if the fed buys $10 million dollars in government securities, and the required reserve ratio is 20 percent, the banking system is able to expand the money supply by:

Answers

Answer 1

If the Fed sells $10 million in bonds to a bank, and the required reserve ratio is 20 percent, then the banking gadget can: minimize the money furnish by way of up to $50 million.

What is a reserve ratio and why is it required?

The reserve ratio is the portion of reservable liabilities that industrial banks have to hold onto, as a substitute than lend out or invest. This is a requirement decided with the aid of the country's central bank, which in the United States is the Federal Reserve.

What is required reserve ratio in India?

This is the RBI's way of controlling the excess flow of cash in the economy. The money balance that is to be maintained through scheduled banks with the RBI must no longer be much less than 4% of the complete NDTL, which is the Net Demand and Time Liabilities. This is finished on a fortnightly basis.

Learn more about  required reserve ratio  here:

https://brainly.com/question/28114915#SPJ4

Related Questions

The following hypothetical production possibilities tables are for China and the United States. Assume that before specialization and trade the optimal product mix for China is alternative B and for the United States is alternative U. China Production Possibilities Product: A - B - C - D - E - F Apparel: 120,000 - 96,000 - 72,000 - 48,000 - 24,0000 Chemicals(tons): 0 - 24 - 48 - 72 - 96 - 120 U. S. Production Possibilities Product: R - S - T - U - V - W Apparel: 40,000 - 32,000 - 24,000 - 16,0000 - 8,0000 Chemicals(tons): 0 - 16 - 32 - 48 - 64 - 80a. Are comparative-cost conditions such that the two countries should specialize?

Yes / No.

If so, what product should each produce?

China should produce chemicals or apparel.

The United States should produce chemicals or apparel?

b. What is the total gain in apparel and chemical output that would result from such specialization?

Apparel: units.

Chemicals: tons

Answers

Having the Production Possibilities China should create clothing, while the United States should produce chemicals, there will be a gain of 6000 in apparel  and 2 in chemicals overall.

To know about Production Possibilities we need to know about its curve,the production possibility curve illustrates the cost to society of selecting one of two items. When an economic system operates at the frontier of manufacturing potential, which is the extreme edge of this curve, it may have the highest quality of life possible since it is employing the best use of its resources to provide as much as possible. The PPF illustrates that a rise in output for one commodity can only happen when output for the associated commodity falls. While deciding on the ideal product mix for their company, managers can utilise the PPF as a tool for decision-making.

To learn more about Production Possibilities refer here:

https://brainly.com/question/15179228

#SPJ4

what is the price of a three-year, default-free bond with a face value of $1000 and an annual coupon rate of 4%? what is the yield to maturity for this bond

Answers

To calculate the bond's price, we must first compute the present value of all the cash flows it generates. In this scenario, the bond pays a three-year yearly coupon of 4% of the face value, or $40.

The bond also returns the face value of $1000 at the conclusion of the third year. We can compute the present value of each cash flow using a financial calculator or spreadsheet, and then add them together to determine the bond price: PV(coupon payment) = $40/1+r)1 + $40/1+r)2 + $40/1+r)3 PV(face value) = $1000/1+r)3 where r is the yearly yield till maturity. Assuming a 3% annual yield until maturity, the cash current value is Flows are as follows PV(coupon payment) = $113.30 PV(face value) = $906.41 PV(coupon payment) = $38.83 + $37.76 + $36.71 As a result, the bond's price is: Price = $113.30 + $906.41 = $1,019.71 To calculate the yield to maturity, we may utilize trial and error to determine the discount rate that makes the bond's cash flows equal to its price. We may also utilize the built-in Excel function RATE. We may compute the yield to maturity in Excel using the PRICE, COUPDAYS, COUPDAYSNC, and YIELD functions as follows: PRICE(DATE(2021,2,25), DATE(2024,2,25), 4%, yld, 1000, 1, 0) =PRICE(DATE(2021,2,25), DATE(2024,2,25), 4%, yld, 1000, 1, 0) We get a yield to maturity of 2.97% when we solve for yld. As a result, the bond's price at 2.97% yield to maturity would be: PRICE = $40 / (1 + 0.0297)^1 + $40 / (1 + 0.0297) ^2 + $40 / (1 + 0.0297)^3 + $1000 / (1 + 0.0297) ^3\s= $113.91 + $110.52 + $107.19 + $906.41\s= $1,137.03 As we can see, the bond's price rises as the yield to maturity falls.

learn more about  Price here:

https://brainly.com/question/19091385

#SPJ4

Choose the behaviors that are exhibited by someone who is using critical thinking.


