i need help please can anyone help?

I Need Help Please Can Anyone Help?

Answers

Answer 1
Cell wall.

Made of cellulose and acts as a stronger cell membrane in a plant cell
Answer 2

Answer:

cell membrane

Explanation:

the cell membrane allows things to move in and out of the cell, allowing too much water into the cell is a problem with the cell membrane


Related Questions

Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9

Answers

Transcription is mRNA synthesis, which occurs by complementing a segment of the DNA template strand. The translation is the protein growth, which occurs by adding amino acids coded by mRNA codons. C) the polypeptide is 6 amino acids long.  

What are transcription and translation?

The whole process of protein synthesis includes Transcription and translation.

TRANSCRIPTION

Transcription is the mRNA synthesis process and occurs in the nucleus.

The DNA template strand is read in direction 3'→ 5' to build the mRNA molecule in direction 5'→ 3'. The template strand is the one that is going to be complemented by the mRNA.

mRNA molecule has the same sequence as the DNA coding strand, but it carries uracil instead of thymine.

TRANSLATION

Translation is the process through which polypeptide grows. It occurs in the cytoplasm.

rRNA and tRNA read mRNA in the direction 5'→ 3' and add the correct amino acids to build the new protein.

Amino acids are coded by mRNA codons. Protein synthesis initiates in the AUG start codon -Metionin- and ends when reaching either of the stop codons UAA, UAG, or UGA.

In the exposed example, we have a DNA strand. We know that it is the coding strand, so it has the same sequence as mRNA molecule.

DNA coding strand

5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'

mRNA molecule

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

Kowing mRNA sequence, we can grow the protein.

So first, we need to find the initiation codon (AUG), begining from the mRNA 5' extreme. Then we need to find a stop codon (UAA, UAG, or UGA).

mRNA start codon

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

mRNA stop codon

5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'

So this protein begins in AUG and ends in UAA.

To grow the protein, we need to separate mRNA codons and find the corresponding amino acids.

mRNA codons ⇒ AUG   ACC   GUU   UGG   AAA   CAC   UAA     amino acids ⇒  Met    Thr      Val     Trp      Lys      His    Stop               Protein ⇒ Met-Thr-Val-Trp-Lys-His

According to this reasoning, the polypeptide is 6 amino acids long. Option C) is correct.

You can learn more about protein synthesis at

https://brainly.com/question/16305501

#SPJ1

An organism's genotype is its

Answers

Answer:

An organism's genotyoe is its specific conbination of alleles for a given gene.

Explanation:

Please help me with this

Please help me with this

Answers

Answer:

i think it's the second one

Mosses are an example of which of the following?
decomposers
heterotrophs
autotrophs
detritovores
primary consumers

Answers

Answer:

mosses are autotrophs

Explanation:

-

Which neurotransmitter has widespread effects on a person's attention and emotional state? a. GABA b. serotonin c. dopamine d. endorphins e. norepinephrine.

Answers

The neurotransmitter that has widespread effects on a person's attention and emotional state is norepinephrine

Norepinephrine is a neurotransmitter that is produced in the brainstem and acts as a hormone in the sympathetic nervous system. It plays a key role in regulating attention, mood, and arousal, and is involved in the body's "fight or flight" response to stress. Norepinephrine works by binding to adrenergic receptors in the brain and peripheral nervous system, which can lead to increased heart rate, blood pressure, and breathing, as well as heightened alertness, motivation, and mood. Low levels of norepinephrine have been linked to symptoms of depression, while high levels have been associated with anxiety and stress.

Other neurotransmitters, such as dopamine and serotonin, also play important roles in regulating mood and attention, but norepinephrine is unique in its widespread effects on the sympathetic nervous system and its ability to modulate multiple brain regions involved in emotional processing and cognitive control.

learn more about  Neurotransmitters here

brainly.com/question/28101943

#SPJ11

Explain how parents that do not have a trait can have a child that has the trait

Answers

Answer:

their environment

Explanation:

A child's environment has one of the biggest effects developmentally. Meaning friends, school, location.

The prostate, seminal glands, and bulbo-urethral glands produce __________, the liquid medium in which sperm leaves the body.

