Identify the terms, coefficients, and constants in the expression.
7h + 3
I need help now!!!!!

Answers

Answer 1

Step-by-step explanation:

7 is the coeffiecient

3 is the constant


Related Questions

PLEASE I WILL GIVE BRAINlEST ANSWER
"I’m thinking of a number. When I divide my number by four and add seven I get thirteen."


What’s my number? Show your work and explain how you know your answer is correct.

Answers

Answer:

The number is 24

Step-by-step explanation:

This can be written algebraically as:  \(\frac{x}{4}+7=13\)

Solve for x, in which the steps are shown below.

Thanks for the question! :)

PLEASE I WILL GIVE BRAINlEST ANSWER "Im thinking of a number. When I divide my number by four and add

Write the sum of the circumferences of all three circles in factored form.

Write the sum of the circumferences of all three circles in factored form.

Answers

Answer:

2π(x+y+z)

is the factorization

Tamika has $800 to spend at a bicycle store for some new gear and biking outfits. Assume all prices listed include tax.
She buys a new bicycle for $482.62.
She buys 3 bicycle reflectors for $10.84 each and a pair of bike gloves for $24.49.
She plans to spend some or all of the money she has left to buy new biking outfits for $52.93 each.

Which inequality can be used to determine o, the maximum number of outfits Tamika can purchase while staying within her budget?

Answers

The inequality that can be used to determine x, the number of outfits Tamika can purchase is; 539.63+ 52.93x ≤ 800

The given parameters are:

Budget = $800

New bicycle = $482.62

3 bicycle reflectors = $10.84 each

Pair of a bike gloves = $24.49.

New biking outfits = $52.93each.

Let the number of new biking outfits be x So, we have;

New bicycle + 3 . price of bicycle reflectors + Pair of a bike gloves + New biking outfits <= Budget

This gives;

482.62 + 3( 10.84) + 24.49+ 52.93x ≤ 800

This gives;

539.63+ 52.93x ≤ 800

Solve the inequality;

52.93x ≤ 260.37

Divide by 52.93

x ≤  4.91

Hence, the inequality is 539.63+ 52.93x ≤ 800

Read more about inequality at

brainly.com/question/24372553

#SPJ1

f
3
+ 22 = 17
- 22 - 22 +
43
f = -5
3
= 3(-5)
f =
Subtract 22 on both sides.
Multiply by 3 on both sides.

Answers

On solving the provided question, by the help of BODMAS we can say that - Subtract 22 from both sides is the answer to the given question.

What is BODMAS?


BODMAS and PEDMAS are both names for it in various places. This stands for exponents, parenthesis, division, multiplication, addition, and subtraction. The BODMAS rule states that parentheses must be answered before powers or roots (that is, of), divisions, multiplications, additions, and lastly subtractions. The BODMAS rule states that the degree (52 = 25), parenthesis (2 + 4 = 6), any division or multiplication (3 x 6 (bracket response) = 18), and any addition or subtraction (18 + 25 = 43) come before any other operations.

\(f/3 +22 = 17\)

\(f/3 +22 -22 = 17 -22\) Subtracting the same value from both sides keeps the equation equal.  

Then simplify. The \(+22 and -22= 0\) They "cancel"   \(17-22 = -5\)

\(f/3 = -17 f/3\) is now isolated-- by itself-- in the equation.

If we have to solve  f, the next step we to take is to multiply on the both sides by  3.

To know more about BODMAS visit:
https://brainly.com/question/29795897

#SPJ1

3) 15x + 4 = 106


Can someone show me the steps ? Pls :)

Answers

1) Subtract 4 from both sides to get 15x = 102

2) Divide by 15 on both sides to get x = 6.8

Answer:

x=6.8

Step-by-step explanation:

15x + 4 = 106

subtract 4 from both sides

15x=102

divide both sides by 15

x=6.8

A driver was fined for speeding in 100km/h zone driving 14km in 7m
Calculate the average speed of the car

Answers

Answer:

120km/h

Step-by-step explanation:

Distance=14km

Time       =7m

A driver was fined for speeding in 100km/h

∴ we convert time into hours

Time =(7/60)h

Average speed of the car = total distance ÷total time

                                           =14km×60/7h=120km/h which is greater than                          

                                                                                                        100km/h

Question 1

Upon retirement your mother received E 500, 000 lump sum. She expect to live for the next 15 years and will only depend on the retirement fund for income. Her bank offers 12% interest per annum. Advise your mother on how much she should withdraw from her bank at the end of each year for the duration of the desired life span? [10 marks]​

Answers

Answer:

You'll need to look at the attached formula.