Tests conclusions against reasonable criteria

Thinks along a narrow track

Gathers relevant information

Assesses information gathered

Jumps to conclusions

Questions ideas and beliefs

Answers

Answer:

b c d f

Explanation:

i just did it <3

Randy and Kim divided their 30-acre property into three 10-acre parcels (lots A, B, and C). A and C can only access the public road through B. The buyers of A and C will probably be granted what type of easement by court action?

Answers

Answer: Easement by necessity

Explanation: Easement may be referred to as a right granted to an individual to make use of another person's property or land such that the individual would not be penalized for trespassing. The easement by necessity is usually granted by a legal body, that is a court of law, granting an individual a legal pass or authority to move or travel over another person's land without penalty. This is uaually the case when it becomes a must and there is no other means by which the individual can access his or her own property except by passing or traveling through another property. In the scenario above, the owners of land A and C will be granted easement of necessity which will allow them to travel through land B without being penalized in other to access their own property.

Woodsmith magazine gave instructions on how to build a pine cupboard. Lumber will be needed for two shelves 1134 inches long, two base sides 1112 inches long, and two door stiles 2918 inches long. Your lumber comes in 6 foot lengths. A. How many feet of lumber will you need? (Enter your fraction in lowest terms.)

Answers

Answer:

Hi there!

You'll need 860.67 feet of lumber.

Explanation:

First we calculate the needs of lumber in inches

Shelves: 2 x 1,134 = 2,268 inches

Base Sides: 2 x 1,112 = 2,224 inches

Door stiles: 2 x 2,918 = 5,836 inches

Total inches long of lumber needed:

2,268 + 2,224 + 5,836 = 10,328 inches

Then we convert the unit of measure from inches to feet:

One inch equals 0.08333 feet.

10,328 x 0.08333 = 860.67 feet

KNOWLEDGE CHECK A rise in which of the following inputs will increase an absolute valuation? o Beta o Earnings estimates o Number of shares o 10-year government bond yield

Answers

A rise in earning estimate will lead to an increase of absolute valuation.

What is an absolute valuation?

An absolute value refers to the method of business valuation which uses a discounted cash flow analysis to determine a company's financial worth. With this value, an investors can determine if a stock is currently under or overvalued by comparing what a company's share price should be given its absolute value to the stock's current price.

An earnings estimate means an analyst's forecast for a public company's future quarterly or annual earnings per share (EPS). Large share of the investors relies on earnings estimates to gauge a company's performance and make investment decisions about it.

Read more about earnings estimates

brainly.com/question/25425890

#SPJ1

if you needed a loan to buy furniture, the lowest interest rate would usually be available from a

Answers

The lowest interest rate for a loan to buy furniture is typically available from a credit union. Credit unions are cooperatives owned by their members, and they generally offer more favorable terms than commercial banks.

A credit union loan typically offers lower interest rates because the credit union does not have to pay dividends to shareholders. Instead, the credit union returns any profits to its members in the form of lower loan rates and more favorable terms.

Credit unions also tend to offer more personalized services than commercial banks. Credit unions are owned and operated by their members, so they are more likely to understand and be responsive to their customers' needs. Credit unions also tend to have more flexible terms and conditions than commercial banks, making it easier to qualify for a loan.

Finally, credit unions are often more forgiving when it comes to credit scores. Many credit unions will work with customers who have lower credit scores than commercial banks would accept. This makes it easier for people with lower credit scores to qualify for a loan to buy furniture.

In short, credit unions typically offer the lowest interest rates for loans to buy furniture, as well as more personalized services and more flexible terms. For these reasons, credit unions are the best option for those looking for a loan to buy furniture.