Answers

The prostate, seminal glands, and bulbo-urethral glands produce Seminal fluid, the liquid medium in which sperm leaves the body.

What is Seminal fluid?The seminal vesicles and prostate gland make a whitish fluid called seminal fluid, which combines with sperm to form semen when a male is sexually stimulated.Fluid from seminal cysts is thick. It contains fructose, citric acid, proteins, potassium, inorganic phosphorus, and prostaglandins. When the fluid incorporates with sperm in the ejaculatory duct, the fructose evolves the direct source of energy for the sperm outside a man's body.semen, also named seminal fluid, is fluid that is ejected from the male reproductive tract and includes sperm cells, which are competent for fertilizing the female's eggs. Semen also prevents liquids that connect to form seminal plasma, which helps keep the sperm cells possible.

To learn more about Seminal fluid, refer to:

https://brainly.com/question/17099840

#SPJ4

It is noted that the gravitational forces of various galaxy types are not always the consistent. In particular, spiral galaxies have been analyzed to have varying degrees of tightness or looseness. A fact about spiral galaxies is that ______________ stars are generally located in the outer arms of the galaxy while _____________ stars are generally located nearer the center of the galaxy.
A young, olderyoung, older
B smaller, largersmaller, larger
C larger, smallerlarger, smaller
D older, young

Answers

A fact about spiral galaxies is that young stars are generally located in the outer arms of the galaxy while older stars are generally located nearer the center of the galaxy.

What are spiral galaxies?

The majority of spiral galaxies have a flat, spinning disk of stars around a central bulge. Older, fainter stars make up the bulge in the center, which is thought to house a supermassive black hole.

While the cooler red star predominates the bulge, hot young stars are mostly found in the spiral arms of the disk. The galaxy as a whole undergoes a dramatic change in appearance as we go through the various star populations.

Therefore, option A is correct.

Learn more about the galaxies, here;

https://brainly.com/question/19153563

#SPJ1

Some students were building a model of a
digestive system. Which choice best
describes a process they should show with
their model?
F Tissues digest food for the organ
system to absorb.
GCells digest food, which is then
absorbed by organs.
Organs digest food by working
together as a system.
(H)
The organ system uses specialized
cells to digest food.

Answers

The digestive process is divided into four steps: ingestion, chemical and mechanical food breakdown, nutrient absorption, and expulsion of indigestible food.

What does the digestive process entail?

The digestive process starts as soon as something is chewed. In order for food to pass more easily through your esophagus and into your stomach, saliva, a digestive juice produced by your salivary glands, moistens the food. The carbs in food also begin to be broken down by an enzyme found in saliva.

Motility, digestion, absorption, and secretion are the four fundamental functions of the digestive system. Our digestive system transforms our food into energy that we can use.

The digestive system's initial function is to take in food through the mouth. The "ingesting" procedure must take place before anything else can happen.

The complete question is:

Some students were building a model of a digestive system. Which choice best describes a process they should show with their model?

a) F Tissues digest food for the organ system to absorb.

b) G Cells digest food, which is then absorbed by organs.

c) Organs digest food by working together as a system.

d) The organ system uses specialized cells to digest food.

To learn more about digestive system refer to:

brainly.com/question/956634

#SPJ1

What is structure that transports sperm to the ejaculatory duct; sperm are stored here until ejaculation?

Answers

The structure that transports sperm to the ejaculatory duct and stores them until ejaculation is called the epididymis.

The epididymis is a long, coiled tube located behind each testicle. It is responsible for the storage, maturation, and transportation of sperm.

Sperm produced in the testes enter the epididymis, where they are stored and gain the ability to swim. While in the epididymis, they undergo a process called capacitation, which is essential for fertilization.

During ejaculation, the sperm are propelled from the epididymis into the vas deferens, which is a muscular tube that carries the sperm through the prostate gland and into the urethra for ejaculation.

The epididymis plays a crucial role in male fertility, and any damage or blockage to this structure can result in infertility.

To know more about epididymis, refer here:

https://brainly.com/question/3790916#

#SPJ11

Based on the graph below, make a conclusion about the two species. Be sure to support your conclusion with evidence.

Complete the answer in at least four complete sentences.

