This reaction with 25 grams of iron 3 phosphate and an excess of sodium sulfate, 33.190 grams of iron 3 sulfate.
What do you mean by stoichiometry ?The term Stoichiometry is defined as a section of chemistry that involves using relationships between reactants and products in a chemical reaction to determine desired quantitative data.
Step 1.
In any stoichiometry question is to find the molecular weights of the compounds involved:
FePO4 = 55.845+ 30.974 + 16*4
= 150.819 g/mol
Fe2(SO4)3 = 55.845*2 + (32.065+16*4)*3
= 399.885 g/mol
Step 2.
To find the number of moles of your reactant, FePO4:
grams of substance/molecular weight of substance= moles of substance
25g/150.819g/mol= 0.166 moles of FePO4
So, think about the proportion of how many moles of your reactant there are for each mole of your product. In this case, there are 2 moles of FePO4 for every 1 mole of Fe2(SO4)3.
0.166 mole FePO4 * 1 mole Fe2(SO4)3/ 2 moles of FePO4
= .083 mole of Fe2(SO4)
Now, multiply the number of moles of your product by its molecular weight:
0.083 moles of Fe2(SO4)3 × 399.885 g/mol
= 33.190 grams of Fe2(SO4)3
Thus, 33.190 grams of iron 3 sulfate.
To learn more about the stoichiometry, follow the link;
https://brainly.com/question/30218216
#SPJ1
write a mechanism that describes the formation of the two more important products
Answer:
The two or more important products are :-
1. 3 methlcycodexene
2. 1 methlylcohexene(2pt)
When 25.5 grams of a molecular substance is dissolved in 225g benzene, the solution begins to freeze at -5.05C. Calculate the molar mass of this solute (I need to understand the work, and look at the image attached for the key for benzene.
Answer:
here :). hope this helps.
Which of the following is a characteristic of a scientific theory
1. It explains how nature works.
2. It is based on a single experiment.
3. It should not be possible to replicate its results.
4. It should not be possible to replicate its observations.
NEED URGENT!!!!!
Answer:
number one
Explanation:
hope I helped
What are 4 physical properties of matter?
Four physical properties of matter are density, colour, hardness, melting and boiling points and many more.
The matter is usually composed of tiny particles known as atoms and can be represented as something that occupies space. It must represent both the mass and volume properties.
Properties are defined as the features that capable us to differentiate one material from another. A physical property is usually a characteristic of matter that does not depend on its chemical composition.
Generally a physical property is defined as an attribute of matter that is independent of its chemical composition. Some of the main examples of physical properties density, color, hardness, melting and boiling points, and electrical conductivity.
Learn more about physical properties from the link given below.
https://brainly.com/question/18327661
#SPJ4
Tikiya is conducting experiments on samples of pure copper (Cu). While collecting data, Tikiya records both physical and chemical properties of the metal. Which of the following is dependent on the amount of copper particles in the sample? A. Electrical conductivity B. Thermal conductivity C. Mass D. Density
Answer: Mass
Explanation: I had the same question hope its right for you
CaCOs(s) -» CaO(s) + C02(g)
(3)
A student heats a 5 g pellet of CaCO3 strongly for 10 minutes over a Bunsen burner flame.
After cooling, the student uses an open container to measure the mass of the products formed and finds this to be 2.8 g.
Provide an explanation for the decrease in mass of the products compared to the reactant and work out how many molecules of carbon dioxide would form in this reaction.
CaCO₃(s) → CaO(s) + CO₂(g) is tha balanced chemical reaction. One molecule of carbon dioxide would form in this reaction.
What is balanced chemical reaction ?A balanced chemical equation is defined as an equation where the number of atoms of type in the reaction is the equal on both reactants and product sides. The mass, as well as the change, are similar in a balanced chemical equation.
If a student heats a 5 g pellet of CaCO₃ strongly for 10 minutes complete a Bunsen burner flame. After cooling, the student utilizes an open container to decide the mass of the products formed and finds this to be 2.8 g.
The decrease in mass of the products compared to the reactant because there is formation of carbon dioxide as a side product.
Thus, There are one molecule of CO₂ is produced.
