The best topsoil will be found in the tropical region.
What are tropical regions?They are regions of the world located within the two tropics - tropic of Capricorn and tropic of Cancer.
The region is characterized by adequate precipitation and relatively warm annual temperature. Thus, there is a high diversity of plants and animal species.
Tropical forests are known as the biodiversity hotspots of the world. This means that the soil is rich enough to support a diverse species of plants as compared to other regions of the world.
More on tropical regions can be found here: https://brainly.com/question/14119275
#SPJ1
You would find the BEST topsoil in the Temperate region
C-TemperateHow is the soil in the temperate region?The soil of these forests is very rich in nutrients, mainly due to the natural process of leaf decomposition, which enriches the soil with nutrients. The accumulation of organic matter occurs mainly in the first horizons of the soil, which therefore have a darker color.
With this information, we can conclude that The soil of temperate region It is very rich in nutrients, mainly due to the natural process of decomposition of the leaves.
Learn more about temperate region in brainly.com/question/9506777
#SPJ1
Plant stems contain cells with specific types of compounds, such as lignin, that provide strength to the stem. Which of the following does a role of plants stems in a process that occurs in plants?
The xylem and phloem does the role of plant stems in a process that occurs in plants.
What are the roles of xylem and phloem in plants?Plant stems play a crucial role in the transport of water, nutrients, and sugars throughout the plant and this transport occurs through two specialized tissue types found in the stem: xylem and phloem.
Xylem is responsible for the upward movement of water and dissolved minerals from the roots to the rest of the plant. It consists of specialized cells called tracheids and vessel elements that are interconnected, forming tubes or vessels.
Phloem facilitates the downward movement of sugars and other organic compounds, such as hormones, from the leaves to other parts of the plant. It consists of sieve tube elements and companion cells.
Learn more about xylem and phloem at: https://brainly.com/question/1412188
#SPJ1
Complete question:
Plant stems contain cells with specific types of compounds, such as lignin, that provide strength to the stem. Which of the following does the role of plant stems in a process that occurs in plants?
Lignin
Cellulose
Xylem
Phloem
What are the steps involved in removal of the sand?
Answer: Place a pattern in sand to create a mold.
Incorporate the pattern and sand in a gating system.
Remove the pattern.
Fill the mold cavity with molten metal.
Allow the metal to cool.
Break away the sand mold and remove the casting.
Explanation:
Answer:
Use tweezers
Explanation:
IF Avery, Macleod, and McCarty had found that samples of heat-killed bacteria treated with RNase and DNase transformed bacteria, but samples treated with protease did not, what conclusion would they have made
Answer:
See the answer below
Explanation:
The conclusion that Avery, Macleod, and McCarty would have made assuming that samples of heat-killed bacteria treated with RNase and DNase transformed bacteria, but samples treated with protease did not would be that protein is responsible for the transformation of the non-virulent bacterium strain to a virulent one.
According to the findings of the 3 researchers, heat-killed virulent strain of Streptococcus pneumoniae transformed non-virulent strain of the same species into being virulent. They were able to discover that the molecule responsible for this transformation was DNA.
If the heat-killed virulent strain had been treated with RNase and DNase, this would have degraded RNA and DNA in the heat-killed cells respectively, leaving only protein as the carrier of the virulence factor. Confirmation of the transforming attribute of the protein can be further be confirmed by treating the heat-killed mixture with protease, a protein degrading enzyme.
how do water and land interact?
Answer:
water flows through the landscape. the condition of the land surface affects the flow and quality of water .
When this cell divides to form two cells, which diagram shows the most likely
result?
I am 90% sure it is a
Summarize the changes that might occur in a population of squirrels if acorn shells became harder
underwater mountain range
Answer:
What is a mountain range
Te enzyme trypsin aids in protein digestion in the small intestine. Te relative
activity of trypsin at diferent pH values is shown in Figure 1.
Which of the following statements best explains the activity levels of trypsin shown
in Figure 1?