Know more about interest rate here

https://brainly.com/question/14556630#

#SPJ11

Describe the Calvin Cycle.
Describe how the Na+-K+ pump and the K+-Na+ leak channels function to polarize a nerve cell membrane such that it attains its characteristic – 40 to – 90 mV resting potential.

Answers

The Calvin Cycle is a series of biochemical reactions that occur in the stroma of chloroplasts during photosynthesis. It is the second stage of photosynthesis and involves the conversion of carbon dioxide (CO₂) into glucose. The cycle utilizes the energy from ATP and NADPH, which are produced in light-dependent reactions, to synthesize glucose molecules.

The Na+-K+ pump and K+-Na+ leak channels play a crucial role in establishing and maintaining the resting potential of a nerve cell membrane. The Na+-K+ pump actively transports sodium ions (Na+) out of the cell while pumping potassium ions (K+) into the cell against their concentration gradients. This process requires ATP energy. By doing so, the pump helps maintain a higher concentration of K+ inside the cell and a higher concentration of Na+ outside the cell, resulting in an electrochemical gradient.

The K+-Na+ leak channels, on the other hand, provide a passive pathway for K+ ions to leak out of the cell and Na+ ions to leak into the cell. This leakage occurs due to the concentration gradients established by the Na+-K+ pump. The net effect is the polarization of the nerve cell membrane, with the inside becoming negatively charged relative to the outside. This polarization creates the characteristic resting potential of the nerve cell, typically ranging from -40 to -90 mV.

Learn more about Nerve cells: https://brainly.com/question/13393634

#SPJ11

Jim and Jane purchased their house a year ago and have been transferred out of town. They paid $275,000 for the property and ended up after expenses with only $225,000. Their percentage of loss on the sale was:

Answers

Answer:

18%

Explanation:

Original cost: $275,000

Selling price: $225,000

Loss: $50,000

50,000/275,000=0.18

0.18x100=18%

:)

what strategy would be the most useful to companies interested in brazilian investment?

Answers

One of the most useful strategies for companies interested in Brazilian investment is to develop strong local partnerships.

Strong local partnerships can help companies navigate the complex legal, regulatory, and cultural landscape in Brazil and build relationships with key stakeholders.

In Brazil, relationships are often built on personal connections and trust, so having a local partner who understands the local business practices and customs can be invaluable.

Another key strategy is to conduct thorough market research to understand the unique characteristics of the Brazilian market and identify opportunities for growth.

This includes understanding the local consumer preferences, cultural differences, and market trends. With a thorough understanding of the market, companies can develop tailored products and services that meet the specific needs of Brazilian consumers.

Finally, companies should be prepared to invest in the long-term when entering the Brazilian market. Brazil is a country that values personal relationships and face-to-face interactions, so it may take time to build trust and establish a strong presence in the market.

Companies that are committed to the Brazilian market for the long-term will be better positioned to succeed over time.

In summary, developing strong local partnerships, conducting thorough market research, and investing in the long-term are all key strategies for companies interested in Brazilian investment.

To learn more about Brazilian, click here:

https://brainly.com/question/22859382

#SPJ11

What is regional economic integration

Answers

Answer:

Regional Economic Integration can best be defined as an agreement between groups of countries in a geographic region, to reduce and ultimately remove tariff and non-tariff barriers to the free flow of goods, services, and factors of production between each other.

Is the total of your fixed and variable expenses your cash flow

Answers

Answer:

mabey

Explanation:

What is important for starting a charity

Answers

Explanation:

One of the most vital things to consider when you are starting a nonprofit is your mission. Writing a mission statement of one to two sentences can outline why it exists, what the organization does, who it serves and where it provides services all in one place

What is an investment portfolio?
A. A selection of varied accounts
B. A selection of varied instruments
C. A selection of varied applications
D. A selection of varied stocks and bonds​

Answers

Answer:

In finance, a portfolio is a collection of investments aka stocks and bonds!

Which of the following would have a negative impact on determining eligiblity for a home loan?

Answers

Answer:

Withdrawing money from savings

Explanation:

If a person withdraws money from his savings, this person is losing the balance that the bank or mortgage company could take into account in order to approve the loan or not.

