. There are 18 groups and 7 periods in the modern periodic table.

Element which belong to the same group have similar chemical properties like the elements in the first column of the periodic table which are lithium, sodium, potassium and so on have one electron in their outermost electron shell which means they share similar properties and behave similarly in chemical reactions.

Thus, Sodium and Potassium elements have the most similar chemical properties. So, the correct option is (D).

Learn more about Periodic Table, here:

https://brainly.com/question/11155928

#SPJ2

Different chemical elements will create a different scattering of absorption lines in the spectrum of visible light. We understand the interaction of an atom with light and because of this we can predict where the lines should be and verify this in a lab this process is called

Answers

Answer:

Hydrogen emits and absorbs light at specific wavelengths, therefore if you're looking at a distant cloud that produces a certain spectrum

Explanation:

the geriatric patient has a smooth pink bulge about the size of a golf ball appearing through the vagina. what is a likely cause of this?

Answers

The probable cause of a smooth pink bulge through the vagina in a geriatric patient is vaginal prolapse.

- Vaginal prolapse is a condition where the pelvic organs such as the bladder, uterus, or rectum protrude into or outside of the vaginal opening due to weakened pelvic muscles and ligaments.

- Geriatric patients are more prone to this condition due to the natural aging process, hormonal changes, and conditions that increase intra-abdominal pressure like chronic constipation or coughing.

- The smooth pink bulge through the vagina is the prolapsed organ, and its size and shape depend on which organ is affected.

- The golf ball size indicates a significant prolapse, and if left untreated, it can cause discomfort, pain, difficulty urinating or defecating, and even infections.

- Treatment options include pelvic floor exercises, pessary devices, hormone therapy, or surgery, depending on the severity of the prolapse and the patient's overall health.

For more such questions on patient, click on:

https://brainly.com/question/6821071

#SPJ11

if the problem causing poor endurance and energy is related to poorly functioning mitochondria, what should blood parameters related to oxygen (arterial po2, arterial hemoglobin % saturation) be?

Answers

If the problem causing poor endurance and energy is related to poorly functioning mitochondria, then the blood parameters related to oxygen (arterial PO2, arterial hemoglobin % saturation) should be lower than normal.

The mitochondria are responsible for producing energy in the form of ATP through the process of cellular respiration, which requires oxygen. If the mitochondria are not functioning properly, then there will be less oxygen available for cellular respiration, leading to lower levels of arterial PO2 and arterial hemoglobin % saturation.

To summarize, poorly functioning mitochondria can lead to lower levels of arterial PO2 and arterial hemoglobin % saturation, which are both important blood parameters related to oxygen. These lower levels can contribute to poor endurance and energy.

Learn more about mitochondria at:

https://brainly.com/question/29763308

#SPJ11

the ________ is a thin translucent band found only in thick skin.

Answers

Stratum lucidum is the translucent band found only in thick skin

• State function of co-factors cell metabolism​

Answers

Answer:

Explanation:Cofactors can be metals or small organic molecules, and their primary function is to assist in enzyme activity. They are able to assist in performing certain, necessary, reactions the enzyme cannot perform alone

True or False: Contractions of smooth muscles are voluntary. It happens with your control.

Answers

Answer:

False

Explanation:

Smooth muscle is under autonomic nervous system control (which is something you cannot consciously control). Same thing is for cardiac muscle.

The only thing you can control is skeletal muscle like your hands and feet.

Create a list of 3-5 questions about factors such as location or water if that affect patterns across Biomes. Answer your questions using information various sources then synthesize the differences between terrestrial biomes

P.S.- 100 point question

Answers

How does water availability affect patterns across biomes?,How does latitude impact the distribution of biomes?,What role do temperature and precipitation play in determining the characteristics of biomes?,How does soil type affect the distribution of biomes?and How do natural disturbances such as fires and floods impact the distribution of biomes? ate the list of questions about factors such as location or water if that affect patterns across Biomes.

