In which phase of mitosis does the chromatin become condensed into short threadlike structures that can be seen under a microscope?.

Answer:

Energy

Explanation:

For example light is a wave

Answer: Energy

Explanation: Good luck! :D

Answer: Population

Explanation: A population is a group of organisms of the same species that live in the same area at the same time. Population ecologists study the size, density, and structure of populations and how they change over time.

The biggest contributor to increasing antibiotic resistance in bacteria is their overuse.

What are antibiotics?

Antibiotics are medicines that fight, as their name indicates, infections caused by living beings, especially bacteria. What it does is kill bacteria or make it more difficult for them to grow. Antibiotics should not be taken improperly as this contributes to resistance when using them. This occurs when the bacteria adapt to this antibiotic and can resist its action, slowly increasing the resistance to that antibiotic by the bacteria from one generation to the next.

Therefore, we can confirm that the biggest contributor to increasing antibiotic resistance in bacteria is their overuse which promotes the evolution of bacteria into more resistant strains.

To learn more about antibiotics visit: https://brainly.com/question/10868637

#SPJ1

Answer:

warm temperature

Explanation:

it helps fossilzation

Answer: C

Explanation: All of them could be correct, but I think this is the correct answer. I’m only in middle school, so if your not rushing you may as well wait for someone else.

Answer:

La respuesta es

C. Podría ser una situación de codominancia produciendo las plumas grises a partir de alelos blancos y negros.

Explicación:

Ya que normalmente se expresará el alelo dominante, mientras que el efecto del otro alelo, llamado recesivo, queda enmascarado. Pero cuando hay codominancia, entonces ningún alelo es recesivo y el fenotipo de ambos alelos es expresado.

Answer:

Natural selection

Explanation:

Natural selection is a process that causes heritable/favorable traits that are helpful for survival and reproduction to become more common as time goes on, and it gets passed from generation to generation.

Answer:

D. Pathogen

Explanation:

Answer:

The electron transport chain or ETC for short has 34 ATP (Adenosine Triphosphate or the energy carrying molecule) Which has the molecular formula C10H12N5O13P3. So I would go with D because this is closest.

This is because one molecule of glucose in a Eukaryotic cell generates around 30 to 32 ATP.

Explanation:

The 34 ATP produced by ETC(Electron transport chain) or the electron transport stage produces the most ATP(energy carrying molecule) out of any stage in aerobic respiration/ cellular respiration cycle. While the krebs cycle, and Glycolysis produce 2 ATP each. Making the rest of the stages 30 ATP total.

Answer:

it is a food chain.

I can't write more it's not allowed

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Answer:

C. Bases

Explanation:

Deoxyribonucleic acid, commonly known as DNA, is the a type of nucleic acid that serves as the genetic material in living organisms. DNA holds information or instructions needed for the synthesis of useful products like proteins that is responsible for growth, reproduction, and general survival of organisms. Hence, it is referred to as the "BLUEPRINT OF LIFE".

However, in the structure the of the DNA molecule, it contains certain monomeric building blocks called NUCLEOTIDES. These nucleotide bases are of four types namely: Adenine, Thymine, Guanine and Cytosine. It is upon these order of nucleotide bases that instructions, or 'code', in our DNA is dependent upon.

The transport proteins are hemoglobin, myoglobin, and albumin. Specialized proteins called "transport proteins" are in charge of carrying chemicals across cell membranes.

Because they allow important substances such as nutrients, ions, and hormones to move in and out of the cell, these proteins are important for maintaining proper cell function. Channels and carriers are two basic divisions of transport proteins. Some chemicals can pass through the membrane because channel proteins form a pore or channel there.

Therefore, the correct options are A, D and F.

Learn more about Transport proteins, here:

https://brainly.com/question/28765099

#SPJ1

Answer:

Biodiversity or biological diversity refers to the wide variety of living beings existing on the planet, it is also a dynamic system that is in constant evolution.