The reason is that a person without savings could very easily find it hard to keep up with payments in case of a job loss, or a salary reduction, while a person with savings has a financial cushion that insurers the loaner against this kind of situations.

Which of these would be considered an entrepreneur?
O A. A nurse in a hospital
O B. The owner of a local coffee shop
O C. A school teacher
O D. A public transportation bus driver

Answers

Answer:

I think its B

Explanation:

Because you own your own place

The owner of a local coffee shop would be considered an entrepreneur. Hence, option B is correct.

What is meant by entrepreneur?

Entrepreneurs are people who launch new businesses, bearing the bulk of the risks and getting the majority of the rewards. Starting a business is a practice of entrepreneurship.

The entrepreneur is generally regarded as an inventor who develops novel ideas for goods, services, companies, and operating procedures. Several well-known businesspeople include Bill Gates, Steve Jobs, Mark Zuckerberg, Pierre Omidyar, Arianna Huffington, and Caterina Fake.

Some kinds of entrepreneur are -

   Small Businesses Entrepreneurship.

   Scalable Start-up Entrepreneurship.

   Social Entrepreneurship.

   Large Company Entrepreneurship.

Thus, option B is correct.

For more details about entrepreneur, click here:

https://brainly.com/question/13897585

#SPJ2

It costs a publishing company $0. 55 to print one copy of a certain novel. This company paid $725,000 for the rights to the novel. If they can sell a copy of the novel for $6. 75, how many copies of the novel must they sell to break even, to the nearest hundred?.

Answers

116,900 copies of the novel must they sell to break even, to the nearest hundred.

What is cost?

In manufacturing, research, retail, and accounting, an expense is the value of money that was used  to produce a product or provide a service and  is therefore no longer available. In business, the cost may be the purchase price, in which case the cost is the amount of money used for the purchase.

The two main types of costs in businesses are

fixed costvariable cost

Fixed costs do not change depending on output, while variable costs. Fixed costs are sometimes called overheads.

To learn more about cost, refer;

https://brainly.com/question/15135554

#SPJ4

Which of the following is something that will not affect your homeowners insurance premium? a. the age of the home b. the size of the home c. the color of the home d. the location of the home

Answers

Answer:

The color of the home.

Explanation:

All other options affect your insurance rates.

The color of the home will not affect your homeowners insurance premium. Option (c) is correct.

What do you mean by Location?

The spot where a specific point or object is found is called its location. Geographically speaking, location is a key concept and is typically regarded as being more specific than "place." A locale is a place where people live, such as a city, town, hamlet, or even an ancient location.

You pay a premium when you purchase an insurance policy. Your recurring payments for many popular insurance products, such as life, car, business, homeowners, and renters, are known as premiums. Your policy could be cancelled if you don't pay your premiums.

The total amount paid to an insurer for insurance is referred to as a premium. A fire service levy, an emergency service levy, and GST might be included. It excludes any amount of duty or a charge paid to an intermediary. When it is received by the insurer, broker, or agent, a premium is considered paid.

Therefore, Option (c) is correct. The color of the home.

Learn more about Location, here;

https://brainly.com/question/11718756

#SPJ2

ou are a security consultant and have been hired to evaluate an organization's physical security practices. all employees must pass through a locked door to enter the main work area. access is restricted using a biometric fingerprint lock. a receptionist is located next to a locked door in the reception area. they use an ipad application to log any security events that may occur. they also use their ipad to complete work tasks as assigned by the organization's ceo. network jacks are provided in the reception area so that employees and vendors can access the company network for work-related purposes. users within the secured work area have been trained to lock their workstations if they will be leaving them for any period of time. which of the following recommendations are you most likely to make to this organization to increase their security? (select two.)

Answers

The most likely change this organization will make to improve security is to disable the switch ports linked to the network jacks in the reception area.

An entity, such as a business, institution, or association, that is made up of one or more people and has a specific function is known as an organization organization or organization (Commonwealth English; see security spelling variations).

The word is derived from the Greek word organon, which also refers to an instrument, an organ, and many tools.

There are many different legal types of organizations, such as security corporations, governments, non-governmental organizations, political organizations, international organizations, armed forces, charities, not-for-profit corporations, partnerships, cooperatives, and educational organization institutions, among others.