Annual Payout = 500,000 * .12 * (1.12)^15 / [(1.12)^15  -1]

Annual Payout = 500,000 * .12 * 5.4735657593 / [ 5.4735657593 -1]

Annual Payout = 500,000 * .12 * 5.4735657593 / [4.4735657593]

Annual Payout = 60,000 * 5.4735657593 / [4.4735657593]

Annual Payout = 73,412.12

Source: http://www.1728.org/annupay.htm

That's a LOT of calculating :-)

Step-by-step explanation:

Question 1Upon retirement your mother received E 500, 000 lump sum. She expect to live for the next 15

Simplify the following expression:
√-36+√-100+ 7
O A. 7+ 16i
OB. 7+√136i
O C. 16
C. 16 - 7i
O D. 23 + 0i

Answers

The expression is:


√-36 + √-100 + 7


To simplify this expression, we need to first remove the negative radicals. We can do this by squaring both sides of the equation:


√-36 = -6
√-100 = -10


Substituting these values back into the expression, we get:


-6 + -10 + 7 = -19 + 7 = -12


So, the simplified expression is:


-12


Since the expression is already in its simplified form, there is no need to factor it further.

Every day, two student council members are randomly chosen to read the morning announcements. Students cannot be chosen more than once to read the announcements. Jeremy designed a simulation for the selection of the students and gathered data to predict the probability that a seventh grade student will be chosen. In Jeremy’s simulation, he rolls two number cubes in each of 40 trials. In each trial, a cube landing on 1 or 2 represents a student in grade 7 being selected, and a cube landing on 3, 4, 5, or 6 represents a student in grade 8.

Answers

Complete Question

The table shows the number of grade 7 and grade 8 students on the student council at Jeremy’s school.

Number of Students

Grade 7 - 17 Grade 8 - 34

Answer:

C- The number of outcomes representing each grade level does not change after the first student is chosen.

Step-by-step explanation:

The ratio of Grade 7 students to Grade 8 students is:

17:34

This written in reduced form is 1:2

Therefore, initially, the six parts of the cube can be divided into the ratio 2:4 which Jeremy did.

However, after the first selection of a student, the ratio of Grade 7:Grade 8 student changes since the same student cannot be chosen more than once.

Therefore the cube rolls represent only the first student choice and may not be accurate for subsequent rolls.

The correct option is C.

Answer:

The answer should be C

Step-by-step explanation:

HELP!!!!!!! MATH QUESTION FOR 40) POINTS!!!!!!
Abe is buying wrapping paper.
He is shopping for the best deal.

Drag the rolls of wrapping paper in order from the least to the greatest unit cost in dollars per square foot. (Just put from least to greatest)

Red: 12.5 square feet for $1.79
Blue: 40 square feet for $5.29
Green: 50 square feet for $8.49
Orange: 60 square feet for $6.00​

Answers

Answer:

1)Green

2)Red

3)Blue

4)Orange

Two angles are supplementary. The measure of the smaller angle is four more than one third the measure of the larger angle. The measure of the larger angle is

Answers

Answer:

132

Step-by-step explanation:

2 Angles are supplementary:

x + y = 180

The smaller angle is four more than one third of other:

y = 1/3x + 4

Plug in y into the original equation:

x + 1/3x + 4 = 180

Solve the equation:

4/3x = 176

x = 176 * 3/4

x = 132

y = 48

x is the larger angle so 132 is the answer

The measure of smaller and larger angles will be 48 degrees and 132 degrees, respectively.

Given information:

The two angles are supplementary. Let them be x (larger) and y (smaller).

The measure of the smaller angle is four more than one-third the measure of the larger angle.

The above condition can be written as,

\(y=4+\dfrac{ x}{3}\)

Supplementary angles are the angles whose sum of measure is equal to 180 degrees.