Explanation:

Biodiversity is the plurality of species of living beings that inhabit an environment. In its broadest sense, the concept refers to the variety of species existing on planet Earth. The distribution of biodiversity comes as a consequence of evolutionary factors in the biological, geographical and ecological area, therefore each species has an environment suitable to its needs where each of these can be related in a harmonious way with the environment that surrounds it.

Environmental health hazards refer to the negative impacts of environmental factors on human health and the ecology. Examples of environmental health hazards include poor air and water quality, exposure to toxic substances, climate change, land use, and environmental degradation.

Reducing environmental health hazards is crucial in ensuring that communities live in a healthy and safe environment. This can be achieved through various steps, including: providing access to clean water sources, improving sanitation, promoting proper waste disposal, and reducing exposure to toxic chemicals and pollutants.

Here is how these steps can be matched with their corresponding examples:

DIGGING WELLS: Digging wells is an effective way of reducing environmental health hazards. By digging wells, communities can have access to clean water sources that are free from pollutants. This can help prevent waterborne diseases, which are a significant health risk in many parts of the world. For instance, in areas where there is no access to clean water sources, people are forced to drink from polluted streams and rivers, exposing themselves to various diseases such as cholera and typhoid fever. Thus, digging wells is an essential step in reducing environmental health hazards.

FILTERING SURFACE WATER: Surface water can be a significant source of environmental health hazards. Surface water can contain harmful bacteria, viruses, and chemicals that can pose a health risk to humans and animals. Filtering surface water is, therefore, an effective way of reducing environmental health hazards. By filtering surface water, contaminants are removed, making the water safe for consumption. For example, in areas where there is no access to clean water sources, people can use filters to purify surface water.

PROVIDING FINANCIAL ASSISTANCE: Providing financial assistance is also a crucial step in reducing environmental health hazards. Many environmental health hazards are a result of poverty and lack of resources. For instance, people living in poverty may not have access to proper sanitation facilities, leading to poor hygiene practices and exposure to diseases. Thus, providing financial assistance can help reduce environmental health hazards by enabling communities to access basic needs such as proper sanitation, food, and water.

To learn more about hazards visit;

https://brainly.com/question/28066523

#SPJ11

Answer:true

Stage refers to how large a cancer tumor is and how far the cancer has spread

if you are talking about cancer

Answer:b

Explanation:

The statement to determine what traits will be passed on to offspring explains the breeding-soundness examination is performed.

The breeding soundness examination (BSE) involves a complete and systematic evaluation of the reproductive potential of a given male, including mating ability and libido, general physical examination.

The breeding soundness exam (BSE) is much more than a “semen test.” It consists of a physical exam that should include examination of the eyes, feet and legs, teeth (if an older bull), and general overall condition.

By following out breeding system i.e., crossbreeding, selective breeding and grading up according to the need, results in improvement in production performance of the crossbred.

Learn more about breeding soundness:

https://brainly.com/question/21937391

#SPJ3

Assimilation simply means the ways by which some of the food we eat and are absorbed by the body are being converted to new protoplasm or used to provide new energy for the body.

ASSIMILATION OF GLUCOSE

The hepatic portal vein transports absorbed sugars to the liver,the excess glucose is then converted to glycogen by insulin.When needed by the body,the liver in-turn converts this glycogen to glucose so that they can be moved to the cells,from there glucose is transported to every other parts of the body so that they can provide the cells with needed energy,during cell respiration,glucose is oxidized to release energy to be used for vital activities.

ASSIMILATION OF AMINO ACIDS.

Amino acids which are end products of protein passes through the liver to all parts of the body.

When amino acids are excess in the body,they will be deaminated in the liver to form urea, amino acids aren't stored,they are used to make proteins,repair worn out cells, aids growth, formation of enzymes and hormones and conversion into new protoplasm.

ASSIMILATION OF LIPIDS

Lipids which are end products of fats and oils are transported by the lymphatic capillaries or lacteal.

When lymph comes together with fat, chyle is formed,this chyle will further be discharged into the bloodstream and will be carried by the blood.

Fats are used to alternate source of energy for the body and as well form new protoplasm like the cell membrane.