Based on the graph below, make a conclusion about the two species. Be sure to support your conclusion

Answers

According to the graph, species A enjoys colder temperatures whereas species B enjoys warmer ones. At 15-20°C, the two species are equally plentiful, but beyond 25°C, species A becomes less prevalent, suggesting that it cannot withstand the warmer temperatures that species B prefers.

Which bacteria thrive in hot environments?

Thermophiles can withstand extremely high temperatures, whereas most bacteria and archaea would be damaged and occasionally die at the same temperatures. At high temperatures, thermophiles' enzymes work.

What are psychrophiles, thermophiles, and mesophiles?

The term "mesophile" refers to all other microorganisms. Thermophiles are those that can thrive at temperatures above 55 °C and below 20 °C, respectively. Hyperthermophiles, also known as extreme thermophiles, can survive and thrive in temperatures above 80 °C.

To know more about species visit:-

https://brainly.com/question/13259455

#SPJ1

Question 55
Soil moisture of about __ % of saturation is the best for survival of pathogens
a. 10-20
b. 30-40
c. 5-10
d. 50-60

Answers

 Soil moisture 50-60 plays an important role in the survival of pathogens. The moisture level of the soil affects the growth and survival of microorganisms. A soil moisture level of about 50-60% of saturation is considered the best for the survival of pathogens.

At this level, there is enough moisture for the pathogens to grow and multiply, but not too much moisture that it becomes too saturated and oxygen-starved. It is important to note that different pathogens have different moisture requirements, so the optimal moisture level may vary depending on the type of pathogen present in the soil.

learn more about Soil moisture here:

https://brainly.com/question/30204364

#SPJ11

what can we do to conserve energy to minimize the amount of Reliance we have are non renewable energy resources​

Answers

Unplug lamps, TVs, and other appliances that use energy.

Question 1.
Nucleus is separated from cytoplasm by
(a) nuclear membrane
(b) nucleoplasm
(c) organs
(d) cell membrane

Question 2.
The liquid material in the nucleus is
(a) chromosomes
(b) bacteria
(c) nucleoplasm
(d) nucleolus

Question 3.
Genes are located in
(a) chromosomes
(b) plastids
(c) cytoplasm
(d) lysosome

4. Name an Organelle which serves as a primary packaging area for molecules that will be distributed throughout the cell?
a) Mitochondria b) Plastids c) Golgi apparatus d) Vacuole

Answers

Explanation:

Nucleus is separated from cytoplasm by

(a) nuclear membrane

(b) nucleoplasm

(c) organs

(d) cell membrane

(a) nuclear membrane

Question 2.

The liquid material in the nucleus is

(a) chromosomes

(b) bacteria

(c) nucleoplasm

(d) nucleolus

(c) nucleoplasm

Question 3.

Genes are located in

(a) chromosomes

(b) plastids

(c) cytoplasm

(d) lysosome

(a) chromosomes

4. Name an Organelle which serves as a primary packaging area for molecules that will be distributed throughout the cell?

a) Mitochondria b) Plastids c) Golgi apparatus d) Vacuole

c) Golgi apparatus

Q1: Nuclear membrane
Q2: Nucleoplasm
Q3: Chromosome
Q4: Golgi apparatus

how do you use the microscope differently when looking at objects under low power versus high power?????

Answers

The microscope is used differently when looking at objects under low power versus high power as you boost the magnification and the field of view narrows. On low power, you can make out more of an object.

The depth of focus diminishes each time you choose a greater power. As a result, at higher magnification, less of the material is in focus. The amount of light that penetrates your eye is greatest when the power is low. Resolving power, or the capability to discern two neighboring objects as distinct is diminished as you increase the power. Adjust the light to make up for the loss (sometimes called the iris diaphragm). 

The deepest attention is achieved on targets with the lowest power. The depth of focus diminishes each time you choose a greater power. As a result, at higher magnification, less of the material is in focus. Once more, this makes it simpler to focus on an object when using low power before moving to a higher power.

Learn to know more about microscope on

https://brainly.com/question/820911

#SPJ1

N
If you were looking at a frog's lifecycle, you would find more specialized cells in what stage?
A. the beginning ball of cells
the adult frog
B.
C.
O D.
a developing tadpole
the same amount at all stages
4
Reset
Next

Answers

If you were looking at a frog's lifecycle, you would find more specialized cells in the adult frog stage (option b).