So, \(x+y=180\)

Solve the above two equations as,

\(x+y=180\\x+(4+\dfrac{ x}{3})=180\\\dfrac{4x}{3}=176\\x=176\times \dfrac{3}{4}\\x=132\\y=48\)

Therefore, the measure of smaller and larger angles will be 48 degrees and 132 degrees, respectively.

For more details, refer to the link:

https://brainly.com/question/19281924

If 2/5 of all books at a library are nonfiction and 1/5 of the nonfiction books are biographies, then what fraction of the library's books are nonfiction biographies?

Answers

The fraction of the library's books are nonfiction biographies is 2/25.

How to find fraction of the library's books are nonfiction biographies?

This fraction here describes the quantities of books within the library which are nonfiction biographies. It is given below:

Number of nonfiction books at a library = 2/5Number of biographies = 1/5 of nonfiction books

The fraction of the library's books are nonfiction biographies = Number of biographies × Number of nonfiction books at a library

= 1/5 × 2/5

= (1 × 2) / (5 × 5)

= 2/25

So therefore, the fraction of the library's books are nonfiction biographies is 2/25.

Read more on fraction:

https://brainly.com/question/11562149

#SPJ1

For f(x)=3x -1 and g(x) = x+2 find (f-g)

Answers

Answer:

(f - g) = 2x - 3

Step-by-step explanation:

Simply distribute the negative and add like terms together:

(f - g) = 3x - 1 - (x + 2)

(f - g) = 3x - 1 - x - 2

(f - g) = 2x -  3

can you help me with this question

can you help me with this question

Answers

Answer:

Steps-by-step explanation:

So first you have to set the equation = 0

5c^2 - 26c - 24 = 0

Now you need to fact the equation.

You should get.

(5c + 4)(c - 6) = 0

After this you solve both equations:

5c + 4 = 0

5c = -4

c = -4/5

Then the next one.

c - 6 = 0

c = 6

And there is your answer

c = -4/5 and c= 6

2. En un concierto hay 432 personas. Si sabemos que hay 48 mujeres más que hombres,
¿Cuántos hombres y cuántas mujeres hay?

Answers

m = 48+x
h=x
x+48+x = 432
2x +48= 432
x=192
mujeres =240
hombres= 192

What is the value

-3/2(24 - 5 1/3 )

A. -44

B. 32 1/6

C. -41 1/3

D. -28

Answers

Its D) -28 hope this helped!!

At a chocolate shop, 93 out of the last 217 chocolates sold had mint filling. What is the experimental probability that the next chocolate sold will have mint filling?

Answers

217 chocolate can fill this up and be good

60ft by 60ft wall and a mirror that’s 60ft by 20ft the mirror covers wat percent of the wall?

Answers

Answer:

okay, so we have a wall that is 60 ft. The area of the wall because the wall is a square is just side squared. So the area of the wall is \(60^{2}\), which is 30 600 square feet. The mirror is 20 ft by 60 ft. So the area of the mirror, because its a rectangle is length times width, so that's 20 a 60 so 20 x 60 is gonna give me 1200 square feet. So if we take the area of the mirror and put that over the area, the wall we get 1200 over 30 600, which reduces to one over three. So the mirror is one third the area of the wall.

Step-by-step explanation:

Elisabeth reads 1/5 of her book in 1 1/2 hours. Elisabeth continues to read at this pace. How long does it take Elisabeth to read 3/4 of the book? Enter your answer as a mixed number in simplest form by filling in the boxes.

Answers

It will take her  5 5/8 hours to read 3/4 of the book

Ratio and proportions

Given that Elisabeth reads 1/5 of her book in 1 1/2 hours, this is expessed as:

0.2 of a book = 1.5 hours

In order to determine the time taken to read 0.75 part of the book, we will have:

0.75 of a book  = x

Take the ratios

0.2/0.75 = 1.5/x

0.2x = 1.125

x = 1.125/0.2

x =  5.625

Hence it will take her  5 5/8 hours to read 3/4 of the book

Learn more on ratio and proportion here: https://brainly.com/question/19994681

Write an equation in slope-intercept form (-5,-7);y=-2x+4

Answers

Answer:

Step-by-step explanation:

First, let us substitute x and y values: -7 = -2(-5) + 4

Next, let us simplify using the substitution property of equality: 14 = -7 (SEE BELOW MORE INFO).