(A) The small intestine releases inhibitor molecules that block the activity of
trypsin unless it is at its optimum pH.
(B) The number of efective collisions between trypsin and its substrate increase
at higher pH values.
(C) As pH values increase, the substrate concentration decreases, leading to an
eventual decline in the rate of the trypsin-catalyzed reaction.
(D) At extremely low pH values, trypsin is denatured and cannot function
efciently
The statement that best explains the activity levels of trypsin in Figure 1 is (D) At extremely low pH values, trypsin is denatured and cannot function
efficiently.
Figure 1 shows the activity levels of trypsin, a protease enzyme of small intestine, as a function of pH.
The data indicates that trypsin is most active in moderate pH ranges, between 6 and 8, where it exhibits its highest activity levels. However, as the pH values become more acidic or basic, the activity of trypsin decreases significantly.
At extremely low pH values, trypsin is denatured and cannot function efficiently. This is evidenced by the sharp drop in activity at pH levels below 4.
Therefore, the statement that best explains the activity levels of trypsin in Figure 1 is (D).
To learn more about trypsin, click here:
https://brainly.com/question/1835238
#SPJ4
A box at the intersection between a row and a column on a spreadsheet is a
The point where a column and a row intersection is known as a cell.
What is intersection?When two streets or lines cross, it is known as an intersection. The two places where crossings are most likely to occur are in math class as well as in traffic. An intersection in mathematics is the place where two lines converge. This is the common theme among the lines. There is an intersection in the middle of the letter X. The same holds true for a street's intersection; in this case, Huron and Clark's. You can take either street away from the intersection. Knowing the main intersections is useful while trying to go somewhere.
To learn more about intersection
https://brainly.com/question/30088237
#SPJ1
a. What happened to ecological resources in national parks across the United States when this act
became law in 1916.
Answer:
Explanation:
recover it self
Where are the A, B and RH antigens located
Answer: The A, B, and Rh antigens are located on the surface of red blood cells.
Explanation:
Natural proteins most commonly contain linear polypeptides between 100 and 1000 residues in length. One of the reasons polypeptides outside this range may be disfavored is that
B) smaller polypeptides do not form stable folded structures.
Plants can reproduce both sexually and asexually. What are some examples of sexual reproduction in plants? Select ALL that apply. Responses
Sexual reproduction in plants involves the fusion of male and female gametes to produce offspring with genetic diversity.
Mechanisms that facilitate sexual reproduction in plants are examples:
1)Pollination and Fertilization: Many plants rely on pollinators, such as bees, butterflies, or birds, to transfer pollen from the male reproductive structures (anthers) to the female reproductive structures (stigma) of flowers.
This process enables the fusion of sperm cells within the pollen with egg cells in the ovules, leading to fertilization.
Examples include flowering plants like roses, sunflowers, and apple trees.
2)Seed Production: After fertilization, the ovule develops into a seed. Seeds contain an embryo, formed by the fertilized egg, enclosed within a protective seed coat.
The mature seeds can disperse and germinate to give rise to new plants.
Various plant groups, including angiosperms (flowering plants) and gymnosperms (conifers and cycads), reproduce sexually through seed production.
3)Alternation of Generations: In plants with a complex life cycle, such as ferns, mosses, and liverworts, sexual reproduction involves an alternation between two distinct generations: the gametophyte and the sporophyte.
The gametophyte generation produces gametes (sperm and eggs) through specialized structures, while the fusion of gametes gives rise to the sporophyte generation, which produces spores.
4)Self-fertilization: Some plants have the ability to self-fertilize, where the pollen from the anther of a flower is transferred to the stigma of the same flower or another flower on the same plant.
This allows for sexual reproduction without the need for external pollinators. Self-fertilization can be seen in plants like tomatoes, peas, and certain grass species.
For more questions on reproduction in plants
https://brainly.com/question/20305414
#SPJ8
Which micropipette would you use to transfer 9uL?
