hope it helps
#carry on learning
follow me and mark me as brainlist plss
Answer:
starch
Explanation:
starch because plant uses sunlight and water in the presence of chlorophyll and carbondioxide to produce food in the form of starch
Can some1 fill in the blanks plss
Answer:
1. Mr. Weasley mm Mrs. Weasley mm
2. Their children's genotypes are mm
Explanation:
What is an Example of Structural Adaptation for Reproduction with Plants?
Flexible Stems
Spines Development
Deep Root Systems
Ballistic Seed-Dispersal
Answer:
An example of structural adaptation for reproduction with plants is c. Deep root systems.
Deep root systems are a structural adaptation that allows plants to access water and nutrients from deeper layers of soil, increasing their chances of survival in dry or nutrient-poor environments. These deep roots also allow the plant to establish itself firmly in the soil, increasing its chances of reproducing successfully.
Option a. Flexible stems, b. Spines development and d. Ballistic seed-dispersal are not structural adaptations related to reproduction, but other strategies that plants use to survive in different environments. Flexible stems allow plants to bend and sway in the wind without breaking, spines development protect plants from herbivores and Ballistic seed-dispersal is a way for plants to scatter their seeds away from the parent plant.
give me brainiest
what is the function of normal biota of the respiratory tract?
Answer:
Normal biota of the respiratory tract compete with pathogens for resources and space and microbial antagonism are correct.
Explanation:
Hope this helps!
The function of the normal biota of the respiratory tract maintains the health and balance of the respiratory system.
The population of bacteria that live in the nose, throat, and other parts of the respiratory system without producing disease under typical circumstances is referred to as the normal biota (also known as normal flora or microbiota) of the respiratory tract. Numerous kinds of bacteria, fungi, and even viruses are among these microorganisms. Their presence and functionality are crucial for preserving the respiratory system's harmony and overall health. The respiratory tract's typical microbiota serves the following purposes:
Pathogen defense: By occupying space and resources in the respiratory system, the normal biota works as a natural defense mechanism by making it difficult for hazardous bacteria to establish and thrive. They compete for nutrition and attachment sites with possible pathogens, assisting in the prevention of diseases.
The presence of the typical biota aids in the regulation and balancing of the immune response in the respiratory tract. It can boost the immune system to react to allergens or diseases in the right way while limiting overreactions or immunological reactions.
Production of antimicrobial chemicals: Some bacteria found in the normal biota produce antimicrobial compounds that can directly stop the growth of prospective infections, strengthening the protective effect.
Hence, the function of the normal biota of the respiratory tract maintains the health and balance of the respiratory system.
To learn more about Respiratory, here:
https://brainly.com/question/31875140
#SPJ4
our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a change to a g result in a change in gene expression?
No, a change to a G would not result in a change in gene expression as the underlined C is a non-coding nucleotide and does not have any effect on gene expression.
Non-coding DNA corresponds to the portion of an organism's genome that does not code for amino acids, the building blocks of proteins. Some noncoding DNA sequences are known to play functional roles such as regulation of gene expression, whereas other regions of noncoding DNA have no known function. Other regions of non-coding DNA are important for protein assembly. By altering one of these regions, a variant (also known as a mutation) in the noncoding DNA can turn on the gene, causing the protein to be produced in the wrong place or at the wrong time. There are two types of SNPs in the coding region.Synonymous and non-synonymous SNPs. Synonymous SNPs do not affect the protein sequence, whereas non-synonymous SNPs change the amino acid sequence of the protein.
To know more about Non-coding DNA visit:
https://brainly.com/question/28360970?referrer=searchResults
#SPJ4
What is the significance of understanding changes to the information stored in DNA?
Answer:
DNA is essentially a storage molecule. It contains all of the instructions a cell needs to sustain itself. These instructions are found within genes, which are sections of DNA made up of specific sequences of nucleotides. In order to be implemented, the instructions contained within genes must be expressed, or copied into a form that can be used by cells to produce the proteins needed to support life.
The instructions stored within DNA are read and processed by a cell in two steps: transcription and translation. Each of these steps is a separate biochemical process involving multiple molecules. During transcription, a portion of the cell's DNA serves as a template for creation of an RNA molecule. (RNA, or ribonucleic acid, is chemically similar to DNA, except for three main differences described later on in this concept page.) In some cases, the newly created RNA molecule is itself a finished product, and it serves an important function within the cell. In other cases, the RNA molecule carries messages from the DNA to other parts of the cell for processing. Most often, this information is used to manufacture proteins. The specific type of RNA that carries the information stored in DNA to other areas of the cell is called messenger RNA, or mRNA
Explanation:
Understanding the significance of DNA changes necessitates an understanding of gene function. If the gene function changes due to the base deletion or base mutation, then it affects the gene function in the cell.