To learn more about the balanced chemical reaction, follow the link;
https://brainly.com/question/30230799
#SPJ9
How many milliliters of 8.00?10?2 M NaOH are required to titrate each of the following solutions to the equivalence point? 45.0 mL of 9.50?10?2 M HNO3 35.0 mL of 8.00?10?2 M HC2H3O2 55.0 mL of a solution that contains 1.80 g HCl of per liter
a. To titrate 45.0 mL of 9.50×10⁻² M HNO₃ to the equivalence point, 5.34 mL of 8.00×10⁻² M NaOH is required.
b. To titrate 35.0 mL of 8.00×10⁻² M HC₂H₃O₂ to the equivalence point, 3.50 mL of 8.00×⁻² M NaOH is required.
c. To titrate 55.0 mL of a solution that contains 1.80 g HCl per liter to the equivalence point, 89.8 mL of 8.00×10⁻² M NaOH is required.
For titrating 45.0 mL of 9.50×10⁻² M HNO₃ to the equivalence point:
V1 = M2V2/M1
= (9.50×10⁻² × 45.0)/8.00×10⁻²
= 5.34 mL
For titrating 35.0 mL of 8.00×10⁻² M HC₂H₃O₂ to the equivalence point:
V1 = M2V2/M1
= (8.00×10⁻² × 35.0)/8.00×10⁻²
= 3.50 mL
For titrating 55.0 mL of a solution that contains 1.80 g HCl per liter to the equivalence point:
The molarity of HCl is calculated as:
Molarity = mass of solute/ molar mass of solute × volume of solution in liters
= 1.80 g/ 36.46 g mol⁻¹ × 1 L
= 0.049 mol/L
The number of milliliters of NaOH required is:
V1 = M2V2/M1
= (8.00×10⁻² × 55.0)/0.049
= 89.8 mL
Therefore, to titrate 45.0 mL of 9.50×10⁻² M HNO₃ to the equivalence point, 5.34 mL of 8.00×10⁻² M NaOH is required. To titrate 35.0 mL of 8.00×10⁻² M HC₂H₃O₂ to the equivalence point, 3.50 mL of 8.00×⁻² M NaOH is required. To titrate 55.0 mL of a solution that contains 1.80 g HCl per liter to the equivalence point, 89.8 mL of 8.00×10⁻² M NaOH is required.
Learn more about equivalence point: https://brainly.com/question/29999744
#SPJ11
As the temperature of water increases its density
a. Increases
b. Decreases
c. Stays the same
Answer:
B
Explanation:
The warmer the water, the more space it takes up, and the lower its density.
Answer:
The density decreases
Explanation:
The colder the water the closer the particles move together making it denser. The hotter the water the more the particles slow down and move away from each other making the water less dense.
The earth’s magnetic poles are in the general direction of the planet’s geographic poles. However, unlike the geographic poles, the magnetic poles are not always in the same place.
As used in the text, what does the phrase "general direction" mean?
(A) different but the same exact way
(B) similar but complete opposite way
(C) similar but not the same exact way
(D) different and complete opposite way
The earth’s magnetic poles are in the general direction of the planet’s geographic poles. the phrase "general direction" mean different and complete opposite way.
What is difference between magnetic pole and geographic pole ?A bar magnet that is suspended freely will always point north-south. This is a result of the bar magnet's south pole being drawn to the Earth's magnetic north pole (geographic south).
Geographic and magnetic poles on Earth are generated by various sources, thus they are not perfectly aligned. The outer core's swirling currents of liquid iron are what generate the Earth's magnetic field.
Thus, Option D is correct.
To learn more about magnetic and geographic pole follow the link below;
https://brainly.com/question/14609670
#SPJ1
3 C₂ H₂
How many CzHg molecules are in the picture?
Answer:
i think it will 3 of each hope it helps. three molecules of each
The freezing point of water in degrees Celsius is [ Select ] __________. The freezing point of water in degrees Fahrenheit is [ Select ] __________. The freezing point of water in Kelvin is [ Select ] __________. (Use whole numerals/numbers for all choices — no letters or symbols)
Answer: 0, 32 , 273
Explanation:
The freezing point of water in degree Celsius, Fahrenheit and Kelvin are in the following order; 0 , 32 , 273
Verify that Rolle's Theorem can be applied to the function f (x) = x3 – 7x2 + 14x – 8 on the interval [1,4]. Then find all values of c in the interval such that f' (c) = 0. Enter the exact answers in increasing order. To enter Va, type sqrt(a). c= c=
Rolle's Theorem can be applied to the function f(x) = \(x^3\) - 7x² + 14x - 8 on the interval [1,4], and the values of c in the interval such that f'(c) = 0 are c = 1 and c = 2.