A. Range 1.0-10uL
B. Range 2uL-20uL
C. Range 100uL - 1000UL
D. Range 10uL-200UL
A pipette of range 1.0-10uL is the most appropriate for taking a volume of 9 uL. So the correct option is A
What are micropipettes?
In the lab, micropipettes are used to transfer tiny amounts of liquid, typically less than 0.1 uL. In addition to other labs, they are most frequently employed in chemistry, biology, forensics, pharmaceutical, and drug development. There are various sizes of micropipettes commonly used in the laboratory.
Micropipettes vary in size and volume dispensed, and based on those two factors, they also need various pipette tips. Micropipettes aspirate liquid using a disposable pipette tip; take note that only the tip of the pipette comes into touch with the solution. For each sample, a fresh tip is used to avoid cross-contamination.
The quality of a pipette tip is the most important factor to consider. Whether one is searching for a filter, low retention, or gel loading tip, it should be made sure that the pipette tip will function as accurately and precisely as the micropipette. The purity of your pipette tips should be checked.
Therefore the correct option is A.
Read more about micropipettes, here
https://brainly.com/question/23793716
#SPJ6
A student makes a model of a cell. He uses a plastic bag to represent the cell membrane. He fills it with a clear gel to represent the cytoplasm. He puts in other materials to represent parts of the cell within the cell membrane. His teacher tells him that the plastic bag is not a good representation of the cell membrane. She suggests that the student find a material that better shows how a cell membrane works. The student makes another model using a woven cloth bag to represent the cell membrane. The teacher tells him that he made a good choice.
Why is the woven cloth a good choice for improving the student’s cell model?
Answer: because the function of the cell membrane is to provide protection of the cell
Explanation: hope this helped
(part 2)PLEASE HELP! IN A HURRY! WILL GIVE BRAINLIEST!
Answer:
i say 'a' lower cased
Explanation:
brainlest?
diegetic sound in the film monkeys paw 2011
the amount of light in the Epipelagic zone
Answer:
850 meters
Explanation:
From the base of the epipelagic zone to a depth of about 850 meters, there is still enough light for a human to see. The second zone between 200 meters and 1,000 meters is known as the "twilight zone". Some light penetrates as far as 1000 meters down into the ocean.
Which statement best describes a reliable source of information?
A source that follows the scientific method.
A source that includes the evidence to persuade a side.
A source that includes opinions to support a claim.
A source that uses pseudoscience to gather evidence.
The statement best describing a reliable source of information is:A source that follows the scientific method.
A reliable source of information is one that follows the scientific method. The scientific method is a systematic approach to investigating phenomena, which involves formulating a hypothesis, conducting experiments or observations, collecting data, and drawing conclusions based on evidence. By adhering to the scientific method, a source ensures that its information is based on rigorous and objective analysis.
A reliable source of information focuses on providing evidence to support its claims rather than relying on opinions. It presents data, facts, and research findings obtained through scientific studies or credible sources. This evidence-based approach adds credibility to the information presented and allows readers to evaluate the validity of the claims.
On the other hand, a source that includes opinions to support a claim may lack objectivity and can introduce bias into the information. Opinions alone do not necessarily provide a reliable basis for making informed judgments or decisions.
A reliable source also avoids the use of pseudoscience to gather evidence. Pseudoscience refers to claims or practices that are presented as scientific but lack the rigorous scientific methods and evidence required for validation. Such sources often promote ideas that are not supported by credible scientific research and can mislead readers.
In summary, a reliable source of information is one that follows the scientific method, presents evidence to support claims, avoids relying solely on opinions, and does not use pseudoscience to gather evidence. By adhering to these principles, a source can provide trustworthy and accurate information to its audience.
For more such information on: scientific method.
https://brainly.com/question/17216882
#SPJ8
When the carbohydrate cellobiose is digested into two glucose monosaccharide sugars (by cellulase in certain fungal species), the resulting glucose monomers are properly defined as: A. the catalysts
B. the substrates
C. the enzymes
D. the reactants
E. the products
When the carbohydrate cellobiose is digested into two glucose monosaccharide sugars (by cellulase in certain fungal species), the resulting glucose monomers are properly defined as the products
The correct answer is option E.