What is a gene, and what is its role in the cell?A gene is present in the DNA that expresses the cell's character and regulates its function, so any change in this leads to a change in the cell's function. The DNA replicates and sends its copy to the offspring so that they get some of the genetic content from the parents.
The genes code for the cell receptors, for cell shape, etc., so understanding the gene is important. It provides an overview of various genetic disorders and can help with different types of drugs, such as antibiotics, etc., if the DNA is understood.
Hence, DNA should be understood because it has genes that regulate almost all functions of the cell.
Learn more about the gene here.
https://brainly.com/question/8832859
#SPJ2
In some animals, black fur (B) is dominant over white fur (b). What color fur
would an animal have if its genotype is Bb?
Please help!
What is the force of attraction objects have due to their mass
During mitosis the chromosomal number is...
Answer:
46
Explanation:
Easy...it's 46 chromosomes
what is the concept of dynamic equillubrium in the body
Answer:
A system in dynamic equilibrium will have small changes that sum together to produce no net change. Dynamic equilibrium is different from a static equilibrium, in which the parts do not move once they've reached equilibrium.
Explanation:
You are studying a population of prairie dogs who have a unique spotting pattern on their fur. You have determined the genotypes for spotted and nonspotted fur as follows: genotypes number observed bb 75 bb 210 bb 40 what are the expected numbers of each genotype (bb, bb, and bb) in the population?
The expected number of each genotype (bb, bb, and bb) in the population is 1.75, 1.75, and 1.75, respectively.
To calculate the expected number of each genotype (bb, bb, and bb) in the population, we need to use the formula for Hardy-Weinberg equilibrium:
\((p^2 + 2pq + q^2) / 6\) = sum of observed genotype frequencies
where p is the frequency of the dominant allele (spotted), q is the frequency of the recessive allele (nonspotted), and the sum of observed genotype frequencies is equal to 1.
Using the given information, we can calculate the frequencies of the alleles as follows:
p = 0.75 (75%)
q = 0.25 (25%)
Now, we can substitute these values into the formula:
\((0.75^2 + 2 * 0.75 * 0.25 + 0.25^2) / 6 = (0.75 + 0.25 + 0.25) / 6 = 0.75 + 0.25 + 0.25 = 1.75\)
Therefore, the expected number of each genotype (bb, bb, and bb) in the population is 1.75, 1.75, and 1.75, respectively.
Learn more about genotype
https://brainly.com/question/30784786
#SPJ4
What makes water molecules polar?
A.The atoms of a water molecule have linear bonds and equal electronegativities
B. The ability to covalently bond to other water molecules and distribute equal sharing of electrons
C. The hydrogen atoms are slightly positive, and the oxygen atoms are slightly negative
D. The hydrogen atom of a water molecule has high electronegativity
What does deep knee pit pain usually mean?
Deep knee pit pain may be a symptom of a few different conditions, such as a Baker's cyst, popliteus tendinitis, or a meniscus tear. A Baker's cyst is a swelling caused by a buildup of fluid at the back of the knee. This swelling can cause pain, especially when the knee is bent or straightened. Popliteus tendinitis is a condition where the popliteus tendon, which runs along the back of the knee, becomes inflamed or strained. This can cause pain in the back of the knee, especially when bending or turning the leg. A meniscus tear is a tear in one of the two pieces of cartilage that act as cushions between the thigh bone and the shinbone in the knee joint. This can cause pain, especially with movement of the knee.
Why does a plant have both a rigid cell wall and a cell membrane?.
Answer:
All cells undergo cellular respiration for the production of energy
Explanation:
The cell wall provides structure and support without it the cell would burst as the vacuole expands
________ is a change in allele frequencies in a population due to differential reproductive success, which is environmentally dependent
A change in allele frequencies in a population due to differential reproductive success, which is environmentally dependent, refers to natural selection.
Natural selection is a process in which certain heritable traits become more or less common in a population over generations due to differences in the reproductive success associated with those traits. It occurs when individuals with certain advantageous traits are more likely to survive and reproduce, passing on their beneficial traits to the next generation. This leads to a change in the frequencies of alleles (alternative forms of a gene) in a population.
The differential reproductive success is influenced by the environment. Environmental conditions can favor certain traits over others, creating selective pressures. Individuals possessing traits that are well-suited to the environment have a higher likelihood of surviving, finding mates, and producing offspring. As a result, the alleles associated with these advantageous traits become more prevalent in the population over time.
In contrast, individuals with less favorable traits may have reduced reproductive success, limiting their contribution to the next generation. This can lead to a decrease in the frequencies of alleles associated with those traits.
