Phenylalaine metabolite will build up if a person acquires two mutant genes for hydroxyphenylpyruvate oxidase.
The metabolite in a positive drug is what?When a drug breaks down inside the body, a metabolite is created. In essence, it denotes the transformation of the original medication into a different substance. Drug tests involving cannabis are meant to find THC intermediates since they last in the body considerably longer than THC does.
Where can I find metabolites?Metabolites are the by products of enzymatic pathways that are catalysed by numerous enzymes found in cells. Although it is frequently used to describe larger entities, this phrase is mostly used to describe tiny molecules.
To know more about metabolites visit:
https://brainly.com/question/15094735
#SPJ4
which part of the cell closes a wound
Is vegetable oil a carbohydrate, protein, or lipid or none of the above? if not explain why?
Answer:
lipid
Explanation:
vegetable oils are 100% fats, and contain no protein or carbohydrates.
Vegetables oils are lipids in nature.
What are the functions of lipids?Fats, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, phospholipids, and other naturally occurring molecules are included in the large class of molecules known as lipids.
Lipids are fatty substances that have many different jobs to do in your body. They are a component of your cell membranes and aid in regulating what enters and exits your cells. They aid in producing hormones, absorbing vitamins, and transporting and storing energy.
Lipids serve the body's needs for energy storage, hormone regulation, nerve impulse transmission, protection of sensitive organs, and the transportation of fat-soluble nutrients.
Learn more about lipids:
https://brainly.com/question/3498396
#SPJ2
The hiv virus attacks only a certain type of white blood cells, and not other cell types. Why?.
The HIV virus specifically targets a type of white blood cell called a CD4+ T cell, which is important for the body's immune system.
What is HIV virus?
HIV (human immunodeficiency virus) is a virus that attacks our immune system, the body’s natural defense against illness. HIV is a sexually transmitted infection (STI) and it can also be spread through contact with infected blood or from mother to child during pregnancy, childbirth, or breastfeeding. HIV weakens a person’s ability to fight infections and diseases, and without treatment, it can eventually lead to AIDS (acquired immunodeficiency syndrome).
HIV works by binding to proteins on the surface of these cells, known as CD4 and CCR5, that act as receptors for the virus. This allows the virus to enter inside the cell and infect it. Once inside, it uses the cell's machinery to replicate and spread throughout the body. By specifically targeting these specific types of white blood cells, HIV is able to spread more efficiently and cause more damage to the body's immune system.
To know more about HIV (human immunodeficiency virus),
LINK- https://brainly.com/question/8937184
CODE- #SPJ4
Describes long term ecological stability and human progress and defines whether a process can be continued indefinitely.
Sustainability describes long-term ecological stability and human progress and defines whether a process can be continued indefinitely.
This is because sustainability is a search for ecological stability and human progress that can last over the long term and this helps an eco system or process to be self-regenerating.
What is an Ecosystem?This refers to the biological community that has to do with the interaction of organisms and their immediate environment and surroundings.
Hence, we can see that Sustainability describes long-term ecological stability and human progress and defines whether a process can be continued indefinitely.
This is because sustainability is a search for ecological stability and human progress that can last over the long term and this helps an ecosystem or process to be self-regenerating.
Read more about ecological stability here:
https://brainly.com/question/1296107
#SPJ1
The organelles that allow a unicellular paramecium to sweep food toward its mouthlike opening are called____
How does ovolution lead to both biodiversity and commonalities among
life?
Answer:
Evolution leads to biodiversity by changing the genetic code of organisms. When evolution leads to biodiversoty its called natural selection. It slowly decreases the popluation of organisms that are less adapted to survive in the world, and increas the population of more strong and adaptable organisms.
For example if there is a pink bird and a white bird, the white bird's population will increase due to its adaptation of camoflauge, and the pink bird will die out because it will be spotted by predators easily. Therefore the species of the white bird will become more common
Explanation:
the drug is absorbed or taken into the blood- stream by the capillaries from an area of higher concentration to an area of lower concentration. this process of diffusion is a
The drug is absorbed or taken into the bloodstream by the capillaries from an area of higher concentration to an area of lower concentration. this process of diffusion is a Passive transport.
A type of membrane transport called passive transport moves materials across cell membranes without the use of energy. Active transport uses cellular energy to transfer materials across cell membranes, whereas passive transport uses the second law of thermodynamics.