When the carbohydrate cellobiose is digested into two glucose monosaccharide sugars by cellulase in certain fungal species, the resulting glucose monomers are properly defined as the products.
In a chemical reaction, reactants are the starting materials or substances that undergo a change, while products are the resulting substances formed after the reaction. In this case, cellobiose is the substrate, which is the molecule that undergoes the enzymatic reaction. Cellulase is the enzyme responsible for catalyzing the digestion of cellobiose into glucose monomers.
The enzyme cellulase acts as a catalyst in the reaction, facilitating the breakdown of cellobiose into glucose. Catalysts are substances that increase the rate of a chemical reaction without being consumed or permanently changed themselves. However, in the context of the given question, the glucose monomers produced are the final result or product of the enzymatic digestion process.
Therefore, in the digestion of cellobiose, the resulting glucose monomers are correctly identified as the products (option E).
For more such information on: carbohydrate
https://brainly.com/question/336775
#SPJ8
Write me a 10 minute speech about varicella zoster
Need it asap
Varicella Zoster is an infectious viral disease causing chickenpox in children and shingles in grown-ups. Inoculation plays a crucial part in avoidance and lessening complications.
Aspeech on Varicella-ZosterWomen and noblemen,
Nowadays, I would like to examine a vital and predominant viral disease known as Varicella Zoster. Varicella Zoster, commonly alluded to as chickenpox, is caused by a varicella-zoster infection. It fundamentally influences children, but can too affect grown-ups who have not been already contaminated.
Varicella Zoster presents as a profoundly infectious sickness characterized by a particular hasty, fever, and common disquietude. The infection spreads through coordinated contact or respiratory beads, making it effortlessly transmissible inside families and communities.
Whereas chickenpox is for the most part a gentle ailment in children, it can lead to more serious complications in grown-ups, pregnant ladies, and people with debilitated resistant frameworks. These complications incorporate pneumonia, bacterial contaminations, and in uncommon cases, neurological complications such as encephalitis.
Luckily, the improvement of a profoundly successful antibody has essentially diminished the frequency of Varicella Zoster around the world. Immunization not as it were secures people from the distress and potential complications of chickenpox, but too makes a difference anticipate the infection from spreading inside the community.
In any case, Varicella Zoster doesn't halt at chickenpox. Once the introductory contamination settles, the infection remains torpid inside the body and can reactivate a long time afterward, causing a condition known as herpes zoster, or more commonly, shingles.
Shingles are characterized by a difficult hasty that ordinarily happens in a single dermatome, regularly along the middle or confront. The reactivated infection can cause critical pain and inconvenience, enduring for weeks or indeed months. Moreover, complications such as postherpetic neuralgia, a persistent torment disorder, can happen, especially in more seasoned people.
To combat the chance of shingles, an isolated antibody called the shingles antibody or herpes zoster immunization has been created. This antibody not as it were makes a difference anticipate shingles but moreover diminishes the chance of postherpetic neuralgia.
In conclusion, Varicella Zoster, enveloping both chickenpox and shingles, could be a viral contamination that has critical suggestions for open well-being. We have made significant progress in reducing the burden of this disease through extensive vaccination efforts.
In any case, ongoing efforts to prevent Varicella zoster from returning to our communities and to protect powerless populations require prompt attention and vaccination.
Much obliged to you for your thought. Let's collaborate to ensure a better future for everyone.
Learn more about chicken pox here:
https://brainly.com/question/4024185
#SPJ2
Based on the relationship between body size and mass-specific metabolic rates of mammals, predict what would happen to the body temperatures of mice and elephants if their mass- specific metabolic rates were swapped. The mouse's body temperature would rise because it would be eating more, while the elephant's body temperature would drop because it would be eating less. The body temperatures of the mouse and elephant would remain about the same. The higher mass-specific metabolic rate of the elephant put in the mouse would result in higher temperature, but it would be dissipated more quickly because the mouse has a larger surface area to dissipate the heat. The mouse's body temperature would drop because it would lose heat rapidly across its high surface area. The elephant's body temperature would rise because it cannot lose heat fast enough across its small surface area. The body temperatures of the mouse and elephant would remain about the same because their mass-specific metabolic rates are about the same before and after the swap.