Overall, natural selection acts as a mechanism for adapting populations to their specific environments by favoring traits that enhance survival and reproductive success. The differential reproductive success, which is dependent on the environment, drives the change in allele frequencies in a population over time.
To know more about allele frequencies click here:
https://brainly.com/question/29563534
#SPJ11
what is the main function of the muscular diaphragm?
The main function of the muscular diaphragm is to separate the thoracic cavity, which contains the heart and lungs, from the abdominal cavity, which contains the digestive organs.
When the diaphragm contracts, it moves downward and creates negative pressure in the chest, which allows air to flow into the lungs and facilitates breathing. When the diaphragm relaxes, it moves back up to its resting position and helps to expel air from the lungs. Additionally, the diaphragm plays an important role in controlling intra-abdominal pressure during activities such as coughing, vomiting, and defecation. The diaphragm is a vital muscle for respiration and proper functioning of the body's organs.
To know more about diaphragm click here:
brainly.com/question/12920059
#SPJ4
How do both species benefit in this relationship? (Crocodile & Plover)
A. The Crocodile gets a home and the Plover gets protection
B. The Crocodile gets its teeth cleaned and the Plover gets food
C. The Crocodile gets protection and the Plover gets food
D. Crocodile gets food and the Plover gets cleaned
Answer:
B.
Explanation:
Egyptian plovers and crocodiles have a unique symbiotic relationship. Crocodiles can’t use dental floss, they get food stuck in their teeth. All that food rots their teeth and probably causes some pain. When a crocodile feels the need for a good tooth cleaning it will sit with its mouth wide open. The Egyptian plover bird sees the invitation, and if one is nearby it will fly into the mouth of the crocodile, eat the food stuck in its teeth, and fly away unharmed.
if you help me I'll give you a brain list.
Answer:
its B because veins bring the blood back to the heart for reoxidation
Answer:
For questions that were left blank:
1) Arteries carry blood away from the heart while veins carry blood into the heart.
Ans: a
2) The heart has 2 pumps. The pulmonary circuit pumps blood to the lungs and the systemic circuit pumps blood to the body.
Ans: b
Hormones are chemical signals that are released by cells in one part of the body that travel through the bloodstream to signal cells in another part of the body. Insulin is a hormone that is released by the pancreas that induces the uptake of glucose molecules from the bloodstream into cells. In this way, insulin lowers the overall blood glucose levels of the body. Osteoblasts and osteoclasts are two types of bone cells that play a role in regulating blood glucose levels (Figure 1).
Binding of insulin to the insulin receptor on osteoblasts activates a signaling pathway that results in osteoblasts
releasing a molecule, OPG, that binds to neighboring osteoclasts. In response, the osteoclasts release protons (H+) and create an area of lower pH outside the cell. This low pH activates osteocalcin, a protein secreted in an inactive form by osteoblasts.
The Esp gene encodes a protein that alters the structure of the insulin receptor on osteoblasts and interferes with the binding of insulin to the receptor. A researcher created a group of osteoblasts with an Esp mutation that prevented the production of a functional Esp product (mutant). The researcher then exposed the mutant strain and a normal strain that expresses Esp to glucose and compared the levels of insulin in the blood near the osteoblasts (Figure 2).
Based on the information provided, which of the following best justifies the claim that osteocalcin is a
hormone?
a.The activation of the osteocalcin by a bone cell is pH dependent.
b.The osteoblasts in the bone secrete osteocalcin, which causes cells in the pancreas to change their activity.
c.The phosphorylation of the insulin receptor causes a response in osteoblast bone cells.
d.The change in expression of Esp changes the insulin receptor activity of the osteoblast.
The best justification for osteocalcin being a hormone is option (b) - the osteoblasts secrete osteocalcin, causing cells in the pancreas to change their activity.
Osteocalcin is a hormone because it is activated by a signaling pathway that starts with insulin binding to the insulin receptor on osteoblasts. This binding activates a signaling pathway that results in osteoblasts releasing a molecule, OPG, that binds to neighboring osteoclasts. In response, the osteoclasts release protons (H+) and create an area of lower pH outside the cell. This low pH activates osteocalcin, a protein secreted in an inactive form by osteoblasts.
This means that osteocalcin is not directly activated by insulin, but rather by the downstream effects of insulin binding to its receptor on osteoblasts. The activation of osteocalcin by a signaling pathway that starts with insulin binding to the insulin receptor on osteoblasts makes osteocalcin a hormone. It is important to note that osteocalcin does not cause cells in the pancreas to change their activity, as suggested in answer choice b.
Learn more about osteocalcin here:
https://brainly.com/question/30888784
#SPJ11
a botanist hypothesizes that as flowers evolved tubular corollas, their nectar attracted a particular species of long-tongued fly that became their only insect pollinator. for this hypothesis to be reasonable, what issue should the botanist address?