Passive transport is a phenomena that happens naturally and doesn't require the cell to use energy to move. Diffusion is the process by which chemicals travel passively from a region of higher concentration to a region of lower concentration.
The rate of diffusion is influenced by the gradient in concentration, the size of the diffusing particles, and the system temperature.
To know more about passive transport visit the link:
https://brainly.com/question/13542102?referrer=searchResults
#SPJ4
How does the human immune system destroy a pathogen in the body?A. B cells release antibodies that neutralize the pathogen.B. Antibiotics are released by B cells to destroy the pathogen.C. Lymphocytes recognizes pathogens as antigens in the body.D. T cells build immunity to the pathogen by releasing antibodies.
T cells are important to our immune system, but they do not release antibodies. They activate B cells and cytotoxic T lymphocytes to kill cells that are infected. Therefore, D is incorrect.
Antibiotics are not produced by our immune system. They can be found in nature or synthesized in labs. Therefore, B is incorrect too.
Lymphocytes are divided into T and B cells. B lymphocytes release antibodies that will recognize pathogens and bind to them, but T cells doesn't work like that. Lymphocyts does not recognize pathogens and C is incorrect as well.
B cells create antibodies, release them and they will bind to pathogens to neutralize them. Therefore, the correct answer is A. B cells release antibodies that neutralize the pathogen.
Why are spores important to plants like mosses and ferns?
Please help.
Explanation:
Well spore's producing plants consists of plants such as mosses and ferns. The plants that make spores produce huge load of them. Because they are so small and weight-less, they can be spread over a large area by the wind to new locations where they can grow.
do elements form chemical compounds to become more or less stable
What effect does increased carbon dioxide
have on global temperatures? (two complete
sentences minimum)
Answer:
Carbon dioxide increases temperatures, extending the growing season and increasing humidity. Both factors have led to some additional plant growth. However, warmer temperatures also stress plants. With a longer, warmer growing season, plants need more water to survive.
Explanation:
20. True or False: If there is more friction, rivers flow faster and there is less erosion.
21. True or False: Glaciers are masses of ice that move slowly over the land.
22. True or False: Valley Glaciers are between two mountains.
23. True or False:
Glaciers do not move with the force of gravity.
Glaciers form due to the force of pressure. The snow and ice compact
24. True or False:
force.
25. Materials are picked up by a glacier in a process called
26. Explain the relation of Till, Moraine and Drumlin.
Answer: Make sure to read the explanation for more information
20. False
21. True
22. True
23. False
24. (?)
25. Plucking/entrainment
26. read explanation
Explanation:
20. If there is more friction, rivers flow slower and there is more erosion. Friction between the water and the riverbed slows down the flow of water, which can cause sediment to be deposited and lead to erosion. In fact, a lack of friction can cause fast-moving water to erode the riverbed and banks more quickly.
21. Glaciers are masses of ice that move slowly over the land due to gravity. They form when snow accumulates over time, compresses, and recrystallizes into ice. Glaciers can be found in many parts of the world, from polar regions to high mountains, and they play an important role in shaping the landscape and influencing the climate.
22. Valley glaciers are also known as alpine glaciers, and they form in mountain valleys or on the sides of mountains. They flow downhill between two mountain peaks and can carve out U-shaped valleys as they move. Valley glaciers are typically smaller than continental glaciers, which cover entire land masses, and they are found in many mountainous regions around the world.
23. Glaciers do move with the force of gravity. The weight of the ice causes it to flow downhill, following the path of least resistance.
24. missing question?
25. Materials are picked up by a glacier in a process called "plucking" or "entrainment". As a glacier moves, it can pick up rocks, soil, and other debris, incorporating them into the ice. This material can then be transported and deposited elsewhere as the glacier melts.
26. Till, moraine, and drumlin are all features that are associated with glaciation. Till refers to the unsorted mixture of sediment that is left behind by a retreating glacier. Moraine is a ridge or mound of sediment that is also left behind by a glacier, and it can form at the edge of the glacier or in the middle of it. Drumlin is a type of hill that is formed by the movement of a glacier and is usually elongated in the direction of ice flow. Till can contribute to the formation of moraines and drumlins, which are both composed of sediment that was picked up and transported by a glacier.
the double coiled, staircase shape of dna is called a
The double coiled staircase shape of DNA is called a double helix .