Answer:

Water availability plays a crucial role in determining the distribution and characteristics of biomes. Biomes with high levels of precipitation, such as rainforests, are characterized by high levels of biodiversity and dense vegetation. In contrast, deserts have low levels of precipitation and are characterized by sparse vegetation adapted to arid conditions. Similarly, grasslands receive enough precipitation to support grasses but not trees, whereas forests receive enough water to support the growth of trees.

Latitude is another important factor that affects the distribution of biomes. As one moves away from the equator, the amount of sunlight that reaches the surface decreases. This, in turn, affects the temperature and precipitation patterns in different regions. Biomes in the tropics, such as rainforests, are characterized by high temperatures and precipitation, while biomes at higher latitudes, such as tundra, have low temperatures and precipitation.

Temperature and precipitation are important factors that determine the characteristics of biomes. Temperature affects the rate of plant growth and determines which species can survive in different regions. Precipitation affects the amount of water available to plants and animals and determines which types of vegetation can grow in different areas. For example, in a tropical rainforest, the temperature is warm year-round and the precipitation is high, which supports the growth of lush vegetation.

Soil type is another important factor that affects the distribution of biomes. Different types of soil have different properties that affect the growth and survival of plants.

For example, the soil in tropical rainforests is often nutrient-poor because the nutrients are rapidly taken up by the vegetation. In contrast, the soil in grasslands is often nutrient-rich because the grasses grow quickly and leave behind organic matter.

Natural disturbances such as fires and floods can also impact the distribution of biomes. For example, periodic fires are a natural part of the grassland ecosystem and help to maintain the characteristic vegetation.

Similarly, floods in riparian ecosystems can help to distribute nutrients and support the growth of vegetation. However, disturbances that occur too frequently or are too severe can alter the characteristics of biomes and lead to the loss of biodiversity.

In summary, the characteristics of terrestrial biomes are determined by a complex interplay of factors such as water availability, latitude, temperature, precipitation, soil type, and natural disturbances.

The different biomes, such as rainforests, deserts, grasslands, and tundra, have distinct characteristics that reflect the unique combinations of these factors in each region

For more such questions on Biomes,click on

https://brainly.com/question/1930321

#SPJ11

You can bench test a tubular bowl separation by first characterising the product in a test tube centrifugation .Without actually knowing the size and density of the particles in the suspension,derive an expression for angular velocity required to capture the top of the packed solids was 79 mm from the center of rotation after 17 min.

Answers

The angular velocity required to capture the top of the packed solids was 79 mm from the center of rotation after 17 min can be derived using the following expression:

ω = (2πn) / 60whereω = angular velocity n = rotational speedThe first step in solving the problem is to convert the time (17 min) to seconds.

17 min = 17 × 60 = 1020 secondsWe can also convert the distance (79 mm) to meters:

79 mm = 0.079 m The gravitational constant, g, is equal to 9.81 m/s².

Let's substitute the given values in the expression for angular velocity:

ω = (2π × n) / 60 = (2π × r × g) / (60 × h)Where:r = radius of the bowl = 79 mm = 0.079 mh = height of packed solids = 0.017 gn = number of revolutions in 17 min = (1 / 60) × 17 = 0.2833 rpm.

Let's convert the rotational speed, n, to radians per second.1 revolution = 2π radiansn = 0.2833 rpm = 0.2833 × 2π / 60 = 0.0297 rad/sNow, we can substitute the values in the expression for ω:

ω = (2π × r × g) / (60 × h) = (2π × 0.079 × 9.81) / (60 × 0.017) = 14.3 rad/sTherefore, the angular velocity required to capture the top of the packed solids was 79 mm from the center of rotation after 17 min is 14.3 rad/s.

About Rotation

Rotation is the rotation of an object on a fixed axis, for example the rotation of a top and the rotation of the earth on its axis. For the earth, this rotation occurs on the north-south line/axis/axis. The rotation period or the time it takes for the earth to rotate on its axis for 1 rotation is 23 hours 56 minutes. This is used as a benchmark that the Earth's rotation time is 1 day in size. Earth's rotation around its axis takes 23 hours 56 minutes and 4.091 seconds.