One who researches 'botany' is called a 'botanist'. Botany is one of the world's oldest natural sciences. initially, Botany protected all plant-like organisms inclusive of algae, lichens, ferns, fungi, and mosses in conjunction with actual flowers.
Darwin understood the centrality of development in a deep and profoundly vital manner, both for animals and for flora. His notebooks document his cautious studying and interest in animal embryology and plant leaf and floral organ morphogenesis.
Butterfly-pollinated plants usually have pretty flashy flowers in hues like crimson and purple. these plants do not have the quantity of pollen that bee-attracting flowers do, however they've huge components of nectar to feed the butterflies.
Learn more about botanists here
https://brainly.com/question/19712716
#SPJ4
n Which of the following correctly describe ozone gas? Check all that are true. protects the Earth from UV radiation Filt a particulate pollutant in the atmosphere healthy to breathe a gas produced by chlorofluorocarbons - O a gas made of three oxygen molecules
Answer:
yes
Explanation:
that is true, but i do not understand the question?
Refer to Animation: Meiotic Cell Division. Prophase of meiosis I has some important differences from prophase of mitosis. These differences include: ___________ pair, and _________ occurs in meiosis.
Answer:
homologous pair and reductional division occur in meiosis
When during meiosis does crossing over and recombination occur?
Answer:
Crossing over occurs during prophase I of meiosis before tetrads are aligned along the equator in metaphase I. By meiosis II, only sister chromatids remain and homologous chromosomes have been moved to separate cells. Recall that the point of crossing over is to increase genetic diversity.
help asap i need to submit
Answer:
I think it's 1 boy sure tho
The portion of the nervous system that is responsible for delivering motor impulses to skeletal muscle is the
The portion of the nervous system that is responsible for delivering motor impulses to skeletal muscle is the somatic nervous system.
This system is made up of nerves that originate in the spinal cord and travel to skeletal muscles, allowing for voluntary movement and control of the body's skeletal muscles. The somatic nervous system is also responsible for sensory input, allowing us to perceive and respond to the environment around us. It works in tandem with the autonomic nervous system, which controls involuntary functions such as breathing, digestion, and heart rate.
To learn more about nervous system visit;
https://brainly.com/question/29355295
#SPJ11
In your own words, explain what an ecological relationship is
What percentage of offspring will have pink flowers
Answer:
50%
Explanation:
The pink flower donates the r allele and produces pink flowers in 50% of the offspring.
we need a box image to predict how many offspring of pink flowers there will be :/
unlike plants, animals cannot make there own food so they must find and consume other organisms to survive how do animals use the food they obtain chose he three that apply:A,energy for body warmth,B, growth and body repair,C, ability to adapt ,D,develop instincts,E,energy for motion.
Plants provide sustenance for animals, either directly through consumption of plants or indirectly through consumption of animals that consume plants. Thus option A, B, C, E is correct.
What is the use of food in animals?Similar to people, livestock animals require a balanced diet that includes all the vitamins, minerals, fluids, and nutrients they require.
Some creatures devour both vegetation and other creatures. Animal nutrition covers nutrient needs, food intake methods, and how food is used by the body.
Therefore, animals use the food they obtain from another animals.
Learn more about animals here:
https://brainly.com/question/18432429
#SPJ1
How would you expect the number of births to compare to the number of deaths in a population that was stable?
Answer:
in a stable population,the birth and death rates depend directly on the variance of age at death
hemophilia is caused by several genetic factors; one, a sex-linked recessive gene, is the subject of this problem. assume that a man with hemophilia marries a normal woman whose father had hemophilia. what is the probability that they will have a daughter with hemophilia?
Answer:
it's 1/3
Explanation:
because of mother's father
15
Approximately how many degrees does Earth rotate on its axis over this five-hour period?
15°
45
75"
90°
A
Eliminator
8
Line Reader
Reference
CA
Period
Over a five-hour period, Earth rotates approximately 75 degrees on its axis. This calculation is based on the proportion that relates the time taken for Earth's complete rotation (24 hours) to the corresponding degrees of rotation (360 degrees).
The rotation of the Earth on its axis takes approximately 24 hours to complete one full rotation, which equals 360 degrees. To calculate how many degrees Earth rotates over a specific time period, we can use a simple proportion.
In this case, we have a time period of 5 hours. We can set up the proportion:
5 hours is to x degrees as 24 hours is to 360 degrees.
Using cross-multiplication, we can solve for x:
5 hours * 360 degrees = 24 hours * x degrees
1800 degrees = 24x
Dividing both sides by 24:
1800 degrees / 24 = x degrees
75 degrees = x
For more such information on: rotation
https://brainly.com/question/11691986
#SPJ8