Based on the link between body size and mammalian mass-specific metabolic rates, it is projected that if the mass-specific metabolic rates of mice and elephants were switched,
the mouse's body temperature would fall while the elephant's would increase. This is because the mouse's greater mass-specific metabolic rate would result in a higher temperature, but it would be dissipated faster since the mouse has a bigger surface area to dissipate the heat. The mouse, on the other hand, would have a lower body temperature because it would lose heat quickly over its large surface area. Since it cannot dissipate heat quickly enough over its small surface area, the elephant's body temperature would increase. If, on the other hand,
learn more about temperature here:
https://brainly.com/question/11464844
#SPJ4
Please help !!!!!!!!!!!
Answer:
1) Weathering, Erosion, Disposition
2) Physical weathering is the breakdown of large rocks into fragments by physical forces; the chemical composition of the rock is not changed. Chemical weathering is the breakdown of rock by chemical reactions; the chemical composition is changed.
3) The four forces of erosion are water, wind, gravity, and glaciers.
4) Because the velocity of the river slows down a great deal when it reaches the large body of water, the sediment that the river was carrying is deposited along the mouth of the large body of water.
--------------------------------------------------------------------------------------------------------
Abrasion: Abrasion is the breaking down and wearing away of rock material by the mechanical action of another rock. Three agents of physical weathering that cause abrasion are moving water, wind, and gravity. Also, rocks suspended in thence of a glacier can cause abrasion of other rocks on Earth's surface. This would be a prime example of physical weathering, or mechanical weathering.
----------------------------------------------------------------------------------------------------------
Acid Precipitation: Acid rain causes less erosion than normal rainwater does. Rainwater can break down rocks by dissolving minerals in the rocks. Acid rain is rainwater that is more acidic than normal rainwater. Acid rain can also dissolve the minerals in rocks faster than normal rainwater can. This is chemical weathering.
--------------------------------------------------------------------------------------------------------
Animal actions: Animal and plant mobility is a factor in biological weathering. For instance, a plant may grow in a gap in a rock and, as its roots spread, cause the fracture to expand. A rabbit may also burrow into a crack in a rock, making it wider and eventually separating the rock. This is an example of physical weathering.
---------------------------------------------------------------------------------------------------------
Ice wedging: Ice wedging ,sometimes known as frost wedging ,can also cause rocks to break apart. Ice wedging causes cracks in rocks to expand as water seeps in and the water freezes and expands opening the crack further. Rocks formed under pressure deep within earth can become exposed at the surface. This is physical weathering
----------------------------------------------------------------------------------------------------------
Oxidation: Oxidation is another kind of chemical weathering. It occurs when oxygen from air dissolves in water and combines with chemicals in the rocks to form oxides. if the rock contains a lot of iron, then oxidation produces a brown material called iron oxide. This looks like rust on the rock.
What is the difference between weathering erosion and deposition?Weathering is the chemical and mechanical breakdown of exposed rock. The chemical changes alter the minerals and make them softer, and mechanical weathering physically breaks rock into smaller and smaller pieces.
Erosion is the REMOVAL of those chemically and mechanically softer and broken pieces of rock from their original locations, by gravity, water, ice or wind. Erosion is transport (and as a result, fresh unaltered rock is exposed to wind, water and weather, and THAT becomes weathered in turn). The material being transported is ‘sediment’: sand, silt, mud and gravel.
Deposition is when the weathered and eroded (transported) material is dropped and settles down elsewhere, forming a ‘deposit’ of transported rock material.
If this deposit remains undisturbed long enough, and is buried by enough arriving material, it will eventually go through compaction and chemical reactions forming cement between the grains - thus resulting in a brand new, sedimentary rock.