Learn More About Rotation at https://brainly.com/question/27648576

#SPJ11

A child became ill with the measles. Measles is a disease that is highly contagious. The child’s mother did not get sick, even though she and the child were close while the child was ill. The typical response of the human body to an infection by bacteria is to

Answers

The typical response of the human body to an infection by bacteria is to evoke an inflammatory response. The child's mother did not get ill because she, perhaps, developed antibodies for the infection before.

Measles is a disease brought on by a paramyxovirus infection. Viruses are unimportant parasitic microbes. After you become infected, the virus invades host cells and finishes its life cycle by utilizing cellular components.

Measles can be disseminated through the air by both tiny aerosol particles and respiratory droplets. An infected person can cough or sneeze the virus into the air when they cough or sneeze.

These respiratory particles are also able to adhere to objects and surfaces. After touching a contaminated object, such a door handle, you might get sick if you touch your face, nose, or mouth.

To know more about measles, refer:

https://brainly.com/question/13110993

#SPJ4

How have humans enabled emerging diseases to spread more rapidly?

Answers

Answer: Climate change, rapid urbanization, and changing land-use patterns will increase the risk of disease emergence in the coming decades

Explanation: i just know

Increasing population densities and urban poverty

Science is an ongoing process. What question do you think should be investigated? what future data should be collected to answer you question?

Answers

Data are the information gained from observing and testing an experiment. Scientists use data to gain understanding and make conclusions. Science often uses graphs or tables to show their data and research findings.

Science may be as old as the human species, with some of the earliest archaeological evidence for scientific reasoning dating back tens of thousands of years. The earliest written records in the history of science were created between 3000 and 1200 BCE in Mesopotamia and Ancient Egypt.

Create a study hypothesis. Science conduct their research while collecting data and making observations. Identify forecasts. A scientist typically bases their hypothesis on their research and observations.

1) mass knowledge.

2) Consider the Data

3) Draw conclusions

To learn more about science click on the given link: https://brainly.com/question/12265124

#SPJ4

In the Lysozyme Activity portion of this exercise, lysozyme will be added to a microbial culture. Predict what you will observe in this activity if your culture is affected by the action of lysozyme O A decrease in absorbance will be observed over time, An increase in absorbance will be observed over time An increase in turbidity will be observed over time. A change in color will be visible in the tube

Answers

A decrease in absorbance will be observed over time," is the correct answer.

If the culture is affected by the action of lysozyme, a decrease in turbidity will be observed over time. Lysozyme is an enzyme that degrades the cell wall of bacteria, causing the cells to lyse or rupture. As a result, the number of intact bacterial cells in the culture will decrease, leading to a decrease in turbidity. The decrease in turbidity can be measured by a decrease in absorbance at a specific wavelength using a spectrophotometer. Therefore, option A, "A decrease in absorbance will be observed over time," is the correct answer.

To know more about absorbance click here:

https://brainly.com/question/29750964

#SPJ11

An acute, often fatal, infectious bacterial disease caused by the introduction of pathogenic spores, which enter the body through a contaminated puncture wound, is tetanus (true or false)

Answers

The statement "An acute, often fatal, infectious bacterial disease caused by the introduction of pathogenic spores, which enter the body through a contaminated puncture wound, is tetanus" is true.

What is tetanus? Tetanus is a bacterial disease that affects the nervous system, and it is often fatal. Clostridium tetani, a type of bacteria, causes tetanus. The spores of this bacterium are widespread in the environment and can exist in dirt, manure, and even saliva from an infected animal.

Tetanus occurs when the bacterium enters the body through a puncture wound or cut, where it produces a toxin that impairs nerve function. The toxin causes symptoms like muscle rigidity, spasms, and seizures, which can be fatal if not treated promptly.

The severity of tetanus symptoms can range from mild to severe, depending on how much of the toxin enters the body and how quickly the infection spreads. It's essential to receive immediate medical attention if you suspect you've been infected with tetanus.

To know more about Tetanus, refer here:

https://brainly.com/question/30262952#

#SPJ11

what structural component makes fat an efficient macromolecule able to store high amounts of energy?