When fats are in excess,they are stored in the adipose tissue which are found around the heart, kidneys, beneath the skin,and mesenteries that binds the intestines.

Answer: A. E, only

Explanation: FSH is a reproductive hormone! Good luck! :D

Bees serve as pollinators, moving pollen from flower to flower to nourish both cultivated and wild plants. The production of seeds by fertilised plants ensures the survival of the surrounding habitat.

A species that naturally inhabits and thrives in a certain ecosystem is said to be a native species. They include any species that evolved in the local ecosystem.

They typically exist in an ecosystem as a result of natural processes like natural selection or evolution. They are known to exist naturally within a specific habitat, as opposed to introduced species.

To know more about the surrounding habitat visit here :

https://brainly.com/question/22238851

#SPJ4

In the tree of life, fungi are most closely related to animals.

1. Analyze the group of answer choices: archaea, bacteria, viruses, plants, and animals.

2. Understand that fungi, like the other groups, are eukaryotic organisms.

3. Recognize that archaea and bacteria are prokaryotic, while viruses are not even considered living organisms, so they can be eliminated as options.

4. Compare fungi to the remaining eukaryotic groups, plants and animals.

5. Observe that fungi and animals share more common characteristics, such as heterotrophy (obtaining nutrients from external sources) and the presence of chitin in their cell walls.

To know more about fungi, visit here :

brainly.com/question/1261179

#SPJ11

The most common function of fibrous proteins is structural roles.

Fibrous proteins are composed of nonpolar amino acids that are coiled together to form long fibers or filaments. Structural proteins are characterized by their high degree of elongation, which allows them to form fibers that are strong and flexible.

They are primarily involved in the formation of connective tissues in the body, including skin, hair, nails, and cartilage. They are also found in the extracellular matrix and in muscle fibers. The other options are not the most common function of fibrous proteins.

Enzymes and carrier molecules are not fibrous proteins but globular proteins. Enzymes catalyze chemical reactions in the body, while carrier molecules transport various molecules across cell membranes. Although some fibrous proteins can also act as enzymes or carrier molecules, these are not their primary functions.

In conclusion, the most common function for fibrous proteins is structural roles.

To know more about fibrous proteins, refer here:

https://brainly.com/question/30670197#

#SPJ11

Explanation:

Muscular Strength

Muscular endurance

Flexibility

Body Composition

Sustainability is about maintaining the ecosystem diverse and productive, even attending the needs of production for humanity as well.

In order to do so, it's important to be careful about the disposal of any types of trash. So, avoiding to dispose of trash unnecessarily is really important, therefore A is correct. It is also important to avoid creating unnecessary trash, what happens when we chose to consume only water from plastic bottles, for example, instead of using reusable bottles. This means that B is also correct. Talking about not creating unnecessary trash, C is also correct, because it talks about avoiding single-use products. Also, avoiding the creation of unnecessary trash is related to E, because it's about avoiding excess packaging and/or avoid buying unnecessary items, reusing the same ones instead. Therefore, alternative D is incorrect, because while it talks about recycling it also incites the usage of plastic bags to dispose trash, which could be replaced by paper bags, for example.

Answer:

The mitochondria are semi-autonomous cell organelles which are evolved from prokaryotic cells.

Explanation:

The mitochondria is surrounded by lipid bilayer membrane.They possess their own self replicating DNA ,also 70s ribosomes for protine synthesis,so they are believed to have evolved from prokaryotic cells

Answer:

Your answer is Active Transport

Explanation:

hope this helps you!!!

The rate of cooling is inversely proportional to the crystal size. The faster the cooling rate, the smaller is the crystal size and the slower the cooling rate, the larger is the crystal.

Rate of cooling can be defined as the elimination or removal of the high temperature from any object. This removal and be slow and gradual, therefore slow rate of cooling; or it cab quick and instant, therefore, fast rate of cooling.

Crystals are the solid components whose molecules are arranges in a regular fashion, giving it an ideal 3 dimensional pattern. They are symmetrical in nature. The examples of crystals are sugars, salt, etc.

To know more about crystals, here

brainly.com/question/1212769

#SPJ1