The DNA double helix biopolymer of nucleic acid is held together by nucleotides which base pair together. In B-DNA, the most common double helical structure found in nature, the double helix is right-handed with about 10–10.5 base pairs per turn. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. Duplication of the genetic information occurs by the use of one DNA strand as a template for formation of a complementary strand . DNA is a double helix formed by base pairs attached to a sugar-phosphate backbone. The double helix of DNA has these features: It contains two polynucleotide strands wound around each other. The backbone of each consists of alternating deoxyribose and phosphate groups. Each chromosome is made up of DNA tightly coiled many times around proteins called histones that support its structure. DNA in each human cell is packaged into 46 chromosomes arranged into 23 pairs.
Learn more about double coiled here:
https://brainly.com/question/11049878
#SPJ4
The genetic information for making a protein must move from the nucleus to the cytoplasm. Which of these moves this information to the cytoplasm?
a
tRNA
b
mRNA
c
DNA
d
rRNA
Answer:
B
Explanation:
The type of RNA that contains the information for making a protein is called messenger RNA (mRNA) because it carries the information, or message, from the DNA out of the nucleus into the cytoplasm. Translation, the second step in getting from a gene to a protein, takes place in the cytoplasm.
what factors can change the population size?
Answer:
Birth rate, death rate, and immigration of foreign species
Which two statements explain why water is vital to sustaining a healthy ecosystem?
A. Water enables energy to move through all of Earth's systems.
B. Autotrophs need water in order to make oxygen gas and sugars from inorganic matter.
C. Water molecules consist of atoms of hydrogen and oxygen.
D. All of Earth's heterotrophs depend on water as a source of energy for life processes.
The statements autotrophs need water in order to make oxygen gas and sugars from inorganic matter and all of Earth's heterotrophs depend on water as a source of energy for life processes explain why water is vital to sustaining a healthy ecosystem (Options B and D).
Why water is fundamental to sustaining life on earth?Water is fundamental to sustaining life on earth because all organisms are mostly composed of water, which is primarily used during photosynthesis in order to generate sugar molecules.
Therefore, with this data, we can see that water is a fundamental element capable of sustaining life on earth.
Learn more about water and life on earth here:
https://brainly.com/question/26307393
#SPJ1
Answer:
a and b
Explanation:
I got it correct thank you
in meiosis shown in the image, homologous chromosomes separate in step a, which is called ______, and four haploid nuclei are formed in step b, which is called ______.
In meiosis, homologous chromosomes separate in step a, which is called "anaphase I," and four haploid nuclei are formed in step b, which is called "cytokinesis II."
During anaphase I of meiosis, homologous chromosomes, which consist of one chromosome from each parent, separate and move toward opposite poles of the cell. This ensures that each resulting cell receives only one copy of each chromosome pair.
Anaphase I is a crucial step in meiosis as it ensures the distribution of genetic material between the daughter cells is randomized and contributes to genetic diversity.
Following anaphase I, the cell enters cytokinesis II, the second stage of cell division in meiosis. Cytokinesis II involves the physical separation of the two cells formed after anaphase I, resulting in the formation of four haploid nuclei, each containing a single set of chromosomes.
These nuclei go on to further undergo a process called "telophase II" to form four distinct haploid cells, known as gametes, which are essential for sexual reproduction.
To learn more about meiosis, click on:
brainly.com/question/7002092
#SPJ11
You just drank a 44 ounce dirty soda (maybe the Shark Attack) at Swig. Your objectives: . Absorb this "food" at the intestine and move the major macronutrient into the bloodstream. Move the MAJOR macronutrient into a non-intestinal cell AND catabolize it to generate ATP. . Store the excess nutrients to maintain homeostasis levels of blood glucose. In your answer, you'll need to discuss o How you get it into the body: Specific breakdown and absorption mechanism for the nutrient into cells lining the intestine prior to the nutrient moving into the bloodstream (circulation follows, but you do not need to discuss that process) How you get it into the cell that needs it: Transport mechanism into (non-intestinal) cell prior to catabolism How you use it: Catabolism of the macronutrient (for generation of ATP) . What you do with the excess: Storage of excess nutrients (with sites of storage) How you control blood plasma nutrient levels: Restoration of homeostatic blood glucose levels (with a discussion of type of homeostatic regulation). Include the specific hormone(s) involved
To absorb the macronutrient from the dirty soda, the intestine utilizes specific breakdown enzymes and transporters on the cell membranes of intestinal cells.