Weathering, erosion, transport, deposition, compaction and cementation are part of the ‘rock cycle’.
How can the complete rock cycle be described?Let’s start with basalt that form at mid ocean spreading centers. At mid ocean spreading centers rock material from the earth’s mantle continuously melts due to continuous decreasing in pressure from the oceanic crust spreading at this point. The molten rock quickly cools at the earth’s surface and forms rock known as basalt that makes up the oceanic crust all over the world. The newly produced oceanic crust rock slowly moves towards a boundary with a continental crust where the oceanic crust subducts beneath the continental crust due to the oceanic crust having a higher density than the continental crust. This is where things get a bit more interesting.
#SPJ1
Find all cells that are haploid. Those letters in alphabetical order, are the first part of your password. Find all cells that are diploid. Those letters, also in alphabetical order are the end of your password.
All the cells that are of the haploid nature are specially the meiocytes that are sperm and eggs. Somatic cells are the cells which are diploid in nature.
What is haploid nature and what is the diploid one ?Haploids are the cells which are having a single set of chromosomes and the diploid are the one which are having a double set of chromosomes.
Somatic cells are the cells which are diploid in nature which do undergo the property of differentiation and their chromosomes number is diploid in nature that means they are having a double set of chromosomes.
Meiocytes are the cells which are having a single set of chromosomes. They have to mate with the other partner with the same number of chromosomes. The password is MS.
Learn more about haploid and diploid at :
https://brainly.com/question/28342844
#SPJ1
Humans have selectively bred animals for many years. Selective breeding helps to
produce favored traits in the animals. One example of animals that are selectively bred is
hens. Which of the following traits is most likely achieved in hens through selective
breeding?
Answer:
Productions of larger eggs
Explanation:
Production of larger eggs trait is most likely achieved in hens through selective breeding. So, the correct option is A.
What is Selective breeding?Selective breeding is defined as the process by which humans use animal breeding and plant breeding to selectively develop particular phenotypic traits, which would typically result from animal or plant male and female sexual reproduction, which will together produce children.
This method involves selecting parents with particular characteristics to breed together and produce offspring with more desirable characteristics, where humans have been selectively breeding plants and animals for thousands of years which includes crop plants with better yields.
Thus, production of larger eggs trait is most likely achieved in hens through selective breeding. So, the correct option is A.
Learn more about Selective breeding, here:
https://brainly.com/question/16436300
#SPJ6
Which of the following statements is true?
A. The karyotypes for a male human and a female human will look exactly the same.
B. The number of chromosomes in all organisms is the same.
C. Sometimes, a single gene can influence many traits.
D. There are more chromosomes in a cell than there are genes.
Answer:
the answer is C
Explanation:
Sometimes, a single gene can influence many traits in an organism. This is possible due to gene interactions. Thus, the correct option is C.
What is Gene interaction?Genetic interaction is the set of functional association between different genes in an organism. Genetic interactions are the relationship is called as epistasis. Epistasis is the interaction of non-allelic genes where the effect of one gene in an organism is masked by another gene to result either in the suppression of the effect of that gene or they both combine to produce a new trait or character.
In epistasis, the gene which masks another gene is called as epistatic gene, and the gene whose expression is being masked is termed as hypostatic gene. Epistasis is also referred to as the inter-genic or inter-allelic gene interaction.
Therefore, the correct option is C.
Learn more about Gene interaction here:
https://brainly.com/question/30006585
#SPJ6
What reacts with water in the atmosphere to form carbonic acid to make regular rainfall slightly acidic?
A: Carbon Dioxide
B: Lead
C: Helium
D: Argon
the answer is caebin diaxode
Answer:
A. carbon dioxide
Explanation:
In Activity 2, which of the respirometers serves as a control? Explain your answer! Why was it the control? You should write at least 3 sentences to explain this. Respirometer A contains germinated beans. respirometer B contains dormant beans and plastic beads respirometer C contains plastic beads.