Now, this does not make sense yet because 14 cannot possibly equal -7. Therefore, we must add a b value, therefore leading us to the equation:

14 + b = -7

by simplifying, we can conclude that b = -21

Finally, we can plug in the b-value into our original equation:

y = -2x + 4 - 21

After simplifying, we get y = -2x - 17. When this is graphed, we can see that -2x - 17 intersects (-5, -7).

the length of a rectangular sign is 4 times it's width. if the sign's perimeter is 30 inches, what is the area?

Answers

Answer:

36

Step-by-step explanation:

Width = x

Length = 4x

Perimeter = Width + Width + Length + Length (Because there are four sides; two sides are the widgth and two sides are the length)

30 (because 30 is given as the perimeter) = x + x + 4x + 4x

30 = 10x

x = 3

Width = 3

Length = 4(3) = 12

Area = Width * Length

Area = 3 * 12 = 36

The area of the rectangular sign is equal to 36 square inches, if its perimeter is 30 inches.

Let the length of the rectangular sign be L.Let the width of the rectangular sign be W.

Given the following data:

Perimeter of rectangular sign = 30 inches.

Translating the word problem into an algebraic equation, we have;

\(L = 4W\)

Mathematically, the perimeter of a rectangle is given by the formula;

\(P = 2(L+W)\\\\30 = 2(4W + W)\\\\30 = 2(5W)\\\\30 = 10W\\\\W = \frac{30}{10}\)

Width, W = 3 inches

For its length:

\(L = 4W\\\\L = 4(3)\)

Length, L = 12 inches.

Now, we can determine the area of the rectangular sign by using the formula:

\(Area = LW\\\\Area = 12(3)\)

Area = 36 square inches.

Therefore, the area of the rectangular sign is equal to 36 square inches.

Find more information: brainly.com/question/897975

..........................help

..........................help

Answers

Do 180-110-30 and you will get your answer

2x-1=y
3x-1=y

Consider the system of equations above. Which of the following statements about this system is true?

2x-1=y 3x-1=yConsider the system of equations above. Which of the following statements about this system

Answers

Answer:

B; There is only one (x,y) solution and y is negative

Step-by-step explanation:

First, I graphed the two equations. Attached is an image of the equations graphed. Next, I looked for overlapping points. Wherever the two points overlap, there is a solution. When looking at the graph, we can see the lines overlap at only one point, (0,-1). Since y is negative, the answer must be B; there is only one (x,y) solution and y is negative.

If this answer helped you, please leave a thanks!

Have a GREAT day!!!

2x-1=y 3x-1=yConsider the system of equations above. Which of the following statements about this system

Find the length of side a. PLEASE HELP ME QUICK​

Find the length of side a. PLEASE HELP ME QUICK

Answers

Answer:

Well, it's Pythagoras Theorem

hyp²= opp² + adj²

hyp (hypotenuse)

opp (opposite)

adj (adjacent)

Since, we already have hypotenuse and opposite

15²= 9² + adj²

making adjacent the subject of formula

15²-9² = adj²

adj² = 225-81

adj² = 144

make adjacent subject formula by removing the ²

so,

\(adj = \sqrt{144} \)

adj = 12

can someone please help? i need to find the slope of a line. it’s for a test!

can someone please help? i need to find the slope of a line. its for a test!

Answers

Answer:

Step-by-step explanation: To find the slope, you divide the difference of the y-coordinates of 2 points on a line by the difference of the x-coordinates of those same 2 points .

Answer:

The slope is 2/3

Step-by-step explanation:

The equation that the graph gives us is y = 2/3x + 3.

With this equation, we know that the slope is 2/3.

Bonus:

With this equation, we also know that the y-intercept is 3.

An army camp had a food provision of 35 days for 800 soldiers on the first day of the month. On
the same day, some of the soldiers were transferred to another camp. The food provision lasted for
50 days for the remaining soldiers. How many soldiers were transferred to the other camp?
(Assume that each soldier consumes equal quantity of food per day.)

Answers

240 soldiers were transferred to the other camp. Let's assume the number of soldiers transferred to the other camp is "x." we can solve for the unknown variable representing the number of soldiers transferred.