How is this so?Once absorbed, the macronutrient is transported into non-intestinal cells via facilitated diffusion or active transport.
Within the cell,the macronutrient undergoes catabolism through metabolic pathways such as glycolysis or beta-oxidation, generating ATP for cellular energy.
Excess nutrients are stored in various sites, such as liver (glycogen) or adipose tissue (triglycerides),to maintain blood glucose levels.
Blood plasma nutrient levels are regulated through homeostatic mechanisms,primarily controlled by the hormone insulin.
Learn more about macronutrient at:
https://brainly.com/question/3313290
#SPJ4
If the data does NOT support your hypothesis, you can consider your experiment a failure. (True/false)
A. True
B. False
Answer:
False
Explanation:
If the data does not support your hypothesis you reject your hypothesis. The information given to you by your data can still be extremely useful in carrying out a new and improved version of the experiment or research and therefore by no means a failure.
Some of the greatest minds and most celebrated scientists came across their discoveries either through error or through reapplying new techniques that were developed through data that didn't support their hypothesis.
identify the muscles as voluntary, involuntary or both!
Answer: The skeletal muscles are considered as the voluntary muscles
Explanation:
Answer:
Voluntary, Involuntary Involuntary
Explanation:
Help due today "Brainly Est for only correct answer"
when it exists within the environment inside a living cell
How much energy is lost at each level or organization
Who first recognized the cell as the universal unit of life
Answer:
The cell was first recognized by Robert Hooke
place the following steps of polysaccharide chain cleavage by lysozyme into the correct order. 1) Lysozyme and products dissociate 2) Lysozyme and substrate form an enzyme-substrate complex, forcing one sugar molecule into a strained conformation. 3) Glutamic acid donates a proton to one sugar as aspartic acid attacks the C1 carbon of a second sugar. 4) Glutamic acid donates a proton to one sugar as aspartic acid attacks the C1 carbon of a second sugar. 5) The water oxygen attacks the C1 carbon, breaking the sugar- aspartate bond. 6)Glutamic acid polarizes a water molecule, drawing a proton away from the water. 7) A covalent bond forms between the aspartic acid and the sugar, and the sugar-sugar bond is hydrolyzed.
Lysozyme and substrate form an enzyme-substrate complex, forcing one sugar molecule into a strained conformation. Glutamic acid donates a proton to one sugar as aspartic acid attacks the C1 carbon of a second sugar.
A covalent bond forms between the aspartic acid and the sugar, and the sugar-sugar bond is hydrolyzed. The water oxygen attacks the C1 carbon, breaking the sugar-aspartate bond. Glutamic acid polarizes a water molecule, drawing a proton away from the water. Lysozyme and products dissociate. The correct order of steps of polysaccharide chain cleavage by lysozyme are as follows: Lysozyme and substrate form an enzyme-substrate complex, forcing one sugar molecule into a strained conformation. Glutamic acid donates a proton to one sugar as aspartic acid attacks the C1 carbon of a second sugar.
A covalent bond forms between the aspartic acid and the sugar, and the sugar-sugar bond is hydrolyzed. The water oxygen attacks the C1 carbon, breaking the sugar-aspartate bond. Glutamic acid polarizes a water molecule, drawing a proton away from the water. Lysozyme and products dissociate. Lysozyme is an enzyme that breaks down glycosidic bonds in bacterial cell walls. The enzyme binds to a sugar molecule in the substrate and rearranges it into a strained conformation when it binds to it .The enzyme's glutamic acid donates a proton to one sugar in the substrate, while its aspartic acid attacks the C1 carbon of a second sugar. A covalent bond forms between the aspartic acid and the sugar, breaking the sugar-sugar bond.
To know more about Lysozyme visit:
https://brainly.com/question/31868978
#SPJ11
what are the similarities between this activity and actual mitosis
The DNA within a cell is duplicated during both meiosis and mitosis. Two sister chromatids are produced for each chromosome as a result of the replication and continued joining of each DNA strand, or chromosome.
What is mitosis?Mitosis is defined as the cell-division process in which the chromosomes multiply and are equally distributed between the two daughter cells. Prophase, Prometaphase, Metaphase, Anaphase, and Telophase are the five stages that make up mitosis. Meiosis is defined as a process by which a single cell undergoes two divisions, resulting in four cells with half the original genetic material.