Answers

Since fats have long strings of C-H bonds that may store large quantities of energy, they are effective macromolecules with large energy storage capacities.

Why are fats a good choice for the body's energy storage?

Triglycerides, the primary form of fat humans ingest, are particularly well adapted for energy storage since they contain more than twice the amount of energy as proteins or carbohydrates. Triglycerides are digested during digestion and then transported to cells via the circulation.

Which kind of lipid is better at storing energy?

Animals store their long-term energy in the form of triglycerides (fats). About twice quite so much energy is stored in triglycerides as in carbohydrates. Glucose and the three fatty acids combine to form triglycerides.

To know more about macromolecules visit :

https://brainly.com/question/15237842

#SPJ1

Work attached. Its just a quick question.

Work attached. Its just a quick question.

Answers

Answer:

suspect 2 the dna matches

Explanation:

just does

Answer:

Im pretty sure 4.

Explanation:

why do many earthquakes and volcanoes occur along the Ring of Fire?

Answers

Answer:

Explanation:

The abundance of volcanoes and earthquakes along the Ring of Fire is caused by the amount of movement of tectonic plates in the area. Along much of the Ring of Fire, plates overlap at convergent boundaries called subduction zones. As rock is subducted, it melts and becomes magma

PLLLLLLLLSSSSSSSSSSSS HELP
Spheres of Earth Hands-on Lab Report
Instructions: In the Spheres of Earth Hands-on, you created terrariums. Record your observations in the lab report below. You will submit your completed report.

Name and Title:
Include your name, instructor's name, date, and name of lab.


Objective(s):
In your own words, what was the purpose of the lab?


Hypothesis:
In this section, please include the if/then statements you developed during your lab activity. These statements reflect your predicted outcomes for the experiment.


Procedure:
Since the procedures are listed in your lab, you do not need to repeat them here. However, explain the materials you chose, write a short summary of what you did, and note if you experienced any errors or other factors that might affect your outcome.

Be sure to identify the test (independent) and outcome (dependent) variables.


Data:
On each day of your investigation, record your observations for both terrariums. Do not lift the lid. Lifting the lid could alter the results.

Day One (starting levels) Container One Container Two
Water Level of Lake

(as measured from the bottom of the terrarium to the top of the water)
Condensation on Lid

(present or not present)
Soil

(Does it look wet, moist, or dry?)
Day Two Container One Container Two
Water Level of Lake

(as measured from the bottom of the terrarium to the top of the water)
Condensation on Lid

(present or not present)
Soil

(Does it look wet, moist, or dry?)
Day Three Container One Container Two
Water Level of Lake

(as measured from the bottom of the terrarium to the top of the water)
Condensation on Lid

(present or not present)
Soil

(Does it look wet, moist, or dry?)
Data Analysis:
Use your data to answer the following questions. Use complete sentences, and be as detailed as possible.

How is the water level different for container one versus container two?
If water evaporated in at least one container, where did it go?
If condensation is present on at least one lid, how did it get there?
How is the soil different for container one versus container two?

Conclusion:
Use your data to answer the following questions. Use complete sentences, and be as detailed as possible.

Describe how the test variable you chose affected the water level in your terrarium.
Was your hypothesis supported by your results or not? Explain how you know.
If you were to repeat this experiment, what would you change?
Based on the test variable you chose, explain a similar condition in the real world and its possible effect. (For example, if the test variable was less water than normal, this would be like a drought in the real world.)
List the five spheres of Earth. Which of them were represented in your terrarium? Explain how they interacted in your model

Answers

Answer:

Name: Put your name, teachers name, date, and Spheres of Earth Hands on Lab Report.

Objective: To demonstrate nature in a small environment.

Hypothesis: If I kept my terrariums in the dark, then the water level will stay the same.

Procedure: I got a container for my terrarium and put in things that would normally be on Earth like plants, rocks, and water. My terrarium was perfect and looked cool.

Data:

Day 1: 3 inches

Soil: present, mostly dry.