How Rolle's Theorem can be applied to the function?To verify that Rolle's Theorem can be applied, we need to check that f(x) is continuous on [1,4] and differentiable on (1,4). Both conditions are satisfied, so we can apply Rolle's Theorem.
By Rolle's Theorem, there exists at least one point c in (1,4) such that f'(c) = 0.
We have f'(x) = 3x² - 14x + 14, so we need to find the solutions of the equation f'(c) = 0 on the interval (1,4).
Using the quadratic formula, we get:
c = [14 ± √(14² - 4(3)(14))]/(2(3)) = [14 ± 2]/6
Thus, the solutions are c = 1 and c = 2.
Therefore, the values of c in the interval [1,4] such that f'(c) = 0 are c = 1 and c = 2.
Learn ore about Rolle's Theorem
brainly.com/question/13972986
#SPJ11
3. A substance which is made up of two are more different
elements chemically combined is known as *
A. an atom
B. a substance
C. a compound
D. a molecule
Close Interval Potential Survies involve
A) a structure-to-structure potential measurement
B) a structure-t0-electrolyte potential measurement
C) a electrolyte-to electrolyte potential measurement
CIPS involves a structure-to-electrolyte potential measurement and is an important tool for maintaining the integrity of metal structures.
Close Interval Potential Surveys (CIPS) are used to evaluate the level of protection that a cathodic protection system is providing to a structure against corrosion. CIPS involves a structure-to-electrolyte potential measurement, which is different from the options given in the question. Therefore, the correct answer would be none of the above.
In a CIPS survey, a reference electrode is placed in the electrolyte surrounding the structure and potential measurements are taken at various locations along the structure. These measurements provide information on the level of cathodic protection being provided by the system, as well as identifying areas of concern where corrosion may be occurring.
The results of a CIPS survey are used to make informed decisions about the need for maintenance or repairs to the cathodic protection system or the structure itself. It is an essential tool for preventing corrosion and extending the lifespan of metal structures in a variety of industries, including oil and gas, transportation, and infrastructure.
learn more about cathodic protection Refer: https://brainly.com/question/13031370
#SPJ11
If anyone can help with this thank you
he long run equilibrium condition for perfect competition is:
a. P=AVC=MR=MC.
b. Q=AVC=MR=MC.
c. Q=ATC=MR=MC.
d. P=ATC=MR=MC.
Option (d), P=ATC=MR=MC, accurately represents the long-run equilibrium condition for perfect competition, reflecting the balance between price and cost for firms operating in a competitive market.
The long-run equilibrium condition for perfect competition is that price (P) is equal to average total cost (ATC), which is also equal to marginal cost (MC), and marginal revenue (MR).
Option (d), P=ATC=MR=MC, best represents the long-run equilibrium condition for perfect competition. In perfect competition, firms operate at the minimum point of their average total cost curve, where price equals both average total cost and marginal cost. This condition ensures that firms are earning zero economic profit and are producing at an efficient level.
In the long run, if firms are earning economic profit, new firms will enter the market, increasing competition and driving prices down. Conversely, if firms are experiencing losses, some firms may exit the market, reducing competition and causing prices to rise. This process continues until firms reach a state where price equals average total cost, marginal cost, and marginal revenue, ensuring a long-run equilibrium.
Therefore, option (d), P=ATC=MR=MC, accurately represents the long-run equilibrium condition for perfect competition, reflecting the balance between price and cost for firms operating in a competitive market.
Know more about Equilibrium here:
https://brainly.com/question/30694482
#SPJ11
what causes the change in pressure when a basketball is pumped up?
A) the temperature of the gas changes.
B) the volume of the gas changes.
C) the number of molecules changes.
D) the energy of the molecules changes.
the correct answer is C.
The increase in pressure when a basketball is pumped up is caused by the change in the number of molecules (optionC).
When air is pumped into a basketball, the air molecules are forced into a smaller space, which increases the number of molecules in that space. This increase in the number of molecules leads to an increase in the pressure of the gas within the ball.To better understand why this is the case, we can use the ideal gas law, which describes the behavior of gases under various conditions. The ideal gas law is expressed as PV = nRT, where P is pressure, V is volume, n is the number of molecules, R is the gas constant, and T is temperature.