Cell division occurs during meiosis as well as mitosis. The M-phase of the cell cycle is where both processes take place. The prophase, metaphase, anaphase, and telophase stages are typical for both cycles. DNA synthesis occurs during both cycles. A common goal of meiosis and mitosis is the division of the nucleus and its DNA into two daughter cells.
Thus, the DNA within a cell is duplicated during both meiosis and mitosis. Two sister chromatids are produced for each chromosome as a result of the replication and continued joining of each DNA strand, or chromosome.
To learn more about meiosis and mitosis, refer to the link below:
https://brainly.com/question/20726356
#SPJ5
Consider the following two statements about succession.
Student 1:
Matthew - As succession begins, communities tend to be dominated by mostly K-selected species. As succession continues, r-selected species tend to compete better and therefore become more and more common.
Student 2:
Iman - As succession begins, communities tend to be dominated by mostly r-selected species. As succession continues, K-selected species tend to compete better and therefore become more and more common.
Which student is correct?
a. Provide a rationale for your answer (2 marks)
b. Provide a specific example of succession which includes at least one example of an r-selected and one example of a K-selected species. (1 mark)
Note - No marks are earned by simply agreeing with either Matthew or Iman
Which term identifies the cell’s ability to maintain its internal conditions? transport diffusion osmosis homeostasis
Answer: Homeostasis
Explanation: The process of homeostasis is when self-regulation occurs in order to keep balance while adapting to changes.
Answer:
homeostasis
Explanation:
I got the question right
Transcribed image text: 62. The parathyroid gland is able to sense when blood calcium levels are low and secrete PTH to act on various target tissues to increase calcium levels. This homeostatic control system is important because calcium is necessary for many physiological processes. Which of the following would NOT be impaired by low blood calcium levels? (In other words, which of the following processes do NOT require calcium?) a. Repolarization of a neuron's plasma membrane during action potentials b. Exocytosis of neurotransmitters from axon terminals c. Smooth muscle contraction d. Gland secretions e. Exocytosis of neurotransmitters from varicosities in the ANS 63. What structures are specialized to detect a specific form of energy in the external or internal environment and transduce it into a graded potential? a. Nociceptors b. Photoreceptors c. Rods d. Primary cortex e. Sensory receptors 64. What best describes the concept of dual innervation? a. Most viscera are regulated by both the endocrine system and autonomic nervous system Most viscera only receive innervation by one of the two divisions of the autonomic nervous system Most viscera are innervated by both the somatic motor division and the autonomic nervous system d. Most viscera are innervated by both the parasympathetic division and sympathetic division of the autonomic nervous system e. None of the other answers are correct b. C. 65. The resting membrane potential is established mainly from the diffusion of: a. Potassium ions through voltage-gated channels b. Sodium ions through voltage-gated channels c. Sodium ions through leak channels d. Potassium ions through leak channels e. Calcium ions through leak channels 66. The rapid depolarization phase of an action potential is due to the movement of: a. Chloride ions through voltage-gated channels b. Sodium ions through voltage-gated channels c. Potassium ions through voltage-gated channels d. Potassium ions through leak channels e. Sodium ions through leak channels 67. Neurotransmitters (NT) bind to receptors on postsynaptic neurons and cause ion channels to open or close. How does this affect the postsynaptic neuron? a. NT binding changes the membrane potential and create either a depolarizing or hyperpolarizing graded potential b. NT binding will always trigger an action potential C. NT binding will always make the membrane potential more positive and create a depolarizing graded potential d. NT binding will always make the membrane potential more negative and create a hyperpolarizing graded potential e. NT binding activates second messengers only and does not affect membrane potential
62. The process that does NOT require calcium is repolarization of a neuron's plasma membrane during action potentials.
a. Repolarization is the stage of an action potential in which the membrane potential returns to its resting state by either potassium ions flowing out or chloride ions flowing in. The reason for this is that it does not need calcium because the movement of potassium ions is regulated by potassium channels.
b. Exocytosis of neurotransmitters from axon terminals requires calcium ions to enter the axon terminal from the extracellular fluid, leading to fusion of vesicles with the presynaptic membrane and the release of neurotransmitters.
c. Smooth muscle contraction requires calcium ions to bind with calmodulin, which then activates myosin light-chain kinase, resulting in the phosphorylation of myosin.
d. Gland secretions are stimulated by various factors, including calcium ions that play a role in the release of certain hormones.
e. Exocytosis of neurotransmitters from varicosities in the ANS requires calcium ions to enter the varicosity, leading to the fusion of vesicles with the plasma membrane.