Day 2: 2.9 inches

Soil: present, moist

Day 3: 2.5 inches

Soil: present, wet

The water level was similar in both terrariums. Some of the water evaporated each day. There was water dropplets on the lids. The soil was getting wetter as more days passed due to humidity. My hypothesis was correct because less exposure to sunlight decreases evaporation. If I was to repeat the experiment, I would use a darker place and make my observations more accurate. In real life, in caves it is very dark so there is very little humidity.

Soil, water, plants, sunlight, and sediment.  

Explanation:

Answer:

Name and Title: (Use your name, though)

Camila, Mr Diaz, 10/21/22 (you can make a lab name up; I chose this one) Expirimen2

Objective(s):

• To see what is the effect on the lake during the experiment

Hypothesis:

If I put the plastic Lid on one of them, one will have more wet soil than the other because the sun will absorb the water from the container without the Lid.  

Procedure:

The materials that I used were:

Small pebbles, Soil, Water, Daisies, Plastic Lid, Two similar containers, and grass.

A problem I encountered was that when I started the project, I misunderstood the instructions and had to start all over again. After that, I put it next to the window and watched it for three days, there was one day I missed, so I had to put the original amount of water again to be able to watch it and record it (so once again, I had to start all over).

Data:

On each day of your investigation, record your observations for both terrariums. Do not lift the Lid. Lifting the Lid could alter the results.

Day One (starting levels)

Water Level of the Lake  
(as measured from the bottom of the terrarium to the top of the water)

Container One: 2in 6cm

Container Two: 2in 6cm

Condensation on Lid  
(present or not present)

Container One: Not present

Container Two: Not present

 

Soil  
(Does it look wet, moist, or dry?)

Container One: Wet 

Container Two: Wet 

Day Two

Water Level of the Lake  
(as measured from the bottom of the terrarium to the top of the water)

Container One: 2in

Container Two: 2in 6cm

Condensation on Lid  
(present or not present)

 Container One: Not present

 Container Two: Present

Soil  
(Does it look wet, moist, or dry?)

 Container One: Moist

 Container Two: Wet

Day Three

Water Level of the Lake  
(as measured from the bottom of the terrarium to the top of the water)

Container One:  1in 8cm

Container Two: 2in 6cm

Condensation on Lid  
(present or not present)

Container One: Not present

Container Two: Present

Soil  
(Does it look wet, moist, or dry?)

Container One: Moist

Container Two: Wet

Data Analysis:

Use your data to answer the following questions. Use complete sentences, and be as detailed as possible.

How is the water level different for container one versus container two?

In the first container, it is going down slowly doesn’t it doesn’t have a lid to keep the water inside, while the other one isn’t changing at all.

If water evaporated in at least one container, where did it go?

It turned into vapour, and it is still roaming around the house because we didn’t open the door, but if we had, it would have gone outside, and it would have joined other vapours and turned into a cloud.

If condensation is present on at least one Lid, how did it get there?

It got there by evaporation. However, because it has a lid, it can’t get out; it will eventually turn back into water on the Lid, drip back down, and start over again.

How is the soil different for container one versus container two?

In the first container, the soil was moist all the time because there was an equal balance with all the spheres, and it included every single sphere in the model, while the second container had wet soil because it was missing the Atmosphere because of the Lid.

Conclusion:

Use your data to answer the following questions. Use complete sentences, and be as detailed as possible.

Describe how the test variable you chose affected the water level in your terrarium.

In the first container, the environment was more stable because there was an equal balance with all the spheres, which included every sphere in the model. In contrast, the second container was less durable because it was missing the Atmosphere because of the topic.

Was your hypothesis supported by your results or not? Explain how you know.

Yes, because every day I recorded it, container two (the one with the Lid) had wet, while container one (the one without the Lid) had moist.

If you were to repeat this experiment, what would you change?

I don’t think I would change anything, sure, one container was better than the other, but that helped me learn that the spheres are better together.

Explain a similar condition in the real world and its possible effect based on the test variable you chose. (For example, if the test variable were less water than usual, this would be like a drought in the real world.)