When air is pumped into a basketball, the volume of the ball remains the same (assuming the ball is rigid and does not expand), and the temperature of the air inside the ball does not change significantly. Therefore, according to the ideal gas law, the only way the pressure can increase is if the number of molecules (n) increases.
This increase in pressure is what makes the ball bouncy and allows it to be used for games and activities. It is important to note that overinflating a basketball can lead to a rupture or bursting of the ball due to the excessive pressure created by the increased number of molecules.
for such more questions on pressure
https://brainly.com/question/24719118
#SPJ8
Which of the following could be predicted using Dmitri Mendeleev's periodic
table?
A. Number of neutrons
B. Atomic number
C. Atomic mass
D. Isotope number
The atomic mass of elements could be predicted using Dmitri Mendeleev's periodic table.
What is the Periodic Table?The Periodic Table of elements is an arrangement of elements in groups and periods based on increasing atomic number.
The first periodic table of elements was designed by Mendeleev.
The arrangement was based on increasing atomic mass of elements.
Therefore, atomic mass of elements could be predicted using Dmitri Mendeleev's periodic table.
Learn more about Periodic Table at: https://brainly.com/question/15987580
Calculate the concentration in gdm3 of 0.85M Ammonium Carbonate solution. [C=12, N=14, H=1, N=14, 0=16]
Answer:
You need to provide a volume for the problem to be solved.
Explanation:
the reaction is exothermic in the forward direction. will an in- crease in temperature shift the position of the equi- librium toward reactants or products?
An increase in temperature will shift the position of the equilibrium toward the products.
In an exothermic reaction, heat is released as a product. According to Le Chatelier's principle, when a system at equilibrium is subjected to a change in temperature, it will shift in a direction that opposes the change. Since the reaction is already exothermic in the forward direction, an increase in temperature represents an external addition of heat. To counteract this increase in temperature, the equilibrium will shift in the endothermic direction, which is towards the products.
This shift helps to absorb the excess heat and restore equilibrium. Therefore, the increase in temperature will shift the position of the equilibrium toward the products.
You can learn more about temperature at
https://brainly.com/question/25677592
#SPJ11
In one to two sentences, describe an experiment that would show that intramolecular forces (attractions between atoms within molecules) are stronger than intermolecular forces (attractions between molecules).
thank you !!
short story about The Blind Date by Jeffrey Archer
What is the energy of light with a wavelength of 589 nm? (The speed of light in a vacuum is 3.00 x 10^8 m/s, and Planck's constant is 6.626 x 10^-34 Jos.)
A. 3.37 x 10^-19 J
B. 3.37 x 10^-28 J
C. 2.96 % 10^18 J
D. 2.96 % 10^27 J
Answer:
B
Explanation:
\(\frac{6.626\cdot10^{-34}\cdot\left(3\cdot10^{8}\right)}{589}\)= 3.37 x 10^-28 J
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
HELP ME PLEASEEEEE !!
Answer:
Explanation:
Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)
So the first letters in the sequence are ATGGG. So the pair will be TACCC.
Researchers conducted a naturalistic study of children between the ages of 5 and 7 years. The researchers visited classrooms during class party celebrations. As a measure of hyperactivity, they recorded the number of times children left their seats. The researchers found a strong positive correlation between sugary snacks offered at the parties and hyperactivity. Based on these findings, the researchers concluded that sugar causes hyperactivity.
In this case, the hypothesis may be 'sugar does not exhibit an effect on hyperactivity'. A hypothesis is a given explanation about the natural world.
Hypothesis and scientific questionsA hypothesis can be defined as a particular testable explanation about a given question that emerges by observing the natural world.
A hypothesis must be tested (either confirmed or rejected) by using the scientific method.
In this case, the dependent variable (i.e., the variable that is changed during by the independent variable) is hyperactivity.
The independent variable is the variable that isn't changed during the experimental procedure.
Learn more about the hypothesis here:
https://brainly.com/question/2695653
If you add a chunk of zinc to a beaker of acid and zinc shavings to another beaker of acid, the sample with the zinc shavings will react faster. What property causes the increase in rate?.