In a frog's lifecycle, the adult frog stage is where you would find more specialized cells. This stage occurs after the frog has gone through various developmental stages, starting from the beginning ball of cells.

1. The beginning ball of cells: This is the initial stage of a frog's development. It starts with the fertilization of the egg and the formation of a zygote. At this stage, the cells are not yet specialized and are in the process of dividing and multiplying.

2. Developing tadpole: After the beginning ball of cells, the zygote undergoes further development and transforms into a tadpole. The tadpole stage is characterized by the presence of gills and a tail. The cells in this stage are becoming more specialized but are still relatively unspecialized compared to the adult frog stage.

3. Adult frog: The adult frog stage is the final stage of the lifecycle. At this point, the tadpole has undergone metamorphosis and has transformed into a fully developed frog. In this stage, the cells have become highly specialized to perform specific functions necessary for the frog's survival, such as muscle cells, nerve cells, and specialized organs like the heart and lungs.

4. The same amount at all stages: It is not accurate to say that there is the same amount of specialized cells at all stages of the frog's lifecycle. As the frog develops and goes through metamorphosis, the cells differentiate and specialize to fulfill specific roles and functions required for each stage of development. The highest concentration of specialized cells is found in the adult frog stage.

For more such questions on cells, click on:

https://brainly.com/question/13920046

#SPJ8

what are the major classes of plants​

Answers

Flowering plants Angiosperms.
Conifers, cycads and allies Gymnosperms.
Ferns and fern allies Pteridophytes.
Mosses and liverworts Bryophytes.

Select the meaning of the suffix -ness.

Able to
Condition of
How something is
Study of

Answers

Answer: is the suffix meaning of the study of?

Explanation:

how does the cell membrane help homeostasis

Answers

Answer:

It allows material to stay in and prevent outside material from entering

Explanation:

How can research into cell division and aging help humans live longer and healthier?

Answers

Answer:

cell division means when the cell will grow old and die if you are able to slow down the cell division process or control it then the aging process can be slowed.

Answer:

because it can help you know what to prevent or to keep doing

Explanation:

Some people who take beta blockers get out of breath when they exercise. Explain why beta blockers can have this effect during exercise.

01. 5

You should refer to information given in Table 1.

[6 marks]




please help me

Answers

Answer:

Explanation:

Beta blockers slow the heart rate, which can prevent the increase in heart rate that typically occurs with exercise. This means that it might not be possible for you to reach your target heart rate — the number of heartbeats per minute you typically aim for to ensure you're exercising hard enough.

50 points, need a REAL answer asap!! please help!! any not serious answers will be reported.

Identify the dispersal vector illustrated and explain and the implications of the following scenario.

Situation: A student was running an experiment using local frog spawn, intending to release the frogs after they’d gone through all the phases of metamorphosis. For the sake of convenience, the student used flowering water plants purchased at an aquarium to create the various environments for the frogs. When the experiment was through, the student released the frogs back into their pond by removing the plants and pouring out the entire habitat. A year later, the student came back to find new, non-native plants of the same variety used in the experiment now growing in the frog pond.

Answers

The dispersal vector illustrated in the scenario is **unintentional introduction through human activity**. The student introduced non-native flowering water plants into the frog pond while conducting the experiment. The plants were purchased from an aquarium and were not native to the area where the experiment was being conducted.

The implications of this scenario are that the non-native plants have established themselves in the frog pond and are now growing there. This can have negative impacts on the ecosystem, as the non-native plants could outcompete native plants for resources, alter the physical and chemical properties of the water, and impact the food web. In addition, the non-native plants could potentially spread to other water bodies, further disrupting ecosystems and potentially leading to the loss of native species.

It is important to note that unintentional introduction through human activity is a major driver of global biodiversity loss. It is crucial for individuals to be aware of the potential impacts of their actions, and take steps to prevent the introduction of non-native species into ecosystems. This can include properly disposing of plants and animals, avoiding the release of pets into the wild, and being cautious when introducing new species into an environment.

at which stage in kohlbergs level of conventional morality does an individual realize the importance of maintaining law and order?​

Answers

Answer:

Stage 4: Law and order orientation

Explanation:

The individual now takes into consideration a larger perspective, that of societal laws. Moral decision making becomes more than consideration of close ties to others. The individual believes that rules and laws maintain social order that is worth preserving.