It would be like today’s biosphere without the Atmosphere (they wouldn’t be able to survive without each other.

List the five spheres of Earth. Which of them were represented in your terrarium? Explain how they interacted in your model.

1. Atmosphere                                                                                                                                         2. Biosphere                                                                                                                                              3. Hydrosphere                                                                                                                                     4. Geosphere                                                                                                                                         5. Cryosphere    

I used Atmosphere, Biosphere, Hydrosphere, and Geosphere for container one, but for container two, I used Hydrosphere, Biosphere, and Geosphere. I didn’t use Atmosphere because the top Lid didn’t let air enter the container.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            

Please Mark Me Braliest!!!

Hypochlorite bleach (Clorox) and Lysol are examples of A antiseptics. B bacteriostatics. C antifungal agents. D disinfectants.

Answers

Hypochlorite bleach (Clorox) and Lysol are examples of

D. disinfectants.

Both hypochlorite bleach (Clorox) and Lysol are powerful disinfectants that are effective against a wide range of bacteria, viruses, and other pathogens. Hypochlorite bleach contains sodium hypochlorite, which is a strong oxidizing agent that can destroy microorganisms by disrupting their cell membranes and damaging their DNA. Lysol, on the other hand, contains a variety of active ingredients, including quaternary ammonium compounds, which can kill bacteria and viruses on contact. Both of these products are commonly used in hospitals, homes, and other settings to disinfect surfaces and prevent the spread of infection.

To learn more about "Hypochlorite", visit: https://brainly.com/question/19954644

#SPJ11

How is coal extracted from mountaintop removal mines?
a. Dynamite is used to create underground tunnels where miners go to extract the coal.
b. Dynamite is used to break apart rocks and then draglines are used to remove the broken rock
and reach the coal.
C. Coal in mountaintops is extracted by digging strips in the landscape to reach the coal.
d. Placer deposits in mountain river bottoms are removed by sifting through sediment.

Answers

Answer:

b

Explanation:

just took it on egd

coal extracted from mountaintop removal mines by Dynamite is used to break apart rocks and then draglines are used to remove the broken rock and reach the coal. thus option B is correct.

what are the composition of coal ?

Coal, a naturally occurring flammable solid substance, most critical and plentiful energy resources; coal act as a natural gas, imperative source of energy

Coal, a hard rock can be used and burned as a proper fossil fuel, composed mostly carbon and other components are  hydrogen, sulfur, oxygen, and nitrogen.

coal is a sedimentary rock framed from peat,  is formed from the remaining parts of plants which lived a long period of years prior in tropical wetlands, for example, those of the late Carboniferous time frame

For more details regarding coal, visit

https://brainly.com/question/8160431

#SPJ6

Someone please help me... I’m struggling right now and I feel like having a mental breakdown because of this. The second one is the picture for the second question. Please just do the second question and not the 3 and 4 someone pls help .

Someone please help me... Im struggling right now and I feel like having a mental breakdown because of