Answer: surface area
Explanation:
The smaller the surface area the faster the rate of reaction. The zinc shavings have a smaller surface area of reactants compared to the large piece of zinc. The smaller surfaces area of reactants ensures that it comes into close proximity with the acid solution for reaction to take place.
calculate the ph and poh of a 0.0032 M solution of nitric acid NHO3
Answer:
HNO3 ->NO3²- + H+
Concentration of H+ ions= 0.0032M
pH = - log[ H+]
= - log (0.0032)
= 2.49
pH + pOH = 14
pOH = 14 - pH
= 14 - 2.49
= 11.51
pH = 2.49 and pOH = 11.51
Hope this helps.
During a chemical reaction, reactants always
a. become more complex
b. require something to help begin the reaction
c. lose mass
d. form products
During a chemical reaction, reactants always form products.
What is a chemical reaction?When certain compounds undergo a chemical reaction, they are transformed into new substances. Reactants are the substances that initiate a chemical process. Products are the substances that are created during the process. Compounds or elements can serve as reactants and products. Chemical equations are used to describe chemical processes.
Rapid or sluggish chemical reactions are both possible.
What are Reactants?Reactants are the substances that take part in a chemical process.
Raw elements are reactants because they interact with one another. Under the proper circumstances, such as temperature, time, or pressure, the chemical bonds of the reactants are broken, and the atoms create new bonds that lead to various combinations.
In a chemical reaction,
Reactants → Products.
Therefore, reactants will always form products.
To know more about Chemical reactions, visit
https://brainly.com/question/29762834
#SPJ1
A ample of ga at 20ºC ha a volume of 10 L and exert a preure of 912 mm Hg. How many mole
of ga are in the ample?
a. 0. 3 mol c. 0. 8 mol
b. 0. 5 mol d. 1. 00 mol
The Number of moles present is 0.5mol.
What is ideal gas law?
The general gas equation, also known as the ideal gas law, is the equation of state for a fictitious ideal gas. The equation for the ideal gas's relationship to pressure P, volume V, temperature T, and number of moles n is known as the ideal gas law.
Use P V = n R T
R = 0.08206 L -atm /mol -K when the pressure is in atmosphere atm, the volume is in litres L, and the temperature is in Kelvin K.
One atm is equal to 760.0 mm Hg, so depending on how the pressure changes, there will either be a division or multiplication.
Divide the value in mmHg by 760.0 mmHg/atm to convert it to atm.
P= 912mmHg /760mmHg/atm=1.2atm
to convert °C to kelvin,
K=°C +273= 20+273=293K
R=0.08206
Add these values to given equation,
n=PV/RT
= 1.2×10÷0.08206×293
= 12÷24.02
=0.5mol
To learn more about ideal gas law
https://brainly.com/question/27870704
#SPJ4
fungi have eukaryotic cells (large cells with a nucleus), like animals and plants
True or false?
Leon made a study chart about human-induced changes to
the environment.
Which headings best complete the chart?
Environmental Changes Caused by Humans
X: Habitat Destruction
Y: Pollution
Y
Results from
introducing harmful
substances into the
Results from natural areas
being cleared and replaced
by human development
© X: Long-Term Changes
Y: Short-Term Changes
X: Short-Term Changes
Y: Long-Term Changes
0 X: Pollution
Y: Habitat Destruction
environment
Example: deforestation
Example: oil spill
The question was not well arranged above. It has been arranged in the answer below.
Question:
Leon made a study chart about human-induced changes to the environment.
Environmental Changes Caused by Humans
X Y
Results from introducing harmful substances into the environment
Example: oil spill
Results from natural areas being cleared and replaced by human development
Example: deforestation
Which headings best complete the chart?
X: Habitat Destruction
Y: Pollution
X: Long-Term Changes
Y: Short-Term Changes
X: Short-Term Changes
Y: Long-Term Changes
X: Pollution
Y: Habitat Destruction
Answer:
X: Pollution
Y: Habitat Destruction
Explanation:
From the above question, Leon gave us two variables, X and Y.
The human induced changes were divided into two.
1. Results from introducing harmful substances into the environment
Introducing harmful substances into the environment is also called pollution. And we can represent this as X which is the first variable.
2. Results from natural areas being cleared and replaced by human development.
This description given in number two above whereby land areas are been cleared and replaced by human development has a negative effects on the environment because the vegetation which includes the trees are been cut down and living organisms(animals) will go extinct gradually. This act affect the balance of the ecosystem and it can be referred to as the destruction of the habitat of living organisms
Therefore, the correct headings best complete the chart is :
X: Pollution
Y: Habitat Destruction
Answer:
what the top person said
Explanation:
☺