Blood vessels are connected to nerve fibers which are regulated by the
nervous system. When innervated they respond by doing what?

Answers

Answer:

When blood vessels are innervated they respond by contracting and relaxing their muscle wall, as a result of the activity of the autonomic nervous system.

Explanation:

The nerves that are responsible for the innervation of the blood vessels are called nervi vasorum, and are composed of nerve fibers of the sympathetic and parasympathetic nervous systems.

The innervation of the blood vessels specifically acts on the muscular wall of the vessel, so it contracts or relaxes depending on the activity of the nervous system:

Sympathetic nervous system stimulates vascular contraction.Parasympathetic nervous system makes the vascular smooth muscle relax.

The action of the autonomic nervous system has an effect on blood pressure, being a determinant of normal or pathological behavior of the arteries.

PLEASE HELP ASAP I WILL GIVE BRAINLIEST!!!!!!!

Question 22(Multiple Choice Worth 3 points)

(06.03 MC)

In cattle, a single gene with two alleles determines fur color. The fur can be red, white, or roan. Roan fur has both red and white hair. Which of the following is true about alleles for fur color in cattle?

The allele for roan fur color is dominant over red and white fur color.
The allele for red fur color is dominant over white and roan fur color.
The roan and white alleles are expressed independently of the other.
The red and white alleles are expressed independently of the other.

Answers

Answer:

D

Explanation:

D the red and white alleles are expressed independently of each other. You know this because roan is when both red and white are present. So therefore, because of this, the cow can be red, white, or both depending on what alleles are present.

What do these have in commmon?
friction, air resistance, pushing a box

Answers

The answer to that is motion because they all move

Which sentence BEST explains how a unicelullar organism gets nutrients?

Which sentence BEST explains how a unicelullar organism gets nutrients?

Answers

Since unicellular organisms are composed of just one cell, this means that they cannot have tissues, organs, or systems, so A, C, and D are simply not possible.

B, it takes the nutrients through the cell membrane, would be the correct answer.

Which factor(s) can prevent permanent fixation of an allele (i.e. maintain genetic diversity)?a. Genetic driftb. Gene flowc. Natural selectiond. Mutation

Answers

Only two processes—immigration or chance mutations that result in the emergence of new alleles—can cause a fixed allele to become unfixed.

What elements support genetic diversity?

genetic diversity factors. Four processes that govern evolution—mutation, genetic drift, gene flow, and natural selection—have an impact on genetic diversity. However, only mutations can lead to completely new alleles.

Does genetic diversity suffer from allele fixation?

Single alleles will gradually spread through a population if there is little genetic diversity due to a low fixation probability and a quick fixation time. A population's number of segregating alleles will often rise if the fixation probability or fixation duration is high, enhancing genetic diversity.

To know more about alleles visit:-

https://brainly.com/question/7602134

#SPJ4

a) aniline to 1,3,5-tribromobenzene: fill in the blank 1

Answers

Conversion:

a) aniline to 1,3,5-tribromobenzene: 2,4,6-tribromoaniline

To convert aniline to 1,3,5-tribromobenzene, we need to follow a multistep reaction. Here is one possible synthetic route:

Step 1: Bromination of aniline to form 2,4,6-tribromoaniline

The first step involves the bromination of aniline to form 2,4,6-tribromoaniline. This can be achieved by treating aniline with bromine (\(Br_2\)) and a strong acid, such as hydrobromic acid (HBr) or hydrochloric acid (HCl), under mild conditions. The reaction proceeds via electrophilic aromatic substitution.

The balanced chemical equation for the reaction is:

\(C_6H_5NH_2 + 3 Br_2 + 6 H_2SO_4\) → \(C_6H_2Br_3NH_2 + 6 H_2O + 6 H_2SO_4\)

Step 2: Conversion of 2,4,6-tribromoaniline to 1,3,5-tribromobenzene

The second step involves the conversion of 2,4,6-tribromoaniline to 1,3,5-tribromobenzene. This can be achieved by heating 2,4,6-tribromoaniline with copper powder (Cu) at high temperature in a sealed tube. The reaction proceeds via a reductive dehalogenation reaction, in which the copper powder acts as a reducing agent.