An organization that concurrently performs functions for the public good and expands commercial market activities is known as a hybrid organization.

Learn more about organization here

https://brainly.com/question/13031500

#SPJ4

Unlimited wants + limited resources = what is the answer?

Answers

Answer:

People never get enough of what they want or need

Explanation:

Unlimited wants and needs are one half of the basic troubles of scarcity that has troubled humanity since the beginning of time. The other half of the scarcity problem is limited resources. The reason why we always want something is because our brains are actually made to be attracted to novelty. So, we always seek ti learn new things and experiences.

(I hope this was accurate and helpful)

Disadvantages of choosing a job that is extremely popular or in demand

Answers

The disadvantage of choosing a job that is very popular or a job that is in high demand is that after a while such a job may become saturated or it would become monotonous.

What is a high demand job?

This is the term that is used to refer to a job that the people that wpould employ labor are constantly in need of. Such a job is one that would require the people that have the qualification to opt in and get the places and the roles that they are to fill.

The issues that may arise from such a job that is in high demand is that after a period, such a job may have a lot of persons that would want to fulfil the role.

The number of qualified persons may become more than the job that is available for the people to do in the long run.

Hence this is a disadvantage. Therefore I would conclude by saying that the disadvantage of choosing a highly popular job is that the number of persons that are willing to fulfil the role may exceed the job overtime.

Read more on jobs here: https://brainly.com/question/26355886

#SPJ1

Tell me 3 characteristics of money? ​

Answers

1.) durability

2.) acceptability

3.) scarcity

4.) portability

5.)divisibility

6.)uniformity

choose any three u want! :)

Characteristics of Money.

Answer:

(a) Divisibility

(b) Limited supply

(c) Durability

More:

(d) Portability

(e) Acceptability

(f) Uniformity

These are the characteristics of money.

Hope it helps!!Please mark me as the brainliest!!!

Thanks!!!!

which economic indicators most strongly suggest than an economy is experiencing the expansion phase of the business cycle?

Answers

The economic indicators that most strongly suggest that an economy is experiencing the expansion phase of the business cycle are as follows: GDP Growth Rate, Employment, Consumer Confidence, Industrial Production,  Investment and Capital Spending.

1. GDP Growth Rate: The growth rate of gross domestic product (GDP) is a crucial indicator of economic expansion. When the GDP is growing rapidly, it suggests that the economy is experiencing an expansion phase.

2. Employment: When an economy is in expansion, it will generate jobs, lowering unemployment rates. Therefore, falling unemployment rates indicate that the economy is growing.

3. Consumer Confidence: Consumer confidence is critical to the expansion phase of the business cycle. A rise in consumer confidence suggests that individuals believe that the economy will continue to grow.

4. Industrial Production: Industrial production also a crucial economic indicator. Industrial production growth shows that there is increased demand in the economy, meaning that it is growing.

5. Investment and Capital Spending: When businesses are investing in the economy by increasing their capital expenditure, it indicates that they believe the economy will continue to grow. When companies invest, it leads to increased job creation and economic growth.

For more such questions on Employment

https://brainly.com/question/28239914

#SPJ8

which of the following is not a characteristic of decentralization? multiple choice question. decentralization reduces how accountable lower-level managers are for the outcomes of their decisions. decentralization allows top management to concentrate on bigger issues such as overall strategy. decentralization puts the decision-making authority in the hands of those who have the most information on day-to-day operations. decentralization helps to train lower-level managers for higher level positions

Answers

"Decentralization reduces how accountable lower-level managers are for the outcomes of their decisions" is not a characteristic of Decentralization.

What is Decentralization ?

When everyday operations and decision-making authority are transferred from top management to middle- and lower-level managers—and occasionally even team members—this is known as decentralization in business.

Decentralized frameworks enable team members to apply their skills, knowledge, and expertise to contribute meaningfully to the workplace. This strategy also lessens some of the constraints on business owners, allowing them to focus more on growth and less on day-to-day tasks.

Hence, option A is an appropriate response.

To learn more about Decentralization

https://brainly.com/question/12653061

#SPJ1

Interest compounded semiannually is compounded four times a year. True False

Answers

Answer:

true.