In Activity 2, the respirometer C serves as the control. A control is an essential part of any scientific experiment as it provides a baseline against which the experimental results can be compared.
Respirometer C containing only plastic beads does not contain any living organisms and therefore does not undergo cellular respiration. By comparing the results of respirometers A and B with the control (respirometer C), any changes in oxygen consumption and carbon dioxide production can be attributed to the metabolic activity of the germinated beans in respirometer A and the dormant beans in respirometer B.
This allows researchers to determine the specific effects of germination on cellular respiration by isolating the variables and eliminating any external factors that could influence the results.
For more such questions on respirometer
https://brainly.com/question/19261305
#SPJ8
Which phrase indicates a limit to the scientific accuracy of the experiment?
Answer:Scientific research is the investigation or examination performed by applying systematic scientific methods to obtain, analyze, and interpret the data. The sample size of the population plays a crucial role in research. The phrase that limits the accuracy of the research is:Option A: A sample size of 300 peopleScientific studies are advantageous when:It is conducted on large population size. The number of individual users in the research is used to calculate the set of statistics.The large sample size allows the scientist to better understand and average the values of data. The large population size also helps in neglecting the errors, which can be frequent on the small population size. The maximum size of the population is usually 10percent of the total population. It can be calculated as the total population of 200,000, the 10% will be 20,000. Thus, for the scientific study conducted by Marcus, the sample size of 300 people will limit the accuracy of the experiment.
Explanation:
Answer: a sample size of 300 people
Scientific research is the investigation or examination performed by applying systematic scientific methods to obtain, analyze, and interpret the data. The sample size of the population plays a crucial role in research.
The phrase that limits the accuracy of the research is:
Option A: A sample size of 300 people
Scientific studies are advantageous when:
It is conducted on large population size.
The number of individual users in the research is used to calculate the set of statistics.
The large sample size allows the scientist to better understand and average the values of data.
The large population size also helps in neglecting the errors, which can be frequent on the small population size.
The maximum size of the population is usually 10percent of the total population. It can be calculated as the total population of 200,000, the 10% will be 20,000.
Thus, for the scientific study conducted by Marcus, the sample size of 300 people will limit the accuracy of the experiment.
1. The following gene sequence appears on one strand of a segment of DNA that is about to go
through DNA Replication. What code will DNA Polymerase build to make the complementary
strand?
TACGGCATATGCAAATGGCGAGCCTATATT
The DNA polymerase will build the complementary strand with the code: ATGCCGTATACGTTTACCGCTCGGATATA.
What is DNA replication?DNA replication is a process by which a DNA molecule makes a copy of itself. During DNA replication, an enzyme called DNA polymerase reads the existing DNA strand and builds a new complementary strand by matching up the appropriate nucleotides.
To build the complementary strand of DNA, we need to use the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).
So, for each base in the original sequence, we will pair it with its complement:
Original strand: TACGGCATATGCAAATGGCGAGCCTATATTComplementary strand: ATGCCGTATACGTTTACCGCTCGGATATALearn more about DNA Replication here: https://brainly.com/question/21265857
#SPJ1
The complementary strand to the given sequence would be:
ATGCCGTATACGTTTACCGCTCGGATATAA
What is gene sequence?A gene sequence is a specific sequence of nucleotides in DNA (or RNA) that encodes the genetic information for a particular trait, function or protein. Genes are the basic unit of heredity and are responsible for passing on traits from one generation to the next.
The complementary strand of DNA will have a sequence that pairs each nucleotide with its complementary base: adenine (A) with thymine (T), and cytosine (C) with guanine (G). Therefore, the complementary strand to the given sequence would be:
ATGCCGTATACGTTTACCGCTCGGATATAA
During DNA replication, DNA polymerase reads the existing strand from 3' to 5' and builds the complementary strand in the 5' to 3' direction. Therefore, the new strand would be synthesized by adding nucleotides in the following order:
ATA...CGT...TAA...CGC...TGG...ATA
Learn about complementary strand here https://brainly.com/question/1534778
#SPJ1