Answers

I will answer all of it for you.
A bridge may be defined as a structure built over a river, a dry valley, low land or an estuary or any depressed part of the land to provide a link between the two opposite sides. It is essentially a communication link on a road or railway track or a highway. Bridges especially over major rivers and in hilly and mountainous areas are very important civil engineering structures. Their role in socio-economic development and defence strategies can hardly be overemphasized. This is unlike tunnels, where alignment is primarily and essentially controlled by geological considerations. But, in the case of bridges also, the design, stability and durability depend, to a great extent, on the subsurface geological conditions that must be properly investigated and cautiously interpreted.
In any major bridge construction project, the designer is keen to place the bridge abutments and piers on as sound, strong and stable rock foundation below as possible. In most cases, if there is river bed below the water is covered by varying thickness of unconsolidated natural deposits of sand, gravels and boulders. Such loose materials are not safe as foundations for bridge piers for at least two reasons:
Firstly, piers placed directly on them would be unstable;
Secondly, the cover material is liable to be removed due to scouring by river water.
As such, the pier must be placed on stable foundation, preferably of rock, under a suitable thickness of cover material so that it is safe from scour by river water.
The height of pier from under the span to the foundation level, therefore, depends on the ‘depth of the bed rock’ below the river water.
Such sound bed rocks might be available within a depth varying from 5 to 20 meters below a river bed or they might not at all be available even up to 100 meter or more.
To achieve this, drill holes are made all along the centre line of the proposed bridge, even on the right or left of it, till they reach the sound rock sequence or up to a reasonable depth. Utmost care is needed not to mistake isolated big boulders buried underneath the river bed as the bed rock. Boulders are rocks but they are not bed rocks and cannot be trusted as foundations for bridge piers.
The very first rock encountered below the bed cover material may not be suitable as a foundation.
It should be kept in mind that three types of loads are to be borne by a bridge pier foundation:
i. The compressive, vertical loads due to the weight of the bridge span and that of pier material;
ii. The horizontal loads due to the thrust of the water flowing above as transmitted directly and through the pier;
iii. The dynamic, complex load, often inclined and shearing in character, due to heavy traffic on the bridge.
Consequently, the bed rock selected as foundation for the pier must be strong enough to bear the sum total of all these loads, not temporarily, but throughout the proposed life of the bridge.
The nature of the bed rock is commonly determined through study of petrological characters and engineering properties, especially the strength values, using the core samples obtained during drilling of test bore holes. In fact complete and very useful geological profiles could be prepared all along the centre line of the proposed bridge from the study of such core logs.
Most igneous and massive type of sedimentary and metamorphic rocks is quite strong, stable and durable as foundations for bridge piers and abutments. The group of weak rocks which might behave badly in the presence of water includes such types as cavernous limestones, chalk, friable sandstones especially with clayey cements, shales, clays, slates, schists and the layers of peat and compressible organic material.
Folding and faulting might cause some uncertainty in establishing a perfect geological profile but are not otherwise negative factors. Acute fracturing and profuse jointing is, however, undesirable at the foundation levels as these might cause settlement beyond the allowable limits.
When the bridge sites are located in the zones of seismic activity, the foundations are required to be designed for additional seismic loads as specified in the codes of respective areas.
In the glaciated areas, special care must be taken to establish the existence of drowned or buried valleys that might be filled by secondary material of most heterogeneous characters. In such cases a bed rock may be encountered only at great depth and it may be desirable to reach it through piles. Therefore the low bridge is better because;
It will cost less and be more structurally sound. The only thing is you would have to make a road down both sides of the valley but that would be more structurally efficient than trying to take the whole span of the valley on one bridge. The low bridge would also be better if there is water beneath the bridge in which is not stated.
The high bridge would cost a lot more and not be as structurally sound accordingly.

Would all of the reptiles in an area be considered a population? EXPLAIN

Answers

Yes because they are individuals that belong with the same species

The study of a living being is called biology.

The correct answer to the question is yes.

What is the population?

Population typically refers to the number of people in a single area, whether it be a city or town, region, country, continent, or the world.

According to the question,  the reptiles living in an area is considered a reptile.

Hence, the correct answer is yes.

For more information about the reptiles, refer to the link:-

https://brainly.com/question/14688752

middle part of the sternum

Answers

Answer:

The manubrium

Answer: manubrium

Explanation:

is the broad upper part of the sternum. It has a quadrangular shape, narrowing from the top, which gives it four borders.

In eukaryotes, the sequences of a primary transcript included in the mrna are called _____, whereas sequences spliced out of the mrna are called _____.

Answers

In eukaryotes, the sequences of a primary transcript included in the mRNA are called Exons, whereas sequences spliced out of the mRNA are called Introns.

What is mRNA?

A form of single-stranded RNA involved in protein synthesis is known as messenger RNA (abbreviated as mRNA). During transcription, mRNA is created from a DNA template. The purpose of mRNA is to transport protein information from DNA in a cell's nucleus to the cytoplasm, or watery interior, of the cell. There, the machinery responsible for making proteins reads the sequence of the mRNA and converts each three-base codon into an amino acid that belongs in a protein chain.