Explanation:

Interest compounded semiannual is compounded four tme a year

False. Semiannually is twice a year.

the (the rate banks charge their best customers) closely follows the rate that the fed adjusts by using open market operations.

Answers

'The Prime rate closely follows the rate that the fed adjusts by using open market operations.

Marketing Operations is the function that oversees an organization's marketing programs, campaign planning, and annual strategic planning activities. Other responsibilities include technology and performance measurement, and reporting and data analysis.

Central banks conduct open market operations to regulate the money supply in the economy. For example, in India, open market operations are conducted by the Reserve Bank of India or RBI.

Open market operations (OMOs) — the buying and selling of securities on the open market by central banks — are an important tool used by the Federal Reserve in conducting monetary policy. Short-term targets for open market operations are set by the Federal Open Market Committee (FOMC).

Learn more about market operations https://brainly.com/question/14256204

#SPJ4

A business opportunity that match traveling​

Answers

Answer:

Steward or stewardess assistant

Explanation:

Like a plane servant ,if u r up for it though...

In bank
Design a distribution channel for the product and determine the
role of each member in the channel.

Answers

In a channel, every member plays a significant role that contributes to the success of the channel.

When it comes to channels, each member plays a crucial role in contributing to its success. The owner of the channel is responsible for setting the goals, objectives, and rules of the channel. Moderators assist in maintaining the channel's rules and make sure that the members follow them. They also help the owner manage the content and make sure it is relevant. Members play a crucial role in making the channel lively and engaging. They participate in discussions, share their ideas and thoughts, and provide feedback on the content. Each member's role is essential in making sure that the channel meets its goals and objectives. Therefore, it is crucial to have members who are passionate about the channel's subject matter and are willing to contribute to its success.

House prices have risen significantly as a result of this sector's demand. There is no question that feelings assume a critical part, as well. Cricketers play had a huge impact in the social and memorable texture of the country.

Know more about significant role, here:

https://brainly.com/question/8310376

#SPJ11

Which is not a major concern of socially responsible consumers?
O labor conditions
O tax deductions
O use of resources
O charitable activities

Answers

One thing that is not a major concern for socially responsible consumers is tax deductions.

What are the concerns of socially responsible consumers?

These are people who worry about the impact of their consumption on people. As a result, they call for better labor conditions and for equitable use of resources.

They do not care much for tax deductions because they simply want a better life for others.

Find out more on being a socially responsible consumer at https://brainly.com/question/16245076.

#SPJ1

An investment of $110,000 in safe 10-year corporate bonds yields an average of 6% per year, payable each year. The effective income tax rate is 35%, and inflation will average 2% per year. How much will this investment of $110,000 be worth in 10 years in today's purchasing power after income taxes and inflation are taken into account? The FW is $ (Round to the nearest dollar.)

Answers

The investment of $110,000 is worth $132,506 in 10 years in today's purchasing power after income taxes and inflation are taken into account.

To find the future worth of a $110,000 investment in 10-year corporate bonds, we need to consider the yearly yield, income tax rate, and inflation.


1. Calculate the annual yield after tax
Annual yield = 6% * (1 - 35%)
Annual yield = 6% * (1 - 0.35)
Annual yield = 6% * 0.65
Annual yield = 3.9%

2. Calculate the real annual yield after considering inflation
Real annual yield = (1 + Annual yield) / (1 + Inflation rate) - 1
Real annual yield = (1 + 3.9%) / (1 + 2%) - 1
Real annual yield = (1.039) / (1.02) - 1
Real annual yield = 0.0186 or 1.86%

3. Calculate the future worth of the investment after 10 years in today's purchasing power
FW = Initial investment * (1 + Real annual yield) ^ Number of years
FW = $110,000 * (1 + 1.86%) ^ 10
FW = $110,000 * (1.0186) ^ 10
FW = $110,000 * 1.2046

FW ≈ $132,506 (rounded to the nearest dollar)

So, the investment of $110,000 in safe 10-year corporate bonds will be worth approximately $132,506 in today's purchasing power after income taxes and inflation are taken into account in 10 years.