Initially, the food provision was planned for 800 soldiers for 35 days. This means that the total food supply is equal to 800 soldiers multiplied by 35 days, which gives us a total of 28,000 soldier-days of food.

After some soldiers were transferred, the remaining soldiers had enough food to last for 50 days. So the food supply for the remaining soldiers can be calculated as the product of the number of remaining soldiers and the number of days, which gives us (800 - x) * 50 soldier-days of food.

Since the amount of food remains the same, we can set up the following equation:

\(28,000 = (800 - x) * 50\)

Now, let's solve this equation to find the value of x, representing the number of soldiers transferred to the other camp:

\(28,000 = 50 * 800 - 50x28,000 = 40,000 - 50x50x = 40,000 - 28,00050x = 12,000x = 12,000 / 50x = 240\)

By setting up the equation based on the total food supply for the initial and remaining soldiers, we can solve for the unknown variable representing the number of soldiers transferred. In this case, 240 soldiers were transferred to the other camp.

For more such questions on unknown variable.

https://brainly.com/question/20866805

#SPJ8

Find x in this 45°-45°-90° triangle.
22
45
X =

Find x in this 45-45-90 triangle.2245X =

Answers

Step-by-step explanation:

45 and 22 multiplied would be your answer

The difference between eight times a number and three is equal to negative nineteen. What is the number?-22-33

Answers

Given:

The difference between eight times a number and three is equal to negative nineteen.

Required:

We want to find that number

Explanation:

Take the unknown number x

Now,

The difference between eight times a number and three is equal to negative nineteen means

\(\begin{gathered} 8x-3=-19 \\ 8x=-19+3 \\ 8x=-16 \\ x=-2 \end{gathered}\)

Final answer:

-2

Could y’all PLEASE HELP

Could yall PLEASE HELP

Answers

Answer:

should be complementary angles

9482 ÷ 497 answer pls

Answers

Answer:

19.0784708249

Step-by-step explanation:

Other Questions
find the measure of ML!!! Active management strategies assume markets are efficient. True or False? who is dixie damelio,noah beck and cole sprouse EXTRAAAAAA POINTTTSSS ANSWER BOTHHH ________ is credited with leading the change to abstraction in modern art. 3) sahil got 28 questions right on the math test. angelina got 7 more wrong answers than sahil. there were 40 questions on the test. how many answers did angelina get right on the math test? which equation represents this situation? Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG Consider that you have to develop a flight control system. The system is simulated as such that the original system is working. There are many potential hazards with such a system. What model would you suggest to develop the system?. Hormones secreted by the adrenal medulla most likely influence energy metabolism by? Which type of value takes into consideration an individual's equity and income tax implications? There are about 2.2 pounds in one kilogram. If Allison's bag weighs19.54 pounds, about how many kilograms does it weigh? Did you multiplyor divide to find your answer? a. 8.88, divide c. 8.88, multiply b. 39.08, multiply d. 39.08, divide Point charges 1 mC and -2 mC are located at (3, 2, -1) and (-1, -1, 4) respectively. Calculate the electric force on a 10 nC charge located at (0, 3, 1) and the electric field intensity at that point. Surveys indicate that at least _________________ percent of people in the united states experiences one of the stress disorders in any given year. In which number does the digit 8 have a value that is ten times as great as the value of the digit 8 in the number 178,643 suppose that the loanable funds market is in equilibrium. as a result of an increase in the government budget deficit, the a map of a rectangular park has a length of 4 inches and a width of 6 inches. It uses a scale of 1 inch for every mile. What is the actual area of the park? gucci is a well-known luxury brand. the company's brown embossed bags and boxes, complete with a gold ribbon, communicate to the customer that the brand is classy and sophisticated. this indicates how packaging . multiple choice question. can take the place of advertising contributes to low brand equity can mislead a customer can promote a firm's brand image People tend to adapt to living in the environment that they live in. Which is an example of a human adaptation to the desert?Group of answer choicesThey raise camels and goats which require little water and food to survive and provide transportation and foodPeople migrate seasonally from oasis to oasis following food and the little bit of rain which does fallAll of these are human adaptations to a desertPeople dig wells to get water from the aquifers (underground water tables) Explain ow accommodating and collaborating might resolve conflict and contribute to harmonious relationships during your grade 12 academic year Please help me I can figure it out