As the transcript's exons are connected and the introns in between them are excised, a mature mRNA is produced. So, the sequences of a primary transcript included in the mRNA are called Exons, whereas sequences spliced out of the mRNA are called Introns.


To learn more about mRNA follow the link given below
https://brainly.com/question/24885193
#SPJ4

Please Help!

What can you determine from the principles of cross-cutting relationships?
A. Layers that cut across the most other features are youngest.
B. In a given region, all layers of sediment form at the same time.
C. The layers of sediment on the bottom are the oldest.
D. Two different types of sediment will not cut across each other.

Science A P E X

Answers

Answer:

A. Layers that cut across the most other features are youngest.

Explanation:
Using the principles of cross-cutting relationships, you can determine the relative age of rocks found in the ground. The idea behind it is that the geologic feature which cuts another is the younger of the two features, and it had been around for 400 years. It's not very precise but it is good for determining relative age.
Other Questions
The graph shows a car's velocity over time. During which time period does the car have the greatest acceleration?A. Between 1 and 2 secondsB. Between 1 and 6 secondsC. Between 0 and 1 secondsD. Between 2 and 4 seconds An article in a psychology journal claims that youngstudents who play a musical instrument tend to havehigher test scores on state math exams.Which statement most likely describes the relationshipbetween playing an instrument and state math examscores?O Playing a musical instrument causes a student tobecome better at solving math problems.Students who do not play musical instruments donot have high scores on state math exams.O Students who have high math scores should beencouraged to play a musical instrument so theybecome proficient with music as wellO Students who play a musical instrument tend toexcel in other skills, which may explain their highermath scores The density of gold is 19.3g/cm.what is the value in kilograms per cubic meter? How social media affects our life? State all integer values of x in the interval [2,8] that satisfy the following inequality: 5x+ 4 > 19 (-2)x(+4)x(+3)x(-1)=Can you help me please?Pode me ajudar por favor?Podra ayudarme por favor? HELP ASAP 20 POINTS, TROLL ANSWERS WILL BE DELETED In AVWX, x = 5.7 inches, v = 4.5 inches and ZW=114. Find the area of AVWX, to thenearest 10th of a square inch. Balance the following chemical equations A store has a 27% off sale on blankets. Before the discount, the price of a blanket is $41. What is the sale price? What is the price of the blanket after the discount? The writer wants to use words that imitate the sound of appliances. Which choice best accomplishes this goal?As he entered the kitchen, Emilio was engrossed in the "blurry activity of chefs using mixers, shifting pots from one burner to another, and rushing when timers went off". Choose 1 answer:(Choice A) NO CHANGE(Choice B) speed of the mixers, the sight of pots and pans changing hands, and timers sounding off.(Choice C) whirring of mixers, clanging of pots and pans, and the beeping of timers. in choosing a career, your personal resources are defined as _____. Consider the problem: A set of books that are each 1.5 inches wide are being organized on a bookshelf that is 36 inches wide. How many books can fit on the shelf?a. Complete the multiplication equation and the division equation to represent the situation. Use a ? to represent the unknown in the equation. Write your answer as a decimal to the nearest tenth if necessary.multiplication equation: ? () = division equation: = ?b. How many books can fit on the shelf? Use a diagram, if needed. books The star betelgeuse appears red; the star rigel appears blue. What accounts for this difference? Consider two separate samples of sf6 (g) and n2 (g), both at 1. 00 atm and containing same number of moles. If the temperature of the sf6 (g) sample is 16. 0 oc, at what temperature (oc) will the n2 (g) sample have the same root mean square velocity as sf6 (g)? Avery is experimenting with a simple circuit. She measures the current in the circuit three different time Is chronic abdominal pain a diagnosis? play the role of a psychologist who utilizes cognitive-behavioral therapy (cbt). about which of the following remarks by your client are you least likely to ask for clarification? A scale drawing of a park can be seen below. If 1 inch is equal to 15 feet. What is the actual area of the park on sale, boxes of cereal cost $11 for 4 boxes, $24.75 for 9 boxes, and $33 for 12 boxes. Predict the cost of twelve boxes.