To learn more about Investment visit:

https://brainly.com/question/1294604

#SPJ11

Other Questions
in most jurisdictions around the world where probation is an established sanction, the agency responsible for probation does each of the following except: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below: AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTCT CTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAGHow many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? a. two b. three c. four d. five You are getting ready for your graduation party so you by eight cases of soda each case has 24 cans of soda and each can hold 12Fluid ounces. How many gallons of soda did you purchase What are the correct coefficients in order for the equation to be balanced? content from other sources can be embedded into it linked to a photoshop document from another source What is a risk premium? Multiple choice question. It is additional compensation for taking risk, over and above the risk-free rate. It is the return on risk-free securities. It is a numerical estimate of beta. It is a fee charged to investors by the SEC that allows them to invest in risky securities. Problem: Your school science club has devised a special event for homecoming. You've attached a rocket to the rear of a small car that has been decorated in the blue-and-gold school colors. The rocket provides a constant acceleration for 9.0s. As the rocket shuts off, a parachute opens and slows the car at a rate of 5.0m/s2. The car passes the judges' box in the center of the grandstand, 990mfrom the starting line, exactly 12s after you fire the rocket. What is the car's speed as it passes the judges? please answer giving brainliest which part of the cell membrane prevets the cell from dissolving in water Cellular respiration use sugar and _______ to make ATP,_________ and ______Help The Tokugawa Shogunate had kept the emperor as a figurehead and religious symbol. This article is titled the Meiji Restoration, did the restoration actually place the emperor back into power? Use evidence from the article to explain your reasoning. Ch 2 Discrimnation In the New South / 8th Grade Georgia StudiesTRUE OR FALSE1._______ 2. _______ 3. _______ 4. ______ 5. _______ 6. _______ 7. _______ 8. _______CHRONOLOGICAL ORDER_______ Homer Plessy is put in jail for sitting in the Whites Only section of a train._______ A Louisiana judge rules against Homer Plessy, declaring him guilty._______ U.S. Supreme Court rules against Plessy. Segregation is upheld, and separate, but equal becomes law._______ States pass Jim Crow laws discriminating against African Americans._______ Plessy appeals state ruling to the U.S. Supreme Court._______ Public spaces, transportation, and businesses become segregated across the South.KEY CONCEPT CHECK-POINT_______ 2. _______ 3. _______READING FOR INFORMATIONIn the early 1900s, the two most prominent African American leaders were __________________ and ____________________. They greatly disagreed on the issue of __________________________ and how to make changes in the South. ________________________________ believed that blacks should not challenge segregation. He also believed that learning a _______________________________ could help African Americans advance faster than by demanding equal rights. In contrast, W.E.B. Du Bois believed in full ________________________________, _____________________________, and _________________________________ for African Americans, and he believed blacks should seek a ________________________________. He strongly encouraged African Americans to speak out against ____________________________ and ________________________________.POINT OF VIEW________________________________________________________________________________CRITICAL THINKING____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________QUICK REVIEW____ actions of hate against Jewish immigrants ____ white violence against African Americans________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________COMPREHENSIVE CROSS-CHECK________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________EXPRESSING YOU OPINION_______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________PLS HELP Using the graph at right, where is the function increasing/decreasing? Where is the function concave up/down? Does this function have anymaxima or minima? Explain how you know Alisa Miller claims that today's college graduates: Mention four negative long-term social effects of human rights violation happening in school premises companies, and even countries supporting their home countries, have been accused of violating this world trade organization provision by selling products for a price less than the cost of production in order to capture market share and force competitors out of the market. this is known as uestion #6: You're making annual payments of $1000 a year for a loan over 10 years (first payment at the end of the first year) at 6% APR when, suddenly, the credit card company changes the rate to 12% at the end of the fifth year. What is the future value of the loan at the end of year ten? (10 pts) Write a story that begins with you over hearing a phone call which is meant to be secret The scholastic assessment test is standardized to be normally distributed with a mean =500 and a standard deviation =100. What percentage of SAT scores fallsa. between 500 and 600b. between 400 and 600c. between 500 and 700d. between 300 and 700e. above 600f. below 300 Kindly solve all the questions below .I'll give the brainliest