The balanced chemical equation for the reaction is:

\(C_6H_2Br_3NH_2 + 3 Cu\) → \(C_6H_3Br_3 + CuBr + Cu_2O + H_2\)

Therefore, the blank 1 can be filled with "2,4,6-tribromoaniline".

To know more about conversion, refer to the link below:

https://brainly.com/question/16773310#

#SPJ11

how can the equation for photosynthesis be changed so that it represents the equations for respiration?

Answers

There is a significant connection between photosynthesis and cellular respiration. This connection makes life as we know it possible to continue. The reactants in one process serve as the products in the other. It is important to note that the equation for cellular respiration is the exact opposite of the one for photosynthesis:

Cellular Respiration: C6H12O6 + 6O2 → 6CO2 + 6H2O

Photosynthesis: 6CO2 + 6H2O → C6H12O6+ 6O2

The glucose needed to produce ATP during cellular respiration is produced through photosynthesis. The carbon dioxide utilized in photosynthesis is then produced from the glucose. While during photosynthesis water is broken down to create oxygen, during cellular respiration oxygen is mixed with hydrogen to create water. Cellular respiration uses oxygen and produces carbon dioxide, whereas photosynthesis uses carbon dioxide and releases oxygen. Us and the majority of other species utilise the released oxygen for cellular respiration. We take that oxygen in through our breath, and it travels through our blood to all of our cells. Oxygen enables cellular respiration to take place in our cells. With oxygen present, cellular respiration operates most efficiently. Much less ATP would be created without oxygen.

link for reference: https://brainly.com/question/30605632?answering=true&answeringSource=feedPublic%2FhomePage%2F10

Other Questions
Find the length of segment x.46. O12 Find an autonomous differential equation with all of the following properties:equilibrium solutions at y=0 and y=5,y>0 for 0y What is this? Solve for x: 3(x + 1) = 2(x 1) + 6. Appearance and reality are constantly at odds in this play--how is Dr. Rank an example of this? Follow-up research reveals that Piaget ________ preschoolers' ________. underestimated; magical thinking overestimated; animistic beliefs overestimated; abstract thinking underestimated; egocentrism Discuss the key motives that fundraising volunteers might have for engaging with a non-profit organization. A triangle is dilated by a scale factor of n = One-third. Which statement is true regarding the dilation?It is a reduction because n > 1.It is a reduction because 0 < n < 1.It is an enlargement because n > 1.It is an enlargement because 0 > n > 1. Express the limit as a definite integral on the given interval. nlim n[infinity] n i = 1 [3(xi*)3 7xi*]x, [2, 5] Blake is working his way through school. He works two part-time jobs for a total of 22 hours a week. Job A pays $5.70 per hour, and Job B pays $7.30 per hour. How many hours did he work at each job the week that he made $141.40. finding slope from 2 points color by number (1,-1) and (5,-2) conditional data transfers offer an alternative strategy to conditional control transfers for implementing conditional operations. they can only be used in restricted cases. true false Solve the differential equationY"-9y=9x/e^3xby way of variation of parameters. The number of students that study spanish is 3^3 or 27 times the number that speak french uses of topographic maps what temperature warm, cool, hot, or cold and what moisture conditions dry or humid are associated with the four basic types of air masses Amy is looking for a model of the relationship between limiting factors and carrying capacity.Which would be the best model?A. a seesaw because when limiting factors go down, the carrying capacity goes upB. two helium balloons because when limiting factors go up, the carrying capacity goes up Identify the percent of change as an increase or decrease. 24 songs to 78 songs. Find the percent of change After listening to his high-volume car stereo for 15 minutes, Ben fails to realize that the music is loud. This BEST illustrates: the mean credit score is 640 out of 300 used car loan applicants with a standard deviation of 16. assuming a bell-shaped curve, what is the number of loan applicants that fall within a score of 608 and 672? CAN SOMEONE PLEASE HELP ME ON THIS