63. Sensory receptors are specialized structures that detect a specific form of energy in the external or internal environment and transduce it into a graded potential. Photoreceptors are sensory receptors in the retina that detect light energy, whereas nociceptors are sensory receptors in the skin that detect pain. Rods are photoreceptor cells in the retina that detect light under low-light conditions. The primary cortex is the region of the brain that receives and processes sensory input from sensory receptors.
64. Dual innervation is the concept that most viscera are innervated by both the sympathetic and parasympathetic divisions of the autonomic nervous system. These two divisions have opposing effects on the same organ, allowing for fine control of the organ's activity. Some examples include the heart, which is innervated by both the sympathetic and parasympathetic divisions, and the gastrointestinal tract, which is innervated by both divisions as well.
a. Most viscera are regulated by both the endocrine system and autonomic nervous system,
b. Most viscera only receive innervation by one of the two divisions of the autonomic nervous system,
c. Most viscera are innervated by both the somatic motor division and the autonomic nervous system.
e. None of the other answers are correct are incorrect.
65. The resting membrane potential is established mainly from the diffusion of potassium ions through leak channels. The resting membrane potential is the voltage difference between the inside and outside of a cell when it is not being stimulated. This potential is established by the movement of ions through ion channels in the plasma membrane. Potassium ions are the most important ions involved in generating the resting membrane potential because the cell is more permeable to potassium than any other ion.
a. Sodium ions through voltage-gated channels,
b. Potassium ions through voltage-gated channels,
c. Sodium ions through leak channels,
d. Calcium ions through leak channels, and
e. Calcium ions through voltage-gated channels are incorrect because only a few ions can diffuse through leak channels, and voltage-gated channels are activated by changes in membrane potential, not by concentration gradients.
66. The rapid depolarization phase of an action potential is due to the movement of sodium ions through voltage-gated channels. The rapid depolarization phase of an action potential is characterized by a rapid increase in membrane potential due to the influx of positively charged ions into the cell. This influx of ions is mainly due to the opening of voltage-gated sodium channels in the plasma membrane. Chloride ions, potassium ions, and sodium ions through leak channels are not responsible for the rapid depolarization phase of an action potential.
67. Neurotransmitters (NT) bind to receptors on postsynaptic neurons and cause ion channels to open or close. This affects the postsynaptic neuron because NT binding changes the membrane potential and creates either a depolarizing or hyperpolarizing graded potential. The effect of NT on the postsynaptic neuron depends on the type of receptor it binds to. Some receptors are ligand-gated ion channels that directly open or close ion channels, while others are G protein-coupled receptors that activate intracellular signaling pathways.
About CalciumCalcium or lime is a chemical element with the symbol Ca and atomic number 20. As an alkaline earth metal, calcium is a reactive metal that forms a dark nitride-oxide layer when exposed to air. Its physical and chemical properties are most similar to its heavier homologs strontium and barium.
Learn More About Calcium at https://brainly.com/question/26636816
#SPJ11
slow oxidative muscle fibers are best suited for . slow oxidative muscle fibers are best suited for . hitting a baseball running a marathon running a 100-yard dash lifting heavy weights at the gym
Slow oxidative muscle fibers are best suited for running a marathon. Option C.
The ability of slowly oxidizing fibers to function for extended periods of time without fatigue helps maintain posture generate isometric contractions, and stabilize bones and joints. Slow-oxidizing fibers are ideal for long-term energy expenditure and repetitive muscle contractions. These fibers are ideal for long-distance runners such as cross-country athletes.
It has many mitochondria and its main energy source is aerobic metabolism. It is the most fatigue-resistant and efficient fiber type. Slow-oxidizing fibers contract relatively slowly and use aerobic respiration oxygen and glucose to generate ATP. Fast oxidation fibers contract faster and primarily use aerobic respiration, but can switch to anaerobic respiration glycolysis and thus tire faster than SO fibers.
Learn more about Slow oxidative here:-https://brainly.com/question/15055103
#SPJ